ID: 926051368

View in Genome Browser
Species Human (GRCh38)
Location 2:9746932-9746954
Sequence GGGGCAGGTTAACATGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926051368_926051373 -8 Left 926051368 2:9746932-9746954 CCGTCCTCATGTTAACCTGCCCC No data
Right 926051373 2:9746947-9746969 CCTGCCCCCCCTGATCTCAGGGG No data
926051368_926051370 -10 Left 926051368 2:9746932-9746954 CCGTCCTCATGTTAACCTGCCCC No data
Right 926051370 2:9746945-9746967 AACCTGCCCCCCCTGATCTCAGG No data
926051368_926051381 2 Left 926051368 2:9746932-9746954 CCGTCCTCATGTTAACCTGCCCC No data
Right 926051381 2:9746957-9746979 CTGATCTCAGGGGTTCTGGAAGG No data
926051368_926051377 -2 Left 926051368 2:9746932-9746954 CCGTCCTCATGTTAACCTGCCCC No data
Right 926051377 2:9746953-9746975 CCCCCTGATCTCAGGGGTTCTGG No data
926051368_926051371 -9 Left 926051368 2:9746932-9746954 CCGTCCTCATGTTAACCTGCCCC No data
Right 926051371 2:9746946-9746968 ACCTGCCCCCCCTGATCTCAGGG No data
926051368_926051382 30 Left 926051368 2:9746932-9746954 CCGTCCTCATGTTAACCTGCCCC No data
Right 926051382 2:9746985-9747007 TGTTCCTCCTGTGACCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926051368 Original CRISPR GGGGCAGGTTAACATGAGGA CGG (reversed) Intergenic
No off target data available for this crispr