ID: 926052476

View in Genome Browser
Species Human (GRCh38)
Location 2:9753826-9753848
Sequence CCGTCGGAGGGGCGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926052476_926052492 11 Left 926052476 2:9753826-9753848 CCTGCCACCCGCCCCTCCGACGG No data
Right 926052492 2:9753860-9753882 AGCCACTTGTCCACAGCCTCGGG No data
926052476_926052491 10 Left 926052476 2:9753826-9753848 CCTGCCACCCGCCCCTCCGACGG No data
Right 926052491 2:9753859-9753881 CAGCCACTTGTCCACAGCCTCGG No data
926052476_926052496 28 Left 926052476 2:9753826-9753848 CCTGCCACCCGCCCCTCCGACGG No data
Right 926052496 2:9753877-9753899 CTCGGGAGTCCCCACAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926052476 Original CRISPR CCGTCGGAGGGGCGGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr