ID: 926054296

View in Genome Browser
Species Human (GRCh38)
Location 2:9765375-9765397
Sequence GAGTTTTAGCAGAGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926054289_926054296 3 Left 926054289 2:9765349-9765371 CCTGGGAAGAGGCAGCCAACAGG No data
Right 926054296 2:9765375-9765397 GAGTTTTAGCAGAGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926054296 Original CRISPR GAGTTTTAGCAGAGGCTGGG TGG Intergenic
No off target data available for this crispr