ID: 926055509

View in Genome Browser
Species Human (GRCh38)
Location 2:9771686-9771708
Sequence TTTGAGAAACCCAGTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926055502_926055509 21 Left 926055502 2:9771642-9771664 CCAAGGCTGACCTAGGTCTCAGG No data
Right 926055509 2:9771686-9771708 TTTGAGAAACCCAGTGAGAAGGG No data
926055507_926055509 -7 Left 926055507 2:9771670-9771692 CCTTACAGTGGGCAGCTTTGAGA No data
Right 926055509 2:9771686-9771708 TTTGAGAAACCCAGTGAGAAGGG No data
926055504_926055509 11 Left 926055504 2:9771652-9771674 CCTAGGTCTCAGGCACAGCCTTA No data
Right 926055509 2:9771686-9771708 TTTGAGAAACCCAGTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926055509 Original CRISPR TTTGAGAAACCCAGTGAGAA GGG Intergenic
No off target data available for this crispr