ID: 926056348

View in Genome Browser
Species Human (GRCh38)
Location 2:9776256-9776278
Sequence CATCTCTAGCCAAGGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926056348_926056361 19 Left 926056348 2:9776256-9776278 CCCCCCAGCCTTGGCTAGAGATG No data
Right 926056361 2:9776298-9776320 CTCCCCACTCCTTCCCAGCTGGG No data
926056348_926056362 20 Left 926056348 2:9776256-9776278 CCCCCCAGCCTTGGCTAGAGATG No data
Right 926056362 2:9776299-9776321 TCCCCACTCCTTCCCAGCTGGGG No data
926056348_926056360 18 Left 926056348 2:9776256-9776278 CCCCCCAGCCTTGGCTAGAGATG No data
Right 926056360 2:9776297-9776319 CCTCCCCACTCCTTCCCAGCTGG No data
926056348_926056354 -9 Left 926056348 2:9776256-9776278 CCCCCCAGCCTTGGCTAGAGATG No data
Right 926056354 2:9776270-9776292 CTAGAGATGTCCCCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926056348 Original CRISPR CATCTCTAGCCAAGGCTGGG GGG (reversed) Intergenic
No off target data available for this crispr