ID: 926059536

View in Genome Browser
Species Human (GRCh38)
Location 2:9796518-9796540
Sequence GGATGCTCGGGGGGTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926059536_926059550 6 Left 926059536 2:9796518-9796540 CCTGGAGGACCCCCCGAGCATCC No data
Right 926059550 2:9796547-9796569 TCTCTCCAGTCAGTGGGGGAAGG No data
926059536_926059554 14 Left 926059536 2:9796518-9796540 CCTGGAGGACCCCCCGAGCATCC No data
Right 926059554 2:9796555-9796577 GTCAGTGGGGGAAGGGAGGCTGG No data
926059536_926059547 2 Left 926059536 2:9796518-9796540 CCTGGAGGACCCCCCGAGCATCC No data
Right 926059547 2:9796543-9796565 CCCCTCTCTCCAGTCAGTGGGGG No data
926059536_926059551 7 Left 926059536 2:9796518-9796540 CCTGGAGGACCCCCCGAGCATCC No data
Right 926059551 2:9796548-9796570 CTCTCCAGTCAGTGGGGGAAGGG No data
926059536_926059555 15 Left 926059536 2:9796518-9796540 CCTGGAGGACCCCCCGAGCATCC No data
Right 926059555 2:9796556-9796578 TCAGTGGGGGAAGGGAGGCTGGG No data
926059536_926059552 10 Left 926059536 2:9796518-9796540 CCTGGAGGACCCCCCGAGCATCC No data
Right 926059552 2:9796551-9796573 TCCAGTCAGTGGGGGAAGGGAGG No data
926059536_926059544 0 Left 926059536 2:9796518-9796540 CCTGGAGGACCCCCCGAGCATCC No data
Right 926059544 2:9796541-9796563 AGCCCCTCTCTCCAGTCAGTGGG No data
926059536_926059543 -1 Left 926059536 2:9796518-9796540 CCTGGAGGACCCCCCGAGCATCC No data
Right 926059543 2:9796540-9796562 CAGCCCCTCTCTCCAGTCAGTGG No data
926059536_926059545 1 Left 926059536 2:9796518-9796540 CCTGGAGGACCCCCCGAGCATCC No data
Right 926059545 2:9796542-9796564 GCCCCTCTCTCCAGTCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926059536 Original CRISPR GGATGCTCGGGGGGTCCTCC AGG (reversed) Intergenic
No off target data available for this crispr