ID: 926060013

View in Genome Browser
Species Human (GRCh38)
Location 2:9799432-9799454
Sequence CTCGGGTCCCCTCTGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926060002_926060013 9 Left 926060002 2:9799400-9799422 CCTTCCTGCCCAGACCACAGCCT No data
Right 926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG No data
926060006_926060013 -5 Left 926060006 2:9799414-9799436 CCACAGCCTGCAAACCTCCTCGG No data
Right 926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG No data
926060000_926060013 14 Left 926060000 2:9799395-9799417 CCCTTCCTTCCTGCCCAGACCAC No data
Right 926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG No data
926060001_926060013 13 Left 926060001 2:9799396-9799418 CCTTCCTTCCTGCCCAGACCACA No data
Right 926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG No data
926060004_926060013 1 Left 926060004 2:9799408-9799430 CCCAGACCACAGCCTGCAAACCT No data
Right 926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG No data
926060005_926060013 0 Left 926060005 2:9799409-9799431 CCAGACCACAGCCTGCAAACCTC No data
Right 926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG No data
926059999_926060013 20 Left 926059999 2:9799389-9799411 CCTCAGCCCTTCCTTCCTGCCCA No data
Right 926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG No data
926060003_926060013 5 Left 926060003 2:9799404-9799426 CCTGCCCAGACCACAGCCTGCAA No data
Right 926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926060013 Original CRISPR CTCGGGTCCCCTCTGGCTCC AGG Intergenic
No off target data available for this crispr