ID: 926061475

View in Genome Browser
Species Human (GRCh38)
Location 2:9807641-9807663
Sequence GGGTGGAGACGGCCTTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926061475_926061481 -9 Left 926061475 2:9807641-9807663 CCCCAGCAAGGCCGTCTCCACCC No data
Right 926061481 2:9807655-9807677 TCTCCACCCCTTCTGGCGCTGGG No data
926061475_926061480 -10 Left 926061475 2:9807641-9807663 CCCCAGCAAGGCCGTCTCCACCC No data
Right 926061480 2:9807654-9807676 GTCTCCACCCCTTCTGGCGCTGG No data
926061475_926061482 -8 Left 926061475 2:9807641-9807663 CCCCAGCAAGGCCGTCTCCACCC No data
Right 926061482 2:9807656-9807678 CTCCACCCCTTCTGGCGCTGGGG No data
926061475_926061487 24 Left 926061475 2:9807641-9807663 CCCCAGCAAGGCCGTCTCCACCC No data
Right 926061487 2:9807688-9807710 ATCTCCTCCCTCCGCGTGTCCGG No data
926061475_926061490 28 Left 926061475 2:9807641-9807663 CCCCAGCAAGGCCGTCTCCACCC No data
Right 926061490 2:9807692-9807714 CCTCCCTCCGCGTGTCCGGCGGG No data
926061475_926061488 27 Left 926061475 2:9807641-9807663 CCCCAGCAAGGCCGTCTCCACCC No data
Right 926061488 2:9807691-9807713 TCCTCCCTCCGCGTGTCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926061475 Original CRISPR GGGTGGAGACGGCCTTGCTG GGG (reversed) Intergenic
No off target data available for this crispr