ID: 926063646

View in Genome Browser
Species Human (GRCh38)
Location 2:9820502-9820524
Sequence AAACAACCCATGCCCCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926063643_926063646 -4 Left 926063643 2:9820483-9820505 CCTGCTTTTCTCCTTAGTAAAAC No data
Right 926063646 2:9820502-9820524 AAACAACCCATGCCCCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926063646 Original CRISPR AAACAACCCATGCCCCACGG AGG Intergenic