ID: 926075498

View in Genome Browser
Species Human (GRCh38)
Location 2:9939673-9939695
Sequence TCTGAAGCCCAAACCGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926075489_926075498 9 Left 926075489 2:9939641-9939663 CCTGTCACTGCCACCCAGAAGTG No data
Right 926075498 2:9939673-9939695 TCTGAAGCCCAAACCGAGGAGGG No data
926075492_926075498 -4 Left 926075492 2:9939654-9939676 CCCAGAAGTGGAGCCACCTTCTG No data
Right 926075498 2:9939673-9939695 TCTGAAGCCCAAACCGAGGAGGG No data
926075493_926075498 -5 Left 926075493 2:9939655-9939677 CCAGAAGTGGAGCCACCTTCTGA No data
Right 926075498 2:9939673-9939695 TCTGAAGCCCAAACCGAGGAGGG No data
926075491_926075498 -1 Left 926075491 2:9939651-9939673 CCACCCAGAAGTGGAGCCACCTT No data
Right 926075498 2:9939673-9939695 TCTGAAGCCCAAACCGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926075498 Original CRISPR TCTGAAGCCCAAACCGAGGA GGG Intergenic
No off target data available for this crispr