ID: 926075509

View in Genome Browser
Species Human (GRCh38)
Location 2:9939710-9939732
Sequence TCTGAAGCCCAAACCGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926075499_926075509 7 Left 926075499 2:9939680-9939702 CCCAAACCGAGGAGGGAGAGCCC No data
Right 926075509 2:9939710-9939732 TCTGAAGCCCAAACCGAGGAGGG No data
926075500_926075509 6 Left 926075500 2:9939681-9939703 CCAAACCGAGGAGGGAGAGCCCA No data
Right 926075509 2:9939710-9939732 TCTGAAGCCCAAACCGAGGAGGG No data
926075496_926075509 17 Left 926075496 2:9939670-9939692 CCTTCTGAAGCCCAAACCGAGGA No data
Right 926075509 2:9939710-9939732 TCTGAAGCCCAAACCGAGGAGGG No data
926075494_926075509 20 Left 926075494 2:9939667-9939689 CCACCTTCTGAAGCCCAAACCGA No data
Right 926075509 2:9939710-9939732 TCTGAAGCCCAAACCGAGGAGGG No data
926075503_926075509 1 Left 926075503 2:9939686-9939708 CCGAGGAGGGAGAGCCCAGGGTC No data
Right 926075509 2:9939710-9939732 TCTGAAGCCCAAACCGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926075509 Original CRISPR TCTGAAGCCCAAACCGAGGA GGG Intergenic
No off target data available for this crispr