ID: 926077383

View in Genome Browser
Species Human (GRCh38)
Location 2:9951942-9951964
Sequence CCGCGCGGGCGGGCGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 936
Summary {0: 1, 1: 1, 2: 21, 3: 122, 4: 791}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926077367_926077383 15 Left 926077367 2:9951904-9951926 CCGCACCTGCAGCGAGCGAGCCG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG 0: 1
1: 1
2: 21
3: 122
4: 791
926077370_926077383 10 Left 926077370 2:9951909-9951931 CCTGCAGCGAGCGAGCCGGGCGC 0: 1
1: 0
2: 1
3: 14
4: 89
Right 926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG 0: 1
1: 1
2: 21
3: 122
4: 791
926077372_926077383 -5 Left 926077372 2:9951924-9951946 CCGGGCGCAGACCCGAGGCCGCG 0: 1
1: 0
2: 0
3: 18
4: 131
Right 926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG 0: 1
1: 1
2: 21
3: 122
4: 791
926077366_926077383 28 Left 926077366 2:9951891-9951913 CCGCGCTGAGGGGCCGCACCTGC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG 0: 1
1: 1
2: 21
3: 122
4: 791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926077383 Original CRISPR CCGCGCGGGCGGGCGGGCGC GGG Intronic
900000169 1:10477-10499 CCGGGCGGGCGGGCCGGCTGAGG - Intergenic
900019874 1:181007-181029 CCGGGCGGGCGGGCCGGCTGAGG - Intergenic
900113727 1:1020057-1020079 GCGGGCGGGCGGGGGGGGGCGGG - Intergenic
900113729 1:1020061-1020083 GCGGGCGGGCGGGCGGGGGGGGG - Intergenic
900113733 1:1020065-1020087 GAGCGCGGGCGGGCGGGCGGGGG - Intergenic
900121319 1:1049773-1049795 CGACGCGGCCGGGCGGGCACTGG - Exonic
900123414 1:1059145-1059167 CCGCGCGGGCGGAGAGGCGCTGG + Intergenic
900190081 1:1349520-1349542 CCGCGCGCGGGGGCGGGGCCGGG - Intergenic
900201254 1:1407606-1407628 CGGCGCGGGCGGGGAGGGGCAGG + Intergenic
900227662 1:1540503-1540525 AGGCGCGGGGGGGGGGGCGCCGG + Intergenic
900269215 1:1778557-1778579 CCGCGCGGGCGGGAGGCGGCGGG + Intronic
900513199 1:3069864-3069886 CCGCGGAGCCGGGTGGGCGCCGG - Intronic
901016628 1:6235686-6235708 CGGCGGGGGCCGGCGGGGGCCGG - Intronic
901086120 1:6613464-6613486 CCCCGCGGCCGAGCCGGCGCGGG + Intronic
901109905 1:6785802-6785824 CCCCGGGGGCGGGCTGGGGCCGG + Intronic
901660298 1:10794875-10794897 GCGGGCGGGCGGGCGGTTGCTGG - Intronic
901673085 1:10867241-10867263 AGGCGCGGGCGGGCGGGCGCCGG + Intergenic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
902476736 1:16692463-16692485 GCCGGCGGGCGGGCGGGCGGTGG + Intergenic
902585781 1:17438099-17438121 CCCGGCGGCCGGGCCGGCGCAGG - Intronic
903078132 1:20787385-20787407 GCGCGGGGACGGGCGGACGCCGG + Intergenic
903263301 1:22142752-22142774 CGGCGCGGGGCAGCGGGCGCGGG - Intronic
903263439 1:22143160-22143182 GCGGGCGGGCGGGCGGCCGGGGG + Intronic
903349863 1:22711052-22711074 GCGGGCGGGCGGGCGGGCGATGG + Intronic
903413714 1:23167880-23167902 CCGGGCGGCTGGGCGGGGGCCGG + Intronic
903735960 1:25530120-25530142 CTGAGCGGGTGGGAGGGCGCTGG - Intergenic
903813254 1:26046369-26046391 CCGCGCGGGAGAGGGGGCGCAGG - Intergenic
904181363 1:28668882-28668904 GGGGGCGGGGGGGCGGGCGCGGG + Intronic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
904673007 1:32180033-32180055 CCTCGCGGCAGGCCGGGCGCGGG - Intronic
904724918 1:32539783-32539805 CCGGGCGGCGAGGCGGGCGCGGG - Intronic
904822869 1:33256593-33256615 CTGCTCGGGCCGCCGGGCGCGGG + Exonic
904942809 1:34177060-34177082 CCGCGCTGCCAGGCGGGCACCGG - Intronic
904988750 1:34574210-34574232 CCGGGCGTGGTGGCGGGCGCCGG - Intergenic
905517177 1:38570279-38570301 CCGCGGGGCAGGCCGGGCGCAGG + Intergenic
905518385 1:38578708-38578730 GGGCGGGGTCGGGCGGGCGCGGG + Intergenic
905717068 1:40161323-40161345 GTGCGCGGGCGGCCGGGGGCAGG + Intergenic
905912135 1:41662322-41662344 GCGGGCTGGCGGGCGGGCGCCGG + Intronic
905995940 1:42380709-42380731 CAGCGCGCGGCGGCGGGCGCTGG - Intergenic
907278006 1:53327613-53327635 CCGCGGGGGCGGGGGGCCGAGGG + Intronic
907429909 1:54405861-54405883 GTGGGCGGGCGGGCGGGGGCCGG - Intronic
908128292 1:61050957-61050979 CCGCGCCGGTGGGTGGGGGCAGG + Intronic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
910694303 1:89995382-89995404 CGGGGCGGGCGGGCGGCCTCCGG - Intronic
910759278 1:90718800-90718822 CTGCGGTGTCGGGCGGGCGCGGG + Intergenic
912246364 1:107965231-107965253 ACGCGCGGGTGGGAGCGCGCCGG + Intergenic
912337633 1:108877205-108877227 TCCCGCGGGCGGGCGGGTCCCGG - Exonic
912416248 1:109509817-109509839 CCGGCCGGGCGGACGCGCGCGGG + Intergenic
912716835 1:111989382-111989404 GCGCCCGGGTGGGTGGGCGCTGG - Intergenic
912716873 1:111989527-111989549 GCGCGCGGGGCGCCGGGCGCGGG - Intergenic
912801599 1:112722951-112722973 CCGGGTGGGCGGGAGGGAGCGGG + Intronic
913209449 1:116570855-116570877 CCGCGCCGGCCGGCGGGTACTGG - Intronic
913544394 1:119853259-119853281 CCGCCTGGGCTGGCGGGCGGGGG - Intergenic
915348284 1:155209050-155209072 CCTCGGGGGAGGGCGGCCGCCGG - Exonic
915495890 1:156282521-156282543 CCTCCCGGGCGGGCGGGGCCCGG - Intronic
915722168 1:157993553-157993575 GGGCGCGGGCGGGCGGGGGGCGG + Intronic
919991267 1:202709857-202709879 CCGCTAGGGCTGGCGGGGGCTGG + Intronic
921029698 1:211326758-211326780 GGGCGCGGGCGGAGGGGCGCGGG - Intronic
921172101 1:212558983-212559005 GCGCGCGGCCCGGCGGGGGCGGG + Intergenic
921189874 1:212699785-212699807 GCGCGCGGGCGGGGCGGGGCGGG - Exonic
921190037 1:212700313-212700335 CCGCGCCGGGGGGCGGACGCAGG - Intergenic
921355564 1:214281443-214281465 CGGCGGCGGCGGGCGGGAGCCGG + Intronic
921384065 1:214551803-214551825 CGGCCCGGGAGGGCGCGCGCCGG + Intronic
921432800 1:215083021-215083043 CGGCGGCGGCGGGCAGGCGCGGG + Intronic
922025179 1:221742869-221742891 GCGGGCGGGCGGGCGGGAGGCGG - Intergenic
922502873 1:226110021-226110043 CCGGGCGCGCGGCCGGGCGGGGG + Intergenic
922739382 1:228006912-228006934 CGGCGCGGGGCGGCGGGGGCGGG - Intergenic
922937246 1:229432227-229432249 CCGGGCGGGAGGGCCGGCGGCGG - Intronic
922958555 1:229625809-229625831 GCGCGCGGGCGGGCGGGGGCCGG - Intronic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
922958617 1:229626008-229626030 CGGCGGGGGCGGCGGGGCGCGGG - Exonic
923126639 1:231039810-231039832 CCGAAAGGGCGGGTGGGCGCGGG + Intronic
923400758 1:233614031-233614053 CGGGGCGGGCGGGCGCGCGGGGG + Exonic
923400762 1:233614043-233614065 GCGCGCGGGGGAGCGGGCGGCGG + Exonic
923611966 1:235504104-235504126 CCGGGCGGGTTGGCGGCCGCCGG - Intronic
923631079 1:235649864-235649886 CCACGCGGGCCTGGGGGCGCAGG + Exonic
923783143 1:237042926-237042948 CCTCCCGGGCGGCCGGGGGCAGG + Intronic
924064778 1:240209759-240209781 CCGGGCGAGGTGGCGGGCGCCGG + Intronic
924090104 1:240492922-240492944 CCCAGCGGCCGGGCGCGCGCGGG + Exonic
924436576 1:244048636-244048658 CCGGGTGGGGGGGCGGGGGCGGG - Intergenic
1062873869 10:930924-930946 CCCCCAGGCCGGGCGGGCGCCGG - Intronic
1063201046 10:3785530-3785552 AGGCGCGGGCGGCCGCGCGCCGG + Intergenic
1063944801 10:11165852-11165874 CCCGGCGGGCAGGCGGGCGGGGG - Intronic
1064009595 10:11725033-11725055 CGGGGCGGGGGGGCGGGGGCAGG + Intergenic
1064022795 10:11823333-11823355 GCGCGCGGGTGGGCGCGCACAGG + Intronic
1064086241 10:12348830-12348852 CCGCGCGGGCGCCCTGGTGCTGG - Intergenic
1064230980 10:13529045-13529067 CCCCGCGGGAGGAGGGGCGCCGG + Intergenic
1064231017 10:13529139-13529161 CCGCGCGGCCAGGCCGGCGGCGG - Intergenic
1065100388 10:22325620-22325642 GCGGGCGGGCGGGCGGGGGAGGG - Intronic
1065100390 10:22325624-22325646 GCGGGCGGGCGGGCGGGCGGGGG - Intronic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1066126468 10:32347205-32347227 CGGCGCGGGCACGCGGGCGGGGG + Intronic
1067068046 10:43114669-43114691 CAGCGAGGGCCGGCGGGCACCGG - Exonic
1067091356 10:43267107-43267129 GCGGGGGAGCGGGCGGGCGCGGG + Intergenic
1067227407 10:44385021-44385043 GCGGGCGGGCGGACGAGCGCGGG + Exonic
1068983270 10:63083590-63083612 CCGGGCGTGGTGGCGGGCGCCGG + Intergenic
1069018940 10:63465137-63465159 CCGCGCGGGCAGGTGGGGGTAGG - Intronic
1069024042 10:63521329-63521351 CCGGGCCGGCGGGCGGGGGCGGG + Intergenic
1069372643 10:67763986-67764008 CCGAGGGGGCGGGCGGGGGGGGG + Intergenic
1069849652 10:71396791-71396813 GAGCGCGGGCGGGCGGGCGGGGG + Intergenic
1069849653 10:71396795-71396817 GCGGGCGGGCGGGCGGGGGCCGG + Intergenic
1069982680 10:72263290-72263312 CCGTGCGTGCTGGCGGGCGCCGG - Intergenic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070257772 10:74826043-74826065 GGGCGCGGGCGGGCGCGCGCGGG - Intronic
1071086829 10:81875254-81875276 CCGGGCGCGGGCGCGGGCGCGGG - Intergenic
1071573699 10:86711429-86711451 GCGGCCGGGCGGGCGCGCGCTGG + Intronic
1072107965 10:92291579-92291601 CCTCGAGGGCGGGCGCGGGCAGG - Intronic
1072294172 10:93993815-93993837 CACCGCGGGCGGCCGGGCGGGGG - Intergenic
1072336551 10:94403067-94403089 GCTCGCGGGCTGGCGCGCGCCGG + Exonic
1072454119 10:95561292-95561314 GCGGCCGGGCGGGCGAGCGCGGG + Intronic
1073109117 10:101050374-101050396 CGGGGCAGGCGGGCGGGCGAAGG - Intergenic
1073328739 10:102657357-102657379 CCACGCAGGCGGCGGGGCGCTGG + Exonic
1073583585 10:104688448-104688470 CCACGCTGGCTGGCAGGCGCTGG - Intronic
1074056042 10:109923528-109923550 GCGGGCGGGCGGGCTAGCGCCGG + Exonic
1074138052 10:110644551-110644573 CCTCGCGGGCCGGAGGGTGCCGG - Exonic
1074182920 10:111078879-111078901 TCGCGCGGCCCGGCCGGCGCGGG - Exonic
1074377493 10:112951635-112951657 CGGCGCGGGCGGGCGGGCAGCGG - Intronic
1074503342 10:114044973-114044995 CCGGGCGGCGGCGCGGGCGCGGG - Exonic
1074829880 10:117241007-117241029 CGGCGCGGGCGGGCGGAGGCCGG + Intergenic
1075040629 10:119104389-119104411 GGCCGCGGGCGGGCGGGCGAGGG - Intronic
1075438509 10:122461808-122461830 CTGCGAGGGCGGCCGGGCCCGGG + Exonic
1075693754 10:124418784-124418806 CGGGGGAGGCGGGCGGGCGCGGG - Intronic
1075748358 10:124743683-124743705 AGGCCAGGGCGGGCGGGCGCGGG - Intronic
1075801848 10:125159410-125159432 CGGCGGGCGCGGGCGGGGGCCGG - Intronic
1075802284 10:125160752-125160774 CTCGGCGGGCGGGAGGGCGCGGG - Intronic
1076327842 10:129642209-129642231 CTGGGCGGGCGGGCGGGCGTAGG + Intronic
1076404670 10:130203874-130203896 GGGCGGGGGCGGGCGGGGGCGGG - Intergenic
1076404676 10:130203884-130203906 GGGCGGGGGCGGGCGGGGGCGGG - Intergenic
1076554295 10:131311824-131311846 GGGCGCGGGCGGGCGGGGACCGG - Intergenic
1076683547 10:132186996-132187018 GCGGGCGGGCGGGCGGGCGGGGG - Exonic
1076734659 10:132453228-132453250 TCGCGGGGCAGGGCGGGCGCTGG + Intergenic
1076792877 10:132786097-132786119 CGGGGCGGGCGGGCGGGCGGCGG + Intergenic
1076792921 10:132786252-132786274 CGGCGGGGGCGCGCGGGCGGGGG - Intergenic
1076949168 10:133668914-133668936 GGGCCCGGGCGGGCGGGCGACGG - Intronic
1076950152 10:133672213-133672235 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
1076953115 10:133682132-133682154 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
1076954099 10:133685431-133685453 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
1076955083 10:133741783-133741805 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
1076957062 10:133748403-133748425 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
1076959034 10:133755011-133755033 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
1076960023 10:133758321-133758343 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
1076961007 10:133761620-133761642 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
1077010089 11:375786-375808 CCGCGCGGGGGCGAGGGCGGGGG + Intronic
1077048054 11:554935-554957 CCGCGAGGGAGGGCGCGGGCGGG - Exonic
1077053162 11:576727-576749 GCGGGCGGGCGCGCGCGCGCTGG + Intronic
1077090859 11:777617-777639 CCGCGCGCCCGGGCGGTCGCAGG + Exonic
1077322111 11:1947183-1947205 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077544885 11:3165010-3165032 CCGCGGGGCCGGTCGCGCGCTGG - Intronic
1078216319 11:9314725-9314747 TCCCGCGGGCGGGCCGGGGCGGG - Exonic
1078527324 11:12110756-12110778 TGGGGAGGGCGGGCGGGCGCGGG + Intronic
1078986661 11:16605062-16605084 CCGCGGGAGCGGCCGGGCTCGGG + Intronic
1079238465 11:18706147-18706169 CTGCGCGGGCGGGGCGGGGCAGG + Intronic
1080283593 11:30585375-30585397 CGGCGCGCGCGGGCGGCCCCGGG + Intronic
1080540094 11:33257296-33257318 CAGCGCTGCCGGGCGGGCGGTGG + Intronic
1080551288 11:33375994-33376016 CCGGCCGGGCGCGCGGGAGCGGG + Intergenic
1081938076 11:46918412-46918434 CCGCGCCGTCCGGCGGGAGCCGG - Exonic
1082787483 11:57324811-57324833 GCGCGGGGGCGGTCGGGCGAAGG - Intronic
1083048217 11:59755262-59755284 CCGGGCGGCCGGGCGGTGGCGGG + Exonic
1083609860 11:63999607-63999629 CCGCGGGGGAGGGCGGGAGGCGG - Intronic
1083657003 11:64234610-64234632 CCGGGCGGGCGGGCGGCCGGTGG - Exonic
1083747636 11:64744645-64744667 CGGCGCGGGCGGGCTGGGGGCGG - Intronic
1083753865 11:64778564-64778586 CCGCGGGGGCGGGCCGGGGGCGG + Intronic
1083895094 11:65616013-65616035 CCGAGCCGGCAGGCAGGCGCGGG - Exonic
1083920984 11:65781266-65781288 CTGCGCGGCTTGGCGGGCGCTGG - Intergenic
1083922324 11:65787526-65787548 GCGGGCGGGCGGGCGGGCGCAGG + Intronic
1083993133 11:66258549-66258571 GGGTGCGGGCAGGCGGGCGCCGG - Exonic
1084065977 11:66704737-66704759 CCGGGCAGGCGAGCGAGCGCGGG - Exonic
1084069942 11:66727804-66727826 CGGGGCGGACGGGCCGGCGCCGG - Intronic
1084070076 11:66728179-66728201 CCGGGCGGGCGGGGGCGCGGCGG + Intronic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084251564 11:67903373-67903395 CCGCGCGTGGTGGCGGGCGCCGG + Intergenic
1084295931 11:68213438-68213460 CGGGGCGCGGGGGCGGGCGCCGG - Intronic
1084526911 11:69703605-69703627 GCGCGCGGCGGGGCGGGCGGGGG + Intronic
1084972993 11:72781595-72781617 CAGCGACGCCGGGCGGGCGCGGG + Intronic
1085982769 11:81744599-81744621 CCACGGGGGAGGGCGGGCGTGGG + Intergenic
1086590481 11:88509178-88509200 GAGCGCGGCCGCGCGGGCGCCGG + Exonic
1087014614 11:93543213-93543235 GCGAGCCGGCGGGCGGGCGCGGG - Intronic
1087404903 11:97718064-97718086 CCGCGATGGTGGGCCGGCGCGGG - Intergenic
1088868954 11:113875415-113875437 CCGCGGCGGCGAGCGGGAGCTGG - Intronic
1089346990 11:117797004-117797026 CTGCGCGGGCGGCTGGGCGGCGG - Intronic
1089497344 11:118914375-118914397 GCAGGCAGGCGGGCGGGCGCTGG - Intronic
1089537349 11:119168904-119168926 CCGCGCAGGCGGGCGGAGGTGGG + Exonic
1090710024 11:129375718-129375740 TGGCACGGGCGGGCGGGGGCGGG + Intergenic
1090736912 11:129618249-129618271 CCGCGCAGTCGGCGGGGCGCGGG - Intergenic
1091219359 11:133920903-133920925 CCCCGCGGGCTGGAGGGCCCCGG - Exonic
1091286672 11:134412055-134412077 GCGCGCGGGAGGGAGGGCGCGGG + Intergenic
1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG + Intergenic
1091301978 11:134513790-134513812 CCGCGCGGGTGTGCGGGGACGGG + Intergenic
1202805127 11_KI270721v1_random:2496-2518 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1091373252 12:10594-10616 CCGGGCGGGCGGGCCGGCTGAGG - Intergenic
1091718469 12:2795699-2795721 CCGCCCGGGTGGGCGAGCCCTGG - Intronic
1091740780 12:2959285-2959307 CGCCGCGCGCGGGCGGGCGAGGG - Intergenic
1092045950 12:5431997-5432019 CGGCGCGGGCCGGCGGGGGAGGG + Intergenic
1092163579 12:6329327-6329349 GGGCGCGGGCGGGAGGGCGGCGG + Exonic
1092843344 12:12562962-12562984 GGGGGCGGGCGCGCGGGCGCGGG - Intergenic
1095196055 12:39318836-39318858 CCGGGCGTGGTGGCGGGCGCCGG + Intronic
1095752975 12:45730347-45730369 GCGGGCGGGCGGCCCGGCGCCGG + Intronic
1095810871 12:46372410-46372432 CCGCGCGGGAAGGCGGCCGCGGG - Intronic
1096073566 12:48788936-48788958 CCGCGGGGGCGGCGGGGCGGGGG - Intronic
1096099027 12:48957597-48957619 CAGCACCGGCGGCCGGGCGCTGG + Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096143912 12:49264947-49264969 CCGCGGGTGCGGCCGGGCGCAGG + Exonic
1096241340 12:49961819-49961841 GGGGGCGGGCGGCCGGGCGCGGG - Intergenic
1096674381 12:53218780-53218802 GCGGGCGGGGCGGCGGGCGCTGG - Intronic
1096710479 12:53452164-53452186 GAGGGCGGGCGGGCGGGCGGAGG - Exonic
1096840931 12:54378983-54379005 CCGCAGGGGCGGGCGGGGACGGG + Intronic
1097218188 12:57430632-57430654 CCGCACGGGCGGGCGCGAGGAGG - Intronic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1100391282 12:94148271-94148293 CACCGCGGGCGGACGGGCGCGGG + Intergenic
1100611519 12:96194857-96194879 CCGCGCGGGAGGGCCGGCCGCGG + Intronic
1100869353 12:98894662-98894684 CCGCGAGGGCTGGCGGGCTCTGG + Intronic
1101371845 12:104137933-104137955 CCGGGCCGGGGAGCGGGCGCGGG - Intronic
1101494001 12:105236295-105236317 CCCCGCGAGCCGGCGAGCGCAGG - Intronic
1101750844 12:107581309-107581331 GCGCGGGGGCGGGCGGGGGGCGG + Intronic
1101783827 12:107864366-107864388 CCGCGCTCGAGGGCAGGCGCGGG + Intergenic
1101970608 12:109309726-109309748 CCGCGCGGGCTGGCGCGCAGCGG + Intergenic
1102046592 12:109833413-109833435 ACCCGCGGGCGGACGGGCGCCGG - Intergenic
1102068652 12:109999605-109999627 CAGGGCAGGCAGGCGGGCGCGGG + Exonic
1102254033 12:111405960-111405982 CCGGGCGGGCAGCCGGGCGGAGG - Exonic
1102395284 12:112580544-112580566 CCGGGCGTGGTGGCGGGCGCCGG - Intronic
1103364003 12:120369314-120369336 CCGGGCTCGCGGGCGAGCGCGGG - Intergenic
1103488238 12:121296881-121296903 CCGAGCCGGCGGGGGCGCGCAGG - Intronic
1103547587 12:121713024-121713046 CCGCCCGGGCCGGGGGGCTCAGG - Intronic
1103563492 12:121804315-121804337 GCGAGCGGGCGGGCGGGCGGCGG + Intronic
1103698489 12:122835428-122835450 CCTCCCCGGCGGGCGGGCCCGGG + Exonic
1103705112 12:122867232-122867254 CCACGCGGGGGGGCAGGGGCGGG + Exonic
1103899461 12:124295669-124295691 CCGCGTGGGCGGGTGGGTGAGGG + Intronic
1103918884 12:124389352-124389374 GCGGGCGGGCAGGCGGGCGGGGG + Intronic
1104568222 12:129903727-129903749 CCGGGCTGGCTAGCGGGCGCTGG + Intergenic
1105471998 13:20703496-20703518 CTGCGCGGGCTGGCTGGGGCGGG + Intronic
1105525607 13:21175417-21175439 CCGGGCGTGGTGGCGGGCGCCGG - Intronic
1105830668 13:24160953-24160975 CGGCTCTGCCGGGCGGGCGCGGG + Intronic
1106109048 13:26760838-26760860 GCGGGCGGCCGGGCGCGCGCGGG - Intergenic
1106735853 13:32586980-32587002 CGGCGGCGGCGGGAGGGCGCGGG - Intronic
1107133500 13:36920309-36920331 GCGCGGCGGCGGGCGGGGGCGGG - Intronic
1107935228 13:45340846-45340868 CCGCGCCGGCGGCCGCACGCGGG + Intronic
1108542071 13:51453635-51453657 CGGCGCGAGCGGGCGCGGGCGGG + Intronic
1109858800 13:68171011-68171033 CGGCGCTTGCGGGCGGGCGTAGG + Intergenic
1112172146 13:96984938-96984960 CCGGGCGTGGTGGCGGGCGCTGG - Intergenic
1113201065 13:107867593-107867615 GCGCGGGGGCGGGCGGCGGCGGG + Intergenic
1113655912 13:112067732-112067754 CCGCCGGGGCGGGCGGCGGCGGG + Exonic
1113834753 13:113321496-113321518 CTGGGCGCGCGGGCGGGGGCGGG - Intronic
1114452680 14:22837351-22837373 GCGCGCCGGCGGGAGAGCGCTGG - Intronic
1114514091 14:23286186-23286208 AGGCGCAGGCGGGCGGGCACGGG + Intronic
1115851903 14:37595583-37595605 CCAGGCGGGCGGGCGGGCTAGGG + Intronic
1116018229 14:39432008-39432030 CTGCGGGGGCGGCCGGGAGCCGG - Exonic
1116945285 14:50830723-50830745 CTGCGCGGGCGGGGGCGGGCCGG - Intronic
1117368276 14:55052090-55052112 CTGCGGGGCGGGGCGGGCGCGGG + Intronic
1118285271 14:64465403-64465425 CGGAGCGGGCGGGCAGGGGCGGG - Intronic
1119318425 14:73714428-73714450 CCGCGGGGGCGGGACGGGGCGGG - Intergenic
1119469046 14:74882142-74882164 CCGCGCGGGCTGGGCGGCCCGGG + Intronic
1120914804 14:89701687-89701709 CCCCGCTGGCGCGCCGGCGCCGG - Intergenic
1121074928 14:91060244-91060266 CCGCGCGGGGCTGGGGGCGCGGG - Intronic
1122082385 14:99274593-99274615 ACGCGCGGGCGGGCGGACGCAGG + Intergenic
1122130857 14:99604040-99604062 GCGCGCGGGCGGGGGGCGGCCGG + Intergenic
1122505471 14:102229125-102229147 CCGCGGGTGCGGCAGGGCGCAGG + Exonic
1122543336 14:102509596-102509618 CCCCGCGGGCGAGCGGGCAAAGG + Exonic
1122689009 14:103522765-103522787 CCGGGCGGCCGGGCGGGGGCGGG + Exonic
1122749399 14:103921531-103921553 CCGAGCGCGCAGGCGCGCGCAGG + Intronic
1122768175 14:104085570-104085592 CCGCGGAGGCGGGCGGGGGCAGG - Intergenic
1122779166 14:104136402-104136424 ACGCGCGGGCGGGGCGGCGGTGG + Intergenic
1122840838 14:104461851-104461873 CCGGGCAGCCGGGAGGGCGCAGG - Intergenic
1122894810 14:104751681-104751703 CAGCGCCGGCGGGCCGGCACTGG + Intergenic
1122917323 14:104865189-104865211 CGGCGCGGCCGGGCGGGGGCGGG + Intergenic
1122975313 14:105168493-105168515 CTCGGAGGGCGGGCGGGCGCTGG - Exonic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1123004442 14:105314656-105314678 CGGCGCGGGTCGGAGGGCGCCGG + Exonic
1123630714 15:22258137-22258159 GCCGGCGGGCGGGCGCGCGCGGG - Intergenic
1123675134 15:22703265-22703287 CCGGGCGTGGTGGCGGGCGCCGG - Intergenic
1124142287 15:27088249-27088271 GCGGGCGCGGGGGCGGGCGCGGG + Intronic
1124142293 15:27088261-27088283 GCGGGCGCGGGGGCGGGCGCGGG + Intronic
1124327144 15:28776262-28776284 CCGGGCGTGGTGGCGGGCGCCGG - Intergenic
1125329073 15:38564742-38564764 GCTCGAGGGCTGGCGGGCGCCGG - Exonic
1125541325 15:40471429-40471451 CCTCGCGGCCGGGCGGGTGCAGG - Exonic
1125565956 15:40678525-40678547 CCGGGCGTGGTGGCGGGCGCCGG - Intergenic
1125575793 15:40754820-40754842 GCAGGCGGGCGGGCGGGCGGGGG + Exonic
1125918585 15:43510844-43510866 CCGCAGGGGCGGGCCGGAGCTGG - Intergenic
1126281666 15:46958952-46958974 CCGGGCGCGGTGGCGGGCGCCGG - Intergenic
1126767053 15:52019604-52019626 CCGCGCGGGCGGGCGGGCGGCGG + Intronic
1126800840 15:52295477-52295499 CAGGGCGGGCGGGCGCGCGCTGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1128067863 15:64775615-64775637 CGGCGGCGGGGGGCGGGCGCCGG + Intergenic
1128067874 15:64775634-64775656 CCGGGGGAGGGGGCGGGCGCCGG + Intergenic
1128454130 15:67823244-67823266 GCCCGCGGGCGGGCGGACCCGGG + Intronic
1128866062 15:71115792-71115814 CCGGCGGGGCGGGCTGGCGCGGG + Intronic
1128982353 15:72197151-72197173 CCGGTCGGGCGGGCTGGGGCCGG - Intronic
1129189276 15:73927898-73927920 ACGCGCGGCCGGAGGGGCGCCGG - Intronic
1129274007 15:74433708-74433730 CCGCGCGGCCGGTCAGGCGCGGG - Intronic
1129463117 15:75709843-75709865 CTGCCCGGGCGGGCAGGCGTAGG + Intronic
1129721767 15:77881558-77881580 CTGCCCGGGCGGGCAGGCGTAGG - Intergenic
1129823761 15:78621016-78621038 GCGGGCGGGCGGGCGTGCGCGGG + Exonic
1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG + Exonic
1130040967 15:80404767-80404789 ACCCGCGGGCGGCCGGACGCTGG + Intronic
1130335295 15:82952715-82952737 AGGCGCGGGCGGGCGGGGGCTGG + Exonic
1130994238 15:88895229-88895251 CGGCGCGGGGATGCGGGCGCCGG - Intronic
1132398103 15:101489181-101489203 TCGCCCGGGGGGGCGCGCGCGGG - Intronic
1132512787 16:352569-352591 CGGAGCGGGCGGGTGGGAGCTGG - Exonic
1132522231 16:397135-397157 GCTCCCGGGCGGGCGGGGGCGGG + Intronic
1132527717 16:425898-425920 CGGCGCGGGCGGGCGCGCGCGGG - Exonic
1132544732 16:527950-527972 CGGCGGGGGCGAGCGGGCCCGGG + Exonic
1132583540 16:695922-695944 ACCTGCAGGCGGGCGGGCGCCGG + Exonic
1132585999 16:705964-705986 CCGCGCGCGGGGGCCGGGGCGGG - Intronic
1132591464 16:728091-728113 GCGGGCGGGCGGGCGGGGGCCGG - Intronic
1132591466 16:728095-728117 CCCTGCGGGCGGGCGGGCGGGGG - Exonic
1132663352 16:1071171-1071193 CCCTGCGGGTGGGTGGGCGCTGG - Intergenic
1132698296 16:1211612-1211634 CTGGGCGGCCGGGCGGGAGCTGG + Intronic
1132719808 16:1309979-1310001 CCGAGCGGCCGGGCCGCCGCAGG + Intronic
1132741294 16:1414576-1414598 GGGCGCGGGCGGGGGGCCGCAGG + Intronic
1132879546 16:2155905-2155927 CCGCGCGGTGGGGCGGGATCGGG + Intronic
1132904135 16:2273566-2273588 CCTCGCGGTGGGGCGGGCCCAGG - Intergenic
1132943560 16:2520258-2520280 GCGGGCGGGCGGGCGGGCGCCGG + Intronic
1132947131 16:2537951-2537973 GCGCGGGGGCGGGGCGGCGCCGG + Exonic
1133212811 16:4272592-4272614 CCGCCCGGGCGGGCTGGCCGGGG + Intronic
1133286669 16:4693912-4693934 CGGCGCGGGCGGGCCCGGGCGGG + Intronic
1136037220 16:27549626-27549648 GCGGGCGGGCGGGCGGGCGCAGG - Intronic
1136141626 16:28292485-28292507 CCGGGCGGGCAGGTGCGCGCTGG + Intergenic
1136146649 16:28320315-28320337 CCGCGCCGACGGGCTGGCGGTGG + Exonic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1136540010 16:30923818-30923840 GCGCGCGGGCTGGGGGGGGCGGG + Intronic
1136627799 16:31472457-31472479 GCCCGCGGGCGCCCGGGCGCGGG + Intronic
1136891920 16:33976880-33976902 CCGGGCAGGCGGGCGGGCATGGG - Intergenic
1137426393 16:48384870-48384892 CCTCCCGGGCGCGCGGGGGCCGG + Intronic
1137617713 16:49856998-49857020 GCTGGCGGGCGGGCCGGCGCCGG - Intronic
1137787581 16:51151337-51151359 GCGGGCGGGCCGGCGGGCGGGGG - Intronic
1138178708 16:54928780-54928802 CCGCGCGGGCGCGCGGGCCGCGG + Intergenic
1138360674 16:56425134-56425156 GCGCTCGGCCGGGCGGGCGCCGG + Exonic
1138450779 16:57092578-57092600 CGGGCCGGGCGGGCGGGCGGCGG - Exonic
1138619147 16:58197891-58197913 CCGCGGGGGCGGGCGGGCTGGGG + Exonic
1139215500 16:65122112-65122134 GCGGGCGGGCAGGCGGGTGCGGG + Exonic
1139448730 16:67014245-67014267 CGGGGCGGACGTGCGGGCGCCGG + Intergenic
1139534487 16:67562918-67562940 GCGGGCGGGCGGGCGGGCGTGGG - Intronic
1139644307 16:68316978-68317000 AAGGGCGGGCGGGCGGGCGGTGG + Intronic
1140462247 16:75148960-75148982 CCCGGCGGGCGCGCGCGCGCGGG + Intronic
1141231341 16:82170352-82170374 GCTCGCGGGGTGGCGGGCGCGGG + Intergenic
1141430520 16:83968493-83968515 CCGCGGGGACTGGCCGGCGCCGG - Intergenic
1141481999 16:84313040-84313062 GCGCGCGGCCTGGCAGGCGCCGG - Exonic
1141830862 16:86509566-86509588 GCGAGCGGGCGGGCAGCCGCCGG - Intergenic
1141972337 16:87492442-87492464 GCCGGCGGGCGGGCGCGCGCGGG + Intergenic
1141989588 16:87602467-87602489 GCGCGCGGGCGGGCGGGGTGCGG + Intronic
1142078065 16:88131893-88131915 CAGAGCGGGCAGGTGGGCGCGGG - Intergenic
1142230278 16:88896881-88896903 CAGCGCGGGAGGGAGTGCGCGGG - Intronic
1142549931 17:732397-732419 CCCGGCGGGCGGGTGGGCGGGGG - Exonic
1142637721 17:1268408-1268430 GGGCGGGGGCGGGCGGGGGCGGG - Intergenic
1142812625 17:2402212-2402234 GCGGGCGGGCGGGCGGGCGACGG - Intergenic
1142860079 17:2755885-2755907 CCGGGTGGGCGGAGGGGCGCCGG + Intergenic
1143026615 17:3945018-3945040 ACGCGCGGGCGGGCGGCCTGGGG - Intronic
1143078554 17:4365694-4365716 CCACGCGGGCGCGAGGGTGCCGG - Intronic
1143174918 17:4950055-4950077 CCGCGCGGGCCGGCGGGGCGGGG + Intronic
1143189533 17:5031675-5031697 TCTCCCGGGCGGGCGGGCGGTGG + Intergenic
1143247798 17:5500779-5500801 GCGCGCGGGCGGGAGGGCGCAGG - Intronic
1143321201 17:6070386-6070408 GCGGGCGGGCGAGCGGGCGCCGG - Intronic
1143904616 17:10198730-10198752 CCGCGAGGGCTGGCCGGGGCCGG + Intergenic
1144438320 17:15260871-15260893 CCGCGCGGGCGGTCGGGCTGCGG - Intronic
1144656824 17:17042414-17042436 GCGGGCGGGCGGCCGGGCGCGGG - Intergenic
1144781343 17:17810010-17810032 GCGGGCGGGCAGGCGGGCTCCGG - Exonic
1145186787 17:20801815-20801837 CCGGGCGGGCGGGGTGGCTCAGG + Intergenic
1145750009 17:27349049-27349071 CCGCGCTGGGGCGCGGGCGGCGG + Intergenic
1145904337 17:28508015-28508037 CAGCGCGGGCGGGGCGGGGCTGG - Intronic
1145962896 17:28897670-28897692 GCGAGCGGGCGGCCGGCCGCTGG - Exonic
1146167478 17:30600950-30600972 CCGGGTGGGCGAGCTGGCGCGGG + Intergenic
1146356991 17:32142652-32142674 CCGTGCGTGCGGGCGGAGGCCGG + Exonic
1146492673 17:33293294-33293316 CCGGGCGGGCGGGGCGGCGGCGG + Intronic
1146763488 17:35498071-35498093 CGGCGAGGGCGGCGGGGCGCGGG + Intronic
1146888275 17:36486849-36486871 CCGGGAGGCCGGGCGGGAGCGGG + Intronic
1146926536 17:36749687-36749709 ACACGCGGGGGAGCGGGCGCTGG - Intergenic
1147006353 17:37406972-37406994 GCGGGCGGGCGGGCGGGTGGCGG + Intronic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147168697 17:38606041-38606063 CCGCCCGGGGCGGCGGGGGCGGG + Intergenic
1147907552 17:43832917-43832939 GCGCGCGGCGGGGCGGGCGCGGG + Intronic
1148095772 17:45051751-45051773 GCGGGCGGGCGGGCGGGGCCGGG + Intronic
1148095787 17:45051783-45051805 GCGGGCGGGCGGGCGGGGCCGGG + Intronic
1148095802 17:45051815-45051837 GCGGGCGGGCGGGCGGGGCCGGG + Intronic
1148095817 17:45051847-45051869 GCGGGCGGGCGGGCGGGGCCGGG + Intronic
1148095828 17:45051875-45051897 TTGGGCGGGCGGGCGGACGCGGG + Intronic
1148095838 17:45051903-45051925 TTGGGCGGGCGGGCGGACGCGGG + Intronic
1148095848 17:45051931-45051953 TTGGGCGGGCGGGCGGACGCGGG + Intronic
1148095858 17:45051959-45051981 TTGGGCGGGCGGGCGGACGCGGG + Intronic
1148095868 17:45051987-45052009 TTGGGCGGGCGGGCGGACGCGGG + Intronic
1148095878 17:45052015-45052037 TTGGGCGGGCGGGCGGACGCGGG + Intronic
1148095888 17:45052043-45052065 TTGGGCGGGCGGGCGGACGCGGG + Intronic
1148262127 17:46193132-46193154 CCGGGAGGGCGGGCGGGCGGGGG + Intronic
1148271728 17:46266919-46266941 GCGCGCGCGCGGCCGGGCGGCGG - Intergenic
1148419243 17:47531635-47531657 CCGGGAGGGCGGGCGGGCCTCGG + Intronic
1149461456 17:56833417-56833439 CCTCGGGCGCTGGCGGGCGCGGG + Intronic
1149626609 17:58084180-58084202 CGGCGCGGGCGGGAGGTCGGGGG + Intronic
1149678587 17:58488096-58488118 CCGCCCGGGCCGGGGGGCGGTGG - Exonic
1149685399 17:58531929-58531951 GCAGGCAGGCGGGCGGGCGCGGG - Intronic
1149994487 17:61399604-61399626 CCGCAGGCGCGGGCGGGCGGTGG + Intergenic
1149994772 17:61400600-61400622 GCGGGCGGGCGGGCGGGCTGGGG + Intronic
1150373680 17:64662406-64662428 CGGGGCCGGCGGGCGCGCGCAGG + Intergenic
1150489015 17:65561705-65561727 CGGCGGGGGCGGGCCGGGGCGGG - Intronic
1150764657 17:67993635-67993657 GAGCGCGGGCGGCCGGGCGGCGG + Intronic
1150840386 17:68601024-68601046 CACCGCGGGCGGACGGGCGACGG + Exonic
1150840484 17:68601416-68601438 CCGAGCGAGGGGGAGGGCGCAGG - Intergenic
1151453540 17:74213465-74213487 CGGCGGGGCGGGGCGGGCGCGGG + Intergenic
1151472330 17:74326123-74326145 GCGCGGGGAGGGGCGGGCGCCGG + Intergenic
1151591393 17:75047102-75047124 CCGCGCGGGTCCCCGGGCGCTGG + Intronic
1151821982 17:76501461-76501483 GCGCGCGGGCGGCCGGGAGGCGG + Intronic
1152049178 17:77959066-77959088 CGGCGCGGGCGAGTGGGCGGCGG - Intergenic
1152349732 17:79778017-79778039 CAGCGAGGGGGGGCGGGTGCGGG - Intergenic
1152349756 17:79778062-79778084 CAGCGCGCGGGGGCGGGCGGCGG + Intergenic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152616678 17:81341210-81341232 CCGCGCGGGGTGGCGGCCGGCGG + Intergenic
1152663113 17:81552131-81552153 CCGCGGGGGCGGGAGGGACCGGG - Intronic
1152745699 17:82037649-82037671 CCTCGCGGGCCGCCGGGTGCTGG - Exonic
1152965646 18:111867-111889 GGGCCCGGGCGGGCGGGCGACGG + Intergenic
1153382602 18:4455378-4455400 CGGAGCCGGCGGGCGGGCGGCGG + Intergenic
1153480591 18:5543405-5543427 CCGCCCGGGCGGGTGGCGGCTGG - Intronic
1153636479 18:7117605-7117627 CCCCGCAGGCGGGCGGGCGGGGG - Intronic
1153805473 18:8705882-8705904 CCGCGAGGTTGGGCGAGCGCGGG - Intronic
1154066351 18:11110697-11110719 CGGGGCGGGCGGGCCGGGGCGGG - Intronic
1154218251 18:12431470-12431492 CAGCGTGGGCGGGCGGGCGGGGG - Exonic
1154255561 18:12778029-12778051 CCGTGGGGGCGGCCGGGCTCGGG + Intergenic
1154325438 18:13387546-13387568 TCGCGCGGGCGGGCGGTACCTGG - Exonic
1155570350 18:27185380-27185402 CTGCCCGGGCGGGCGGGGGCGGG - Intergenic
1156171845 18:34494371-34494393 CGGCGGGGGCGGGTGGGCACGGG + Intronic
1157496775 18:48162006-48162028 CCGCCCGCCCGGGCAGGCGCCGG - Intronic
1157529515 18:48409449-48409471 CGGCGCGGGAGGCGGGGCGCGGG - Intronic
1157529553 18:48409573-48409595 CCGCGCGGCGGGGAGGGGGCGGG - Intronic
1158931074 18:62325438-62325460 CCGCGCGGCCCGGCAGGCGCGGG - Intronic
1159040603 18:63320109-63320131 CGGCGCGGAGGGGCGGGCGCGGG + Exonic
1159586890 18:70289688-70289710 CCGCGAGGTCGCGCCGGCGCTGG + Intronic
1160453548 18:78980492-78980514 CCCCGCGGCCGGCCTGGCGCGGG - Intronic
1160500716 18:79400131-79400153 GCGCGCGAGGGGGCGGGGGCGGG + Intronic
1160733520 19:651652-651674 CCGCGTGGTGAGGCGGGCGCGGG + Exonic
1160739648 19:680034-680056 CTGCGCTGGGGGGCGGGGGCTGG - Intronic
1160739727 19:680236-680258 ACGCGCGTGGGGCCGGGCGCGGG - Intronic
1160745439 19:709100-709122 CCGCGGTGCCGGGCGGGGGCGGG - Exonic
1160766851 19:812641-812663 CCACGCGGGCGGCCTGGGGCTGG - Exonic
1160775525 19:853410-853432 CCGGGCGGGGCGGGGGGCGCAGG + Intronic
1160789740 19:917932-917954 CAGCGCGGGCGGGCCCGGGCGGG + Intronic
1160824896 19:1074891-1074913 GGGCGGGGGCGGGCGGGGGCGGG + Intronic
1160873157 19:1286065-1286087 CCGAGCGGGCGGGCGGAGGGCGG - Intergenic
1160913099 19:1483812-1483834 CGGCGGGGCCGGGCGGGGGCGGG - Intronic
1160930162 19:1566671-1566693 CGGGGCGGGCGGGCGGGTGGTGG - Intronic
1160930529 19:1567835-1567857 GCGCTCGGGCTGGGGGGCGCTGG - Exonic
1160930663 19:1568186-1568208 CCGGGCGGGCGGGGCGGCGGCGG + Intergenic
1160961866 19:1725716-1725738 CCGCGCGGGGGCGCATGCGCGGG + Intergenic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161006721 19:1940926-1940948 CCGCGAGGGCGCGCGCGGGCAGG - Intergenic
1161153561 19:2721371-2721393 CGGCTCGGGCGGGCGGGGGGCGG - Exonic
1161153659 19:2721599-2721621 CCCCGAGGGAGGGCGCGCGCAGG - Intronic
1161249007 19:3270608-3270630 GCGGCCGGGCGGGCGGGCGGCGG + Intronic
1161285209 19:3464864-3464886 CCGGGAGGGCGGGCGGGGGAGGG + Intronic
1161388075 19:4007541-4007563 GCGAGCGGGGGGGGGGGCGCTGG + Intergenic
1161400670 19:4065396-4065418 CCGCGCGGGCGAGGCGGCGGGGG - Intronic
1161424977 19:4198354-4198376 CCGGGCGGGCGGGCGGGGCGGGG + Intronic
1161471272 19:4457725-4457747 CCGCGGGGGCGGGGGGGCACGGG + Exonic
1161494926 19:4581500-4581522 GCGCGAGGGCGGGAGGGCGCGGG + Intergenic
1161608798 19:5229588-5229610 CCGTGCTGCCGGCCGGGCGCGGG + Exonic
1161960321 19:7519666-7519688 CGGGGCGGGCTGGCGGGGGCGGG - Exonic
1162223592 19:9200650-9200672 CCGAGCGTGGTGGCGGGCGCCGG + Intergenic
1162299309 19:9835273-9835295 CAGCGGCGGCGGGCGGGCGCGGG + Intronic
1162315570 19:9936389-9936411 CCGCTAGGGCGGGCGGGGGTCGG - Exonic
1162435236 19:10654304-10654326 GCGGGCGGGCAGGCGCGCGCCGG - Exonic
1162798316 19:13097944-13097966 GCGTGCGTGCGTGCGGGCGCGGG - Intronic
1163146077 19:15380003-15380025 CCGCGCGGGCGGGGCGGGGTGGG - Intergenic
1163443517 19:17333664-17333686 GCGGGCGGGCGGGCGGGCTTGGG + Intronic
1163607124 19:18281542-18281564 CCGAGCGGACGGGGGGGCGCGGG - Exonic
1163666706 19:18606903-18606925 GCCCGCGGGCGGGCGGGCGGCGG - Intronic
1163720502 19:18896168-18896190 GCGCGCGGGCGGGAGAGCGGAGG + Intronic
1163785515 19:19273063-19273085 CAGTGGGGGCGGGCGGGGGCGGG - Intronic
1164648108 19:29873634-29873656 TCGAGCGGCCGGGAGGGCGCGGG - Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1164658573 19:29942450-29942472 GAGGGCGGGCGCGCGGGCGCTGG + Exonic
1164693129 19:30225727-30225749 CGGCGCGGGGGGGCGGCGGCGGG + Intergenic
1164958393 19:32405949-32405971 CCGAGAGGGCGGGCGGGCGCCGG + Intronic
1165349607 19:35268822-35268844 CGGAGCCGGCGGGCGGGCGGAGG + Intergenic
1165421406 19:35723806-35723828 CCACGCCGGGGGGCGGGAGCTGG + Exonic
1165871426 19:38975826-38975848 GAGCGAGGGCGGGCGGGCGGGGG + Exonic
1166304192 19:41928391-41928413 GAGCGCGGGCGGGCGCGCGCCGG + Intronic
1166330683 19:42076430-42076452 GCGCGCGGGCAGCCGGGCGGGGG + Intronic
1166347768 19:42177014-42177036 GCGGGCGGGCGGGCGGGCAGGGG + Intronic
1166749610 19:45158693-45158715 CCGCTGGGGCGGGCAGGGGCCGG + Exonic
1166754036 19:45179594-45179616 GAGCGCGCGGGGGCGGGCGCCGG - Exonic
1166765678 19:45251339-45251361 GCGGGCAGGCGGGCGGGCGGGGG - Exonic
1166869801 19:45864344-45864366 GCGGTCGGACGGGCGGGCGCCGG + Exonic
1167104485 19:47422058-47422080 GCGGGCGGAGGGGCGGGCGCAGG - Intergenic
1167133157 19:47600669-47600691 CGGCGCGGGCGGGCAGGGCCAGG + Intergenic
1167428417 19:49441428-49441450 CCGCCCGGGCCCGCGGGCGGGGG - Exonic
1167613293 19:50517546-50517568 CGGCGGGGCCGGGCGGGCGAGGG - Exonic
1168247037 19:55117595-55117617 GCGGGCGGGCGGGCGGGTGGTGG - Intergenic
1168347015 19:55654908-55654930 GCGGGCGGGCGGGCGGGTGAGGG + Intronic
1168401461 19:56088085-56088107 CCGCGCGGGCGGGGAGGAGGAGG - Exonic
1168694421 19:58396598-58396620 CGGCGGGGGCGGCGGGGCGCGGG - Exonic
1202710752 1_KI270714v1_random:18287-18309 GCGGGCGGGCGGGCGGGCGGGGG + Intergenic
925922224 2:8645582-8645604 CCAGGCGGGCGGGCGGGCCGCGG - Intergenic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
926251002 2:11155410-11155432 GCGCGCGGAGGGGCGGGCCCTGG + Exonic
926268162 2:11344604-11344626 CCGCGCGGGAGTGTGTGCGCCGG - Intronic
927964788 2:27262280-27262302 CCTGGGGGGCGGGCGGCCGCCGG - Intronic
928554594 2:32410841-32410863 CCGGGCGTGCTGGCGGGCACCGG - Intronic
929188711 2:39120745-39120767 CAGCCCCGGCGGGCGGGCGGCGG - Intronic
930071426 2:47369441-47369463 ACTCGCGGGAGGGCGTGCGCCGG - Exonic
930136038 2:47905401-47905423 GCGGGCGGGCGGGCGGGCGGGGG - Intronic
931321338 2:61177300-61177322 ACGCGCGGGCGGGGAGGGGCTGG - Intergenic
931355845 2:61537493-61537515 CCGGGCGGGCGGGAGGAGGCCGG - Intronic
931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG + Intronic
932231480 2:70087515-70087537 GCGGGCGGGCGGGTGGGCGAGGG - Exonic
932231514 2:70087605-70087627 CCGCGGGAGCGAGCGGGAGCGGG - Exonic
932567264 2:72917805-72917827 GAGCGCGAGCGGGCGGGCGGGGG + Exonic
932591530 2:73070806-73070828 CGGCGCGGGGGCCCGGGCGCGGG + Intronic
932806238 2:74785866-74785888 CCGGGCGTGGTGGCGGGCGCCGG - Intergenic
934566987 2:95346619-95346641 CCCCGCGGGCGCCGGGGCGCGGG - Intronic
934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG + Intronic
935112417 2:100105139-100105161 GGGCGCGGGCGGGCGGCCGAGGG - Intronic
935645312 2:105329630-105329652 CGGCGCGGGACGGCGGGCGCCGG - Exonic
935645477 2:105330175-105330197 CCGCGTGGTCAGGCGGCCGCGGG - Intergenic
935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG + Exonic
935815524 2:106843185-106843207 CCGCGCGCGCGTGCGGACGCTGG - Exonic
935971483 2:108534367-108534389 CCGCGCGGGAAGGCGGGGGAGGG - Intronic
935971500 2:108534406-108534428 CCGCGCGGGGGCGCGGGAGGGGG - Intronic
936038376 2:109129932-109129954 ACGCGCGGGCGGGCTGCCGCCGG - Exonic
936104530 2:109613746-109613768 CCGCGGGGGCCGGGGAGCGCGGG + Intronic
936396953 2:112138531-112138553 CCGCGCGGCCGGGGGGCGGCTGG - Exonic
936512164 2:113157346-113157368 GAGCGCAGGCGGGCGGGCGGCGG - Intronic
936569444 2:113602375-113602397 CCGGGCGGGCGGGCGGGCTGAGG + Intergenic
937221731 2:120346040-120346062 CCCGGCGGGCGGGCGGGCGGAGG + Intergenic
937221748 2:120346072-120346094 GCGCGGGCGCGGGCGGGGGCGGG + Intergenic
937953806 2:127408172-127408194 GCGGGCGGGTGGCCGGGCGCCGG + Intergenic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938338994 2:130523040-130523062 GCGCGCGGGTTGGGGGGCGCGGG + Intronic
938350844 2:130597710-130597732 GCGCGCGGGTTGGGGGGCGCGGG - Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
938368808 2:130756197-130756219 CCGCGGGGTCGGGCAGGCGAGGG - Intronic
938414505 2:131093245-131093267 CGCCGCGGGCCGGCGTGCGCTGG - Intronic
940316864 2:152335727-152335749 GCGCGGCGGCGGTCGGGCGCGGG + Intronic
940453806 2:153872148-153872170 CGGCGCTCGCGGGCCGGCGCGGG + Exonic
940918932 2:159286706-159286728 CCCCGCGGGCGTTCGGGGGCGGG - Intronic
941021039 2:160407967-160407989 GCGGGCGGGCGGGGAGGCGCGGG - Intronic
942450778 2:176106943-176106965 CGGCGCGGGAGGGCGGACGCGGG + Intronic
942451232 2:176108837-176108859 CCGGGCGGGCGGGCGGGTGGGGG + Intronic
942653745 2:178194382-178194404 CCGGGCGGACGGGCGGGAGCCGG + Intergenic
943060497 2:183037946-183037968 CGGCGGAGGCGGGCGGGCCCGGG - Intronic
943200011 2:184810631-184810653 CCGGGCGTGGTGGCGGGCGCCGG - Intronic
945891545 2:215436059-215436081 CGGCGCGGGCGTCCGAGCGCCGG + Exonic
946020544 2:216636935-216636957 GCGGGCGGGCGGGCGGGCCTGGG + Intronic
946622460 2:221573617-221573639 CCCGGCGGCCGGGCGGCCGCTGG + Intronic
947636084 2:231681288-231681310 CCGCGCGGGCCGGAAGCCGCAGG - Intergenic
948479143 2:238239607-238239629 CGGGGCGGGCGGGCGGGTCCGGG - Intronic
948641689 2:239379291-239379313 CCGCGCAGGTGGGCGAGCCCCGG + Intronic
948645181 2:239400329-239400351 GGGCGGGGGCGGGCGGGCGCCGG - Intronic
948645454 2:239401181-239401203 CGGGGCGGGCGGGCGGGAGGCGG - Intronic
948874615 2:240820049-240820071 GGGCGCGGGCTGCCGGGCGCAGG + Intronic
948945737 2:241218046-241218068 CGGCGGGGGCGGGCAGGGGCGGG + Intronic
948994400 2:241571201-241571223 CCACTCGGGAGGGCGGGGGCTGG - Intronic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
949079865 2:242088461-242088483 GGGCGCGGGGGGGCGGGGGCGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG + Intronic
1169065691 20:2693178-2693200 GCGGGCGGGCGGGCGGGAGGTGG + Intronic
1169849599 20:10035057-10035079 GCGCGCGGGCAGGTGAGCGCAGG - Exonic
1172155288 20:32819937-32819959 GCGGGCGGGCGGGCGGGGTCTGG + Exonic
1172702662 20:36862816-36862838 CCGGGGAGGCGGGCGGCCGCGGG + Exonic
1173582956 20:44160194-44160216 CCACGCGGGATGGCGGGCGAGGG + Exonic
1173673000 20:44810700-44810722 GCGCGCGGGGAGGCAGGCGCCGG + Intergenic
1173939115 20:46894929-46894951 GCGGGCGGGCGGGCCGGTGCGGG - Exonic
1174386612 20:50191337-50191359 GCGGGCGCGGGGGCGGGCGCGGG - Exonic
1174467863 20:50731422-50731444 CCGCTCGGGTGCGCGCGCGCGGG + Intergenic
1175136374 20:56827408-56827430 CAGGCCGGGCGGGCGGGGGCAGG - Intergenic
1175517195 20:59577322-59577344 TCGCCCGGGCGAGCGGGAGCGGG - Intergenic
1175903005 20:62367359-62367381 GCGCTCGGGCGGGCCGGGGCGGG - Intergenic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176119277 20:63446719-63446741 CCCCGAGGGAGGGCGGGGGCTGG - Intronic
1176131641 20:63498941-63498963 GCGCGCGCGGGGGCGGGTGCGGG + Intronic
1176157097 20:63627296-63627318 CCGCGCGGGCGGCCGGGCCGAGG + Intergenic
1176206979 20:63894586-63894608 CCGGGAGGGTGGGAGGGCGCTGG + Intergenic
1176207171 20:63895373-63895395 GCAGGCGGGCGGGCGGGCGCGGG + Intronic
1176223614 20:63981645-63981667 GCGGGCGGGCGGGCGGGGGGGGG - Intronic
1176223618 20:63981649-63981671 CGGGGCGGGCGGGCGGGCGGGGG - Intronic
1176234939 20:64049692-64049714 CGGGGCGGGCGGGCGGGGGCGGG + Intergenic
1176281590 20:64316650-64316672 CCGCGCGGGGGTTGGGGCGCGGG + Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176548059 21:8209888-8209910 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176549079 21:8213728-8213750 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1176555952 21:8254098-8254120 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176556973 21:8257948-8257970 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1176566990 21:8392923-8392945 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176568011 21:8396766-8396788 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1176574889 21:8437133-8437155 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176575915 21:8440985-8441007 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1176611504 21:8988429-8988451 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176952647 21:15064886-15064908 ACGGGCGGACGGGCGCGCGCGGG + Exonic
1178535105 21:33404018-33404040 CGGCGCGGGCGCGCGGGTGGGGG - Intronic
1178610341 21:34073866-34073888 CCGGGGCGGCGGGCGGGCGGCGG + Intronic
1178640900 21:34344133-34344155 CAGGGCGGGCGGGTGGGAGCCGG + Intergenic
1179874689 21:44261950-44261972 CCGCGGGGGCGGGGAGGGGCGGG + Exonic
1179998558 21:44985010-44985032 CCGAGGGGGCGGGCTGGAGCAGG - Intergenic
1180014685 21:45074528-45074550 CCCGGCGGGCCGGCGGGGGCGGG + Intronic
1180101530 21:45590045-45590067 AAGCGCGGCCGGGCCGGCGCGGG - Intergenic
1180216087 21:46324527-46324549 CCTCTCGGGCGGGCCGGGGCGGG + Intronic
1180247592 21:46558324-46558346 CGGCGCGGGCCGGCAGGCCCAGG - Exonic
1181094357 22:20495627-20495649 GCGCGGGGGCGGGCGCGGGCCGG - Intronic
1181160739 22:20958088-20958110 GCGGGCGGGCGAGCGGGCGGAGG - Intergenic
1181299247 22:21867651-21867673 GCGGGCCGGCGGGCGGGCGGAGG + Intronic
1181457969 22:23070377-23070399 CGGCGCGGGAGGGCGGGCGGAGG + Exonic
1183386868 22:37519738-37519760 CCGCACGGGCGGGCGCGCTGTGG - Intergenic
1183501410 22:38181753-38181775 CCTCGCGGGTGGGCGGGGCCTGG - Exonic
1183702228 22:39457270-39457292 CCCGGCGAGCGGACGGGCGCGGG - Intergenic
1184053128 22:42023632-42023654 CCGGGCGTGGTGGCGGGCGCCGG - Intronic
1184101547 22:42343876-42343898 GAGGGCGGGCGGGCGGGCGGAGG + Intergenic
1184101605 22:42344034-42344056 GGGCGCGGGTGGGCGGGGGCTGG - Intergenic
1184153049 22:42649426-42649448 GCGCGGGGCGGGGCGGGCGCGGG + Intronic
1184186772 22:42870036-42870058 CCACGCGGGCCGGCGGGGGTGGG - Exonic
1184236769 22:43187175-43187197 CGGGGCGGGGGGGGGGGCGCTGG - Intergenic
1184242329 22:43217755-43217777 CCCAGCGGGCGGGTGTGCGCTGG - Intronic
1184276479 22:43411947-43411969 GCGCGCGGGCGGGCGGCGGAGGG + Intronic
1184276562 22:43412191-43412213 GCGGGCGGGAGGCCGGGCGCGGG + Intronic
1184276822 22:43413316-43413338 CGGCGCCGGGGGGCGGGGGCGGG + Intronic
1184362015 22:44024463-44024485 CCCCGGGGGTCGGCGGGCGCGGG - Intronic
1184445306 22:44543762-44543784 CGGCGGGGGCGGGCGGGGGGCGG + Intergenic
1184523229 22:45007793-45007815 GCGCGCGGCCGGCCGGGCTCTGG + Intronic
1184681015 22:46072083-46072105 CCGGGCCGTCGGGCGGGCGGTGG - Intronic
1185055393 22:48576240-48576262 CGGAGGGGGCGGGCGGGGGCGGG - Intronic
1185255119 22:49827522-49827544 CCCGGCAAGCGGGCGGGCGCGGG + Intergenic
1185272383 22:49935319-49935341 CCGGGCGGGCGGCGGGGCGCGGG + Intergenic
1185278863 22:49961392-49961414 CGGCGGCGGGGGGCGGGCGCGGG + Intronic
1185336004 22:50271117-50271139 CCCCGCGGGCGGGCAGGCGCGGG + Intergenic
1185351736 22:50343231-50343253 CCGCGCGGGTGGGCGGGGCCGGG - Intergenic
1185381072 22:50507797-50507819 GCGGGCGGGCGGGCGGGCCGAGG - Intergenic
1203252938 22_KI270733v1_random:126188-126210 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1203253966 22_KI270733v1_random:130043-130065 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1203260993 22_KI270733v1_random:171269-171291 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1203262022 22_KI270733v1_random:175122-175144 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
949987542 3:9552744-9552766 CCGGGCTGCCGGGCGGGAGCTGG + Exonic
950345326 3:12287854-12287876 CCCGGCGCGGGGGCGGGCGCGGG - Intronic
950433949 3:12967606-12967628 CCGCGGGAGCCGGCGGACGCTGG - Exonic
950438493 3:12994155-12994177 GGGCGCGGGGGGGCGGGGGCGGG + Intronic
950509979 3:13420253-13420275 CGGCGCGGGCGGCCGGGCGCAGG - Exonic
951080293 3:18444671-18444693 CCGGGCGGGCGCGCCGGCGTCGG + Intronic
951485254 3:23203116-23203138 GCGCGCGGACGGCCGGGCGGCGG + Intronic
953484964 3:43286559-43286581 CCGAGCGGGCTGCCGGCCGCGGG - Exonic
953748735 3:45594168-45594190 GCGCGCGGGCCGGAGGGCGGCGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954076910 3:48188189-48188211 GCCAGCGGGCGGGCGGGCGCCGG + Exonic
954223981 3:49171234-49171256 CCGCGGAGGTGGGCAGGCGCCGG + Intergenic
954437490 3:50503733-50503755 CGGCGGGGGCGCGCGGGGGCGGG - Intronic
954540842 3:51392129-51392151 CCGAGCGGGTCGGCGGGCGCGGG - Exonic
954763951 3:52897480-52897502 CAGCGAGGCCGGGCGGGCCCTGG - Exonic
954779040 3:53045938-53045960 GGGCGCGAGCGGGCGAGCGCGGG - Exonic
956813661 3:72888449-72888471 CCGCTCGGGGGCGCGGACGCGGG - Exonic
957673220 3:83332339-83332361 CCGGGCGTGGTGGCGGGCGCCGG + Intergenic
960281325 3:115784286-115784308 CAGCGCGAGCGGGTGGGCGGGGG + Intergenic
960338325 3:116445418-116445440 GCTGGCGGGCGGGCGGGCGAGGG + Exonic
960639144 3:119810206-119810228 GCGCGCGGGCGGGCCGGCGCCGG + Intronic
960960438 3:123067098-123067120 GCAGGCGGGCGGGCGGGAGCGGG + Exonic
961359422 3:126357562-126357584 CCGCGCGGGCGGGCCGGGGCGGG - Intergenic
961545349 3:127629309-127629331 GAGCGCGGGAGGGCGGGCGGCGG + Intronic
961599940 3:128052620-128052642 CCGTGCGGTCGGGCGCCCGCCGG + Intronic
961666507 3:128496399-128496421 AAGCGCGGGAGGCCGGGCGCCGG + Intergenic
962222355 3:133574186-133574208 GCGGGCGGCGGGGCGGGCGCGGG + Exonic
963228758 3:142889010-142889032 GCGCGCGGGCAGCCGAGCGCCGG - Exonic
963236719 3:142963600-142963622 CAGCGCGGGCGGCCGCGCGCCGG - Exonic
964087554 3:152835638-152835660 CCCCGCGGGAGGGGGCGCGCAGG - Exonic
964118816 3:153162097-153162119 CCGCGGGGCCGGGAGGGGGCGGG - Intergenic
964201222 3:154121380-154121402 GCGTGGGGGCGGGCCGGCGCCGG + Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
964771241 3:160225963-160225985 CCGCGCGGCCAGGCGCGCCCGGG + Exonic
966182223 3:177197634-177197656 GCGGGCGGGCGGGCGCGCGGGGG + Intergenic
966911414 3:184562240-184562262 CGGCGGCGGCGGGCGGGCTCTGG - Exonic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
967493654 3:190120428-190120450 CCTCGCCGGGGGGCGGGGGCGGG + Exonic
967859594 3:194141282-194141304 CCGCCCCGGCGGGCGCGCGGCGG - Intergenic
968230432 3:197002423-197002445 CCTCGCGGAGGGGCGGGCACGGG + Exonic
968382315 4:107535-107557 CAGCGCGGAGGGGCGGGCGGAGG - Intergenic
968503455 4:961432-961454 CCGAGTGGGCGGGCGAGCCCAGG - Intronic
968562293 4:1290345-1290367 CCGGGAGGGCGGCCGGGCACTGG - Intronic
968571933 4:1346681-1346703 CCGCCCAGACGGGCGGGCGCGGG - Intergenic
968642309 4:1720931-1720953 CCCCGCGGGCGGCCGGGCGGCGG - Exonic
968642323 4:1720973-1720995 CCCCGCGGGCGGCCGGGCGGCGG - Exonic
968642337 4:1721015-1721037 CCCCGCGGGCGGCCGGGCGGCGG - Exonic
968642351 4:1721057-1721079 CCCCGCGGGCGGCCGGGCGGCGG - Exonic
968652897 4:1767134-1767156 CCCCGGAGGCGGGCGGGCGGAGG - Intergenic
968729226 4:2261869-2261891 CCGCGGCGGTGGGCGGGCGGCGG - Intronic
969239202 4:5888195-5888217 CAGCGCGGGGCGGCGGGGGCGGG + Intronic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
969379012 4:6782507-6782529 GCGCGCGGGCGGTGGGCCGCGGG - Intronic
969379139 4:6782882-6782904 CCCCTCGGCCGGGTGGGCGCGGG + Intronic
969597797 4:8158771-8158793 CGGAGCCGGCGGGCGGGCGGAGG - Intronic
971406027 4:26321244-26321266 CAGCGCGTGAGGGCGGGCGGCGG + Intronic
971457798 4:26860763-26860785 CAGCGCGGGCCGGAGGGGGCGGG + Intronic
972321574 4:37977415-37977437 GCCCGCGGGCGGCCGGGGGCGGG - Intronic
972418804 4:38867870-38867892 CCCGGGGGGCGGGCGAGCGCGGG + Intronic
972533055 4:39977575-39977597 GCTCCCGGGCGGGCGGGCGGCGG - Exonic
975041611 4:69751592-69751614 CCGGGCGTGGTGGCGGGCGCCGG - Intronic
975612188 4:76213896-76213918 CTGCGCGGGGAGGCGGGCGGGGG + Intergenic
979231378 4:118352477-118352499 CCTGGAGGGCGTGCGGGCGCTGG + Exonic
979785682 4:124712797-124712819 CCGAGCGGCGGGGCGGGGGCGGG - Intergenic
981128558 4:141133179-141133201 CCGCCGGGGCTGGAGGGCGCAGG - Intronic
981531950 4:145761919-145761941 CCGAGGGGCCGGGCGGGGGCTGG - Intronic
981782888 4:148445591-148445613 CCGAGCGGGCACGAGGGCGCGGG - Intergenic
982584855 4:157222860-157222882 CTGCGCGGGGGAGCGAGCGCGGG - Intronic
984639272 4:182144539-182144561 CCGCGCGGCCGGGGGCGGGCAGG + Intronic
985129024 4:186723629-186723651 GGGCGCGGGCCGGCGGGCGGGGG - Intronic
985129097 4:186723881-186723903 CGGCGCCGGCGGGCGGGGCCGGG - Intronic
985180521 4:187256507-187256529 CCGGGCGTGGTGGCGGGCGCCGG + Intergenic
985299182 4:188469489-188469511 CCGGGCGTGGTGGCGGGCGCCGG + Intergenic
985452623 4:190069704-190069726 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
985453610 4:190073001-190073023 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
985454600 4:190076294-190076316 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
985455588 4:190079587-190079609 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
985456572 4:190082881-190082903 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
985457560 4:190086181-190086203 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
985458547 4:190089474-190089496 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
985459536 4:190092774-190092796 GGGCCCGGGCGGGCGGGCGACGG - Intergenic
985463787 4:190175543-190175565 GGGCCCGGGCGGGCGGGCGACGG - Intronic
985520996 5:373838-373860 CTGCCCGGGCGGGCGGGGGCGGG + Intronic
985629976 5:1009107-1009129 GAGGGCGGGCGGGCGGGCGTGGG + Intronic
987156735 5:15096604-15096626 CATGGCGGGCGGGCGGGCGGGGG + Intergenic
987156737 5:15096608-15096630 GCGGGCGGGCGGGCGGGGGGTGG + Intergenic
988949321 5:36241623-36241645 CCGCGCGAGCTGGCGGGCTGTGG - Exonic
989102340 5:37834823-37834845 CTGCGCGGGCAGGCGGGAGGTGG + Intronic
989209520 5:38845802-38845824 CTTTGCGGGCGGGCGGGCACTGG - Intergenic
989308747 5:39988177-39988199 CCGGGCGTGGTGGCGGGCGCTGG - Intergenic
992487598 5:77210889-77210911 GGGCGCGGGCGGGCGCGCGGGGG + Exonic
992910745 5:81393973-81393995 CCTGGCGGGTAGGCGGGCGCCGG - Exonic
992939561 5:81750226-81750248 GGGCGGGGGCGGGTGGGCGCCGG - Intronic
993519465 5:88883246-88883268 GCGCGCGAGGGGGGGGGCGCGGG + Intronic
993727353 5:91383410-91383432 CGGCGCGGGAGGGGGCGCGCAGG - Intergenic
994411361 5:99410608-99410630 CCGCGTTCGCGGGCAGGCGCGGG - Intergenic
996308486 5:122077496-122077518 CCACGCGGCTGGGCGGCCGCAGG + Exonic
996393571 5:122989518-122989540 CCGGGTGGGGGGGCGGGGGCAGG + Intronic
996738246 5:126776841-126776863 CCGCGCGGGTGGGCAGTCCCAGG + Intronic
996900590 5:128538289-128538311 CGGGGCGGGCCGGCGGGCGGCGG + Intronic
997521380 5:134526332-134526354 CCGGGCCGGCGAGGGGGCGCGGG + Intronic
997963271 5:138338388-138338410 CCGCGCGGGCGGTCGGGCTGGGG - Intronic
998130284 5:139648328-139648350 CTGCCCGGGCGGGCGCGCGGCGG + Exonic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998199459 5:140108010-140108032 GCGGGCTGGCGGGCGGGGGCGGG - Intronic
998200375 5:140113888-140113910 CCTGGCGGGCGGGCGGACGGGGG + Intronic
998655167 5:144170658-144170680 CTGCGCGAGCGGGCGTGCCCCGG - Exonic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1001496073 5:172188370-172188392 CCGGGCCGGTGGGCGGGCGCGGG - Exonic
1002093512 5:176817929-176817951 GCGGGCGGGCTGGCGGGCGGAGG - Intronic
1002180117 5:177426907-177426929 CCGGGTGGGCGGCCGGGCCCGGG + Intronic
1002186198 5:177455946-177455968 CGGCGCGGGCCGAGGGGCGCTGG - Exonic
1002487617 5:179550529-179550551 CCCAGCGGGCGGGCGGGCGCGGG - Intergenic
1002785003 6:393469-393491 CGGGGCGGACGGGCGGGCGGCGG + Intronic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003175769 6:3751567-3751589 TCCTGCGGGCGGGCGGGCGGCGG - Exonic
1003290737 6:4776486-4776508 CCGCGGGGCCGGGCGGGCTGGGG - Exonic
1003290788 6:4776654-4776676 TCCCGCGGCCGGCCGGGCGCTGG - Exonic
1003645602 6:7910866-7910888 CGGCGCGGGCGGGCGGGGAGAGG - Intronic
1003942671 6:11044371-11044393 CCGAGGGGGCGGGGAGGCGCGGG - Intergenic
1004262067 6:14117537-14117559 CGGCCCGGGCGCGCGGGGGCGGG + Intronic
1004587445 6:17016006-17016028 CGGCGCGGGCGGGCCGGCAGTGG + Intergenic
1004864121 6:19837247-19837269 GCGCGCGGGCGGGGGCGCGGAGG - Intergenic
1004923863 6:20401524-20401546 CCCGGCGGGCGGGCGGGGACAGG + Intergenic
1005405266 6:25480861-25480883 CCGGGCGTGGTGGCGGGCGCGGG - Intronic
1005762958 6:28984824-28984846 CCGGGCGTGGTGGCGGGCGCCGG - Intergenic
1005826326 6:29633265-29633287 CAGCGCGGTGGGGCGGGCGGTGG + Intronic
1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG + Intergenic
1006472950 6:34238244-34238266 GCGCGCGGGGGGAGGGGCGCAGG - Intronic
1006606250 6:35259735-35259757 GCGCGCGGGCGGGCGGGCTATGG + Exonic
1006606298 6:35259881-35259903 GCGGGAGGCCGGGCGGGCGCAGG + Intronic
1007431440 6:41779692-41779714 CCGGGCGGGCGGGCAGGCGGCGG - Intronic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1007686131 6:43668423-43668445 CTGCGCAGGCGGGAGGGTGCTGG - Intronic
1008106045 6:47442126-47442148 ACGGGTGGGCGGGGGGGCGCGGG + Intergenic
1008160390 6:48068864-48068886 GCGCGCGTGGGGGCGGGCGGCGG + Intergenic
1008920876 6:56843481-56843503 CGGCGAGGGCGGGCGGGGGCCGG + Intronic
1010083099 6:71886716-71886738 CGGCGGGGGCGGGCAGGCGGAGG - Intronic
1010249879 6:73696313-73696335 GCGCGCGGGCGCGCGGGCCTGGG + Intronic
1010703136 6:79077131-79077153 GCGCGCGTCCGTGCGGGCGCGGG - Intronic
1012939682 6:105403269-105403291 ACGGGCGGGCGGCCGGGCGTGGG - Intergenic
1013117684 6:107115142-107115164 CCACGTGGGGGGGAGGGCGCGGG + Intronic
1013441806 6:110179242-110179264 CCCCGCTGGCGGGTGGGCGGTGG + Intronic
1013459039 6:110358073-110358095 CCGCGCGGCTGGCCCGGCGCGGG + Exonic
1014798207 6:125749292-125749314 CAACGCGGGCGCGCGGGGGCGGG - Intronic
1015626027 6:135181548-135181570 CCGGGCGGGCGGCCGAGGGCGGG + Intronic
1016340919 6:143060816-143060838 CCGGGCGCGGGCGCGGGCGCGGG - Intronic
1019014957 6:168873481-168873503 CCGAGCTGGCGGCCGGCCGCTGG + Intergenic
1019111952 6:169724054-169724076 GCCCCCGGGCGGGCGGGCGGAGG - Exonic
1019153321 6:170023347-170023369 ACGCACGGGAGGGCGGGCGCTGG - Intergenic
1019174436 6:170153035-170153057 CCTGGCGGGCGGGCGAGCACAGG - Intergenic
1019279461 7:192738-192760 CCGGGCGGGCGGGCGGGGAAGGG - Intergenic
1019343292 7:518431-518453 CCGGGCGGGCGGGACTGCGCCGG + Intronic
1019531142 7:1504109-1504131 TCGCCCCGCCGGGCGGGCGCGGG - Intronic
1019588516 7:1817306-1817328 CTGCGCGCCCGGGCGGGTGCTGG - Intronic
1019693942 7:2434099-2434121 GCGGGCGGGTGGGCGGGCGGAGG - Exonic
1019999177 7:4745183-4745205 CCGCGGGGGCGGGGCGGCACTGG - Intronic
1020080344 7:5283161-5283183 CCGGGCGGGCGGGAGGGGGCGGG - Intronic
1020080348 7:5283165-5283187 GCGCCCGGGCGGGCGGGAGGGGG - Intronic
1020274355 7:6615647-6615669 CCGGGCGGGCGGGCGAGCCCAGG + Exonic
1020889891 7:13866303-13866325 CCGGGCGTGGCGGCGGGCGCCGG - Intergenic
1021106791 7:16646533-16646555 GACCGCGGGCGGGCGGGCGGGGG + Intronic
1021717651 7:23474110-23474132 CCGCGCTGGCCGGCGGACTCAGG - Intergenic
1021719247 7:23490434-23490456 GGGCGGGGGCGGGCGGGCGCGGG + Intergenic
1022230555 7:28409182-28409204 CCGCGCGGGCGGGGCGGGGTCGG + Intronic
1022410422 7:30135358-30135380 CCGCGCGGGAGCTCGGGCGCAGG - Intronic
1022923353 7:35037483-35037505 TCCAGCGGGCGGGCGGGCGGAGG + Intronic
1023810360 7:43906654-43906676 CGGAGCGGGCGGGCGGCCGGCGG - Exonic
1023838550 7:44082529-44082551 GTGGGCGGGCGGGCGGCCGCCGG + Intronic
1023842212 7:44104184-44104206 CGGGGCAGGCGGGCGGGCGCTGG - Intergenic
1023881981 7:44325850-44325872 GTGCGGGGGCGGGCGGGGGCGGG - Intronic
1024043815 7:45574449-45574471 GCGCCGGGGCGGGCGGGCGGCGG - Intronic
1024726367 7:52201077-52201099 CCGGGCGTGGTGGCGGGCGCCGG - Intergenic
1026010039 7:66629213-66629235 CCGGGCGGGCGGCGGGCCGCGGG + Intronic
1026360523 7:69598349-69598371 GCGAGCGAGCGGGCGGGCGCGGG + Intergenic
1026732764 7:72925610-72925632 CCGGGCGGGCAGGTGGGCGGCGG - Intronic
1026797869 7:73377556-73377578 CGGGGCGGCCGGGCGGGCGGCGG - Intergenic
1026822291 7:73557647-73557669 CGGCGGCGGCGGGCGGGCGGCGG - Exonic
1026943301 7:74300596-74300618 CCGGGCGTGGTGGCGGGCGCCGG - Intronic
1027111308 7:75442248-75442270 CCGGGCGGGCGGGTGGGCGGCGG + Intronic
1027202340 7:76071970-76071992 CCGTCGGGGCGGGCGGGAGCTGG + Intergenic
1027374633 7:77537492-77537514 CCGGGCGGGCGGGCGGCGGGGGG + Exonic
1028526964 7:91797449-91797471 CCGGGCGTGGTGGCGGGCGCCGG - Intronic
1028922352 7:96322100-96322122 CCGCGCCGGCGGGAGGGCGTGGG - Exonic
1029238697 7:99143674-99143696 CGGGGCGGGCGAGGGGGCGCCGG + Intronic
1029456628 7:100675207-100675229 AGGCGCGGGCGGGCGGCCCCAGG - Intronic
1029537002 7:101162959-101162981 CGGCGGGGGCGCGCGGGGGCGGG + Exonic
1030983322 7:116210954-116210976 GCGCGAGCGAGGGCGGGCGCGGG + Intronic
1031043548 7:116862917-116862939 GCGGGCGGGGGCGCGGGCGCGGG + Intronic
1031051869 7:116953412-116953434 CCCCGGCGGCGGGCGGGCTCCGG + Exonic
1031895973 7:127347988-127348010 TCCCGGGGGCGGCCGGGCGCAGG + Intronic
1032159852 7:129502240-129502262 CGGGGCGAGGGGGCGGGCGCGGG - Intergenic
1032159861 7:129502259-129502281 CGGGGCGAGGGGGCGGGCGCGGG - Intergenic
1032159870 7:129502278-129502300 CGGGGCGAGGGGGCGGGCGCGGG - Intergenic
1032344295 7:131105744-131105766 CCGCGCGGGTGCCCCGGCGCTGG - Intergenic
1033253112 7:139777557-139777579 CCGCGGAGGGCGGCGGGCGCGGG + Intronic
1033654206 7:143362325-143362347 CCGCGCCTGCGGGAGGGCGACGG + Intronic
1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG + Intergenic
1034222972 7:149460090-149460112 CCGCGCGTCCGTGCGCGCGCGGG + Intronic
1034228115 7:149498059-149498081 CCGCGCCCGCGGGCGAGCACGGG + Intergenic
1034469716 7:151248744-151248766 CGGCGGCGGCGGGCGGGCGGCGG - Exonic
1034470450 7:151251879-151251901 CCGAGCGAGCGGGCGGCGGCCGG + Intronic
1034680689 7:152925478-152925500 CCGAGGGGCCGGGCGCGCGCGGG + Intergenic
1035361728 7:158317988-158318010 CTGCGCGGGCGGGCGGACAATGG + Intronic
1035747551 8:1973489-1973511 CCGCGCGTGGGCGCGGGCTCGGG + Intergenic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1036910381 8:12754072-12754094 CCGCGCGGGCGCCCGGCCCCGGG - Intronic
1037450661 8:19013587-19013609 GCGCGCGGCCGGGCTGGCGATGG - Exonic
1037450722 8:19013800-19013822 CGGCGCAGGCGGGCCGGCGGTGG + Intronic
1037788828 8:21919410-21919432 TCGCTCCGGCAGGCGGGCGCTGG - Intergenic
1037811468 8:22089381-22089403 GCAGGAGGGCGGGCGGGCGCGGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037928828 8:22865477-22865499 CTGCGCGGCCGGGGGGGCGGTGG - Intronic
1039493655 8:37965627-37965649 GCGCGCGGGCCGCCGGCCGCAGG + Exonic
1039903265 8:41767661-41767683 GCGCGCGGGGGCGCGGGCGGGGG + Intronic
1040981766 8:53251759-53251781 CCGGGCGGGCGGGGCGGGGCAGG - Intergenic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1041690409 8:60680435-60680457 CCGGGCGGGGGTGGGGGCGCTGG + Intronic
1042561157 8:70072558-70072580 CGTCGGGGGCGGGCGGGCGCGGG - Intergenic
1042591767 8:70403655-70403677 CCGCGAGGGCGGGCGGGGGGCGG - Intronic
1044250678 8:90001441-90001463 CGGCGCAGGCGGTTGGGCGCAGG - Exonic
1045063529 8:98427190-98427212 CCCGGCGGGCCGGCGGGCGGGGG - Exonic
1045305275 8:100952207-100952229 CCGCGCTGGAGGGCGAGCGGAGG + Intronic
1045510075 8:102806897-102806919 CCGCGCGGCCCGGGGGGCGGGGG + Intergenic
1047615274 8:126557992-126558014 CCGAGCCTGAGGGCGGGCGCGGG - Intronic
1047961688 8:130016156-130016178 GCGTCCGGGCCGGCGGGCGCGGG - Intronic
1048553903 8:135457366-135457388 CAGGGCGGGGCGGCGGGCGCGGG + Intergenic
1048981101 8:139703726-139703748 CCGCGCGCCCGGGTGGGCGCTGG - Intergenic
1049179129 8:141212133-141212155 GTGGGCGGGCGGGCGGGCGGCGG - Intronic
1049409035 8:142464274-142464296 CGCCGCGCGCGGGCGGCCGCCGG + Exonic
1049471752 8:142777829-142777851 CGGCGCGGGCGAGTGGGCGGAGG - Exonic
1049585408 8:143430506-143430528 CGGCGGGGGCGGGGGGGCGCCGG + Intergenic
1049724323 8:144138445-144138467 CCGCGCGGGCGGGGAGGGGACGG + Intronic
1049791100 8:144473098-144473120 AGGCGCGGGTGGGCGGGCCCGGG - Exonic
1050874020 9:10613103-10613125 CCGCTCCGGCGGGCGGGGGCCGG + Intergenic
1051774492 9:20620479-20620501 GCGCGCGGGCAGGCGGGAGCCGG + Intronic
1052982322 9:34458319-34458341 CCGCGCGGGGCGGCGGCCCCAGG + Exonic
1052982346 9:34458377-34458399 CCACTCGGGCGGGCAGGGGCCGG + Exonic
1053001147 9:34577936-34577958 GCTGGCGGGCGGGCGAGCGCGGG + Intronic
1053001223 9:34578153-34578175 CCCGGCGGGCGGGTGGGCGAGGG + Intronic
1053129073 9:35605294-35605316 GCGGGCGGGCGGGCGGGCGGCGG - Exonic
1053312852 9:37030252-37030274 CCGCCCGAGCGGGCGGCCTCTGG + Intronic
1055030622 9:71768900-71768922 GCGGGCGGGCGGGCGGGCGGTGG + Intronic
1056992282 9:91423561-91423583 GCGGGCGGGCGGGCGGGCGCGGG - Intronic
1057146935 9:92764837-92764859 GCGGGCGGGCGGGCGGCCGTCGG - Intergenic
1057228888 9:93306896-93306918 TCCCGCGGCCGGGCGGGCGTGGG + Intronic
1057245576 9:93451822-93451844 GCGGGCGGGCTGGCGGGCGGGGG - Exonic
1057259664 9:93576666-93576688 CGGCGGGGGCGGCGGGGCGCAGG - Exonic
1057294657 9:93828070-93828092 CAGGGCGGGCGGGCGGGCAGGGG + Intergenic
1057547265 9:96027625-96027647 CCGGGGGGACGGGTGGGCGCTGG - Intergenic
1058467638 9:105244916-105244938 CCGGGCGGGCGGCCGGGAGGCGG - Intronic
1059145645 9:111897029-111897051 GCGCGCGGGCGGGGGCGCGCAGG + Exonic
1059176653 9:112174910-112174932 TCGCGGGGTCGGGCGGGGGCAGG + Intronic
1059208262 9:112486801-112486823 GGGCGCGGGCGGGCCGGGGCGGG - Intronic
1059633913 9:116154283-116154305 CCGGGCCGGCGGCGGGGCGCGGG - Exonic
1060106526 9:120876585-120876607 GCGCGGGGCCGGGCGGGGGCAGG + Intronic
1060106774 9:120877428-120877450 GGGCGGGGGCGGGCGGGGGCTGG - Intronic
1060542718 9:124441506-124441528 CCTGGCAGGCAGGCGGGCGCAGG - Intergenic
1060700764 9:125747429-125747451 CGCCGCGCGCGGGCGGGAGCGGG - Exonic
1060713058 9:125889864-125889886 GCGCGAGCGCGGGCGGGCGTCGG - Intronic
1060770260 9:126327065-126327087 GAGGGCGGGCGGGCGGGCGCGGG + Intronic
1060979809 9:127785668-127785690 CTGCGCGGGGCGGCGGGCGGGGG - Intronic
1061128302 9:128690044-128690066 CCGCGCGGGAGGTCGGGCGCGGG - Intronic
1061128355 9:128690172-128690194 ACACGCGGGCGGCCGCGCGCTGG + Intronic
1061262657 9:129488602-129488624 CCGCGAGGGCGGGAGGGGGCCGG - Intergenic
1061587706 9:131579345-131579367 CAGCGGGGCCGGGCGGGAGCTGG - Exonic
1061816497 9:133200347-133200369 GCCCGCGGGCGGGAGGGGGCCGG + Intergenic
1061961691 9:133992045-133992067 CCCGGCGGGCGGGAGGGCCCCGG - Intronic
1062022685 9:134326739-134326761 CGGCGCGCGCGGGGGGTCGCCGG + Intronic
1062162474 9:135087840-135087862 CGGCGGCGGCGGGCGGGCGGCGG + Exonic
1062272120 9:135714432-135714454 GCGGGCGGCCGGGCGGGGGCGGG - Intronic
1062272122 9:135714436-135714458 GCGGGCGGGCGGCCGGGCGGGGG - Intronic
1062280859 9:135751047-135751069 CCACGTGCGCGGCCGGGCGCGGG + Intronic
1062306000 9:135907420-135907442 CCGGGGGCGGGGGCGGGCGCGGG + Intergenic
1062499628 9:136846800-136846822 GCGCGCGAGCTGGCGGCCGCTGG + Exonic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1203469340 Un_GL000220v1:109335-109357 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1203470366 Un_GL000220v1:113187-113209 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1203477161 Un_GL000220v1:153307-153329 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1203478187 Un_GL000220v1:157159-157181 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1185703003 X:2245449-2245471 CCGGGCGTGGTGGCGGGCGCTGG - Intronic
1185778820 X:2828869-2828891 CCGCGGGGGCTGGCGGAGGCGGG + Exonic
1186496404 X:10015413-10015435 TAGGGCGGGCGGGCGGACGCCGG + Intergenic
1186768104 X:12791627-12791649 CCGCGCCGGCGGCCGGGCTAGGG + Intronic
1186987424 X:15031935-15031957 CCGGGCGCGATGGCGGGCGCTGG + Intergenic
1187076313 X:15938786-15938808 CCGGGCGAGGTGGCGGGCGCCGG - Intergenic
1187112181 X:16313216-16313238 CTGGGCGGGTGGGGGGGCGCGGG + Intergenic
1188542661 X:31266963-31266985 CGGCGCGGGCGGGCCGGGGAGGG + Intronic
1189335577 X:40168917-40168939 CGGCCAGGGCGGGCGGGCGGGGG - Intronic
1190298681 X:49043354-49043376 CTGCGCGGGCGGGCGGCGTCGGG + Exonic
1192177058 X:68892765-68892787 CCGGGCAGGCGGGCAGGCGGTGG + Intergenic
1192177535 X:68895242-68895264 GCGGGCGGACGGGCGGGCGCCGG + Intergenic
1192561738 X:72131850-72131872 CCGGGCGGGCGGGCGGGCAGGGG + Intronic
1195156035 X:102125663-102125685 GCGGGCTGGCGGGCGGGCGCGGG - Intergenic
1195158079 X:102142470-102142492 CTGGGCGGGCGGGCGGGCGCGGG + Exonic
1195308377 X:103607919-103607941 CAGGGCGGGCGGGCGGGCGCGGG - Intronic
1196415302 X:115464739-115464761 CCGGGCGTGGTGGCGGGCGCCGG + Intergenic
1196842542 X:119871809-119871831 CCCCGCTCGCGGGCGGCCGCGGG + Exonic
1197694898 X:129540305-129540327 CCGCGCCGGGCGCCGGGCGCCGG - Exonic
1198051750 X:132957855-132957877 CCGGGTGGGCAAGCGGGCGCGGG - Intronic
1198657676 X:138932503-138932525 CGGCGCGGGAGGGCGGGGGGTGG + Intronic
1198767159 X:140091569-140091591 GCGGGCGGGCGCGCGGGCGGCGG - Intergenic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200101118 X:153689407-153689429 GCGGGCGGGCGGGCGGGCATGGG - Intronic
1200787604 Y:7273902-7273924 CCCCGCGGCCGGGTGGGGGCGGG + Intergenic