ID: 926077383

View in Genome Browser
Species Human (GRCh38)
Location 2:9951942-9951964
Sequence CCGCGCGGGCGGGCGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 936
Summary {0: 1, 1: 1, 2: 21, 3: 122, 4: 791}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926077372_926077383 -5 Left 926077372 2:9951924-9951946 CCGGGCGCAGACCCGAGGCCGCG 0: 1
1: 0
2: 0
3: 18
4: 131
Right 926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG 0: 1
1: 1
2: 21
3: 122
4: 791
926077366_926077383 28 Left 926077366 2:9951891-9951913 CCGCGCTGAGGGGCCGCACCTGC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG 0: 1
1: 1
2: 21
3: 122
4: 791
926077370_926077383 10 Left 926077370 2:9951909-9951931 CCTGCAGCGAGCGAGCCGGGCGC 0: 1
1: 0
2: 1
3: 14
4: 89
Right 926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG 0: 1
1: 1
2: 21
3: 122
4: 791
926077367_926077383 15 Left 926077367 2:9951904-9951926 CCGCACCTGCAGCGAGCGAGCCG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG 0: 1
1: 1
2: 21
3: 122
4: 791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926077383 Original CRISPR CCGCGCGGGCGGGCGGGCGC GGG Intronic