ID: 926079079

View in Genome Browser
Species Human (GRCh38)
Location 2:9969263-9969285
Sequence ATATGCTAGGTGCTGTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 9, 3: 69, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926079079 Original CRISPR ATATGCTAGGTGCTGTGCTA AGG Intronic
901283563 1:8058511-8058533 ATATGCCAGTTGGGGTGCTAGGG - Intergenic
902187584 1:14736891-14736913 GTATGCCAGGTGCTGTTCTAAGG + Intronic
902559362 1:17267395-17267417 GTATGCTAGGTGCTGTCCACGGG + Intronic
902755602 1:18547428-18547450 ATCTGCTGGGCCCTGTGCTAGGG + Intergenic
902930028 1:19724547-19724569 ATATGCCAAGTGATATGCTAAGG - Intronic
904052913 1:27651004-27651026 ATGTGCCAGGCCCTGTGCTAGGG + Intergenic
904863903 1:33561514-33561536 ATGAGCTAGGTACTCTGCTATGG + Intronic
905342698 1:37290127-37290149 ATAGGCCAGGTTTTGTGCTAGGG + Intergenic
906144288 1:43550736-43550758 ATAAGCTAGGAGCAGTGCTGTGG + Intronic
906212580 1:44020361-44020383 GTGTGCTAGGTCCTGTACTAGGG + Intronic
906280367 1:44549288-44549310 ATATGCAAGGCATTGTGCTAGGG - Intronic
906865206 1:49410886-49410908 ATATGCCAGATGCTGTACTAAGG + Intronic
906935089 1:50207772-50207794 ATATGCCAGATACTGAGCTAGGG + Intergenic
907960916 1:59280117-59280139 ATATACCTGGTGCTCTGCTAGGG + Intergenic
908135497 1:61128002-61128024 AGATGCTGGGTTCAGTGCTAGGG - Intronic
908173151 1:61527830-61527852 ATATGTTAGGTACTGTTCAATGG - Intergenic
908833903 1:68209433-68209455 ATGTGCTAGGCATTGTGCTAGGG + Intronic
909519044 1:76546221-76546243 TTATGCTAGGTGCTGTAAGAGGG - Intronic
910068163 1:83178966-83178988 ATGTGCCAGGTGCTGTTCTAAGG + Intergenic
910197745 1:84661521-84661543 ATGTGTTAGGTGCTGTAATAAGG - Intronic
910292720 1:85615035-85615057 ATATGTCAGGTGCAGTGCTGTGG - Intergenic
910466394 1:87504836-87504858 ATGTGCCAGGTACTGTGCCAAGG - Intergenic
910903858 1:92152322-92152344 ATGTGCTAGGCACTGTTCTAAGG - Intergenic
911584398 1:99673803-99673825 ATGTGCTAGGCGTTGTACTAGGG - Intronic
914506247 1:148291750-148291772 ATGTGCCAGGTACTGTGCTAAGG - Intergenic
914894924 1:151661272-151661294 ACATGCTTGATGCTGTGGTAAGG - Intronic
915390725 1:155541180-155541202 ATGTTCTAGGTGCTTTGCTAAGG - Intronic
915908284 1:159895714-159895736 ATATGGTAGGTGGTGAGCTACGG + Intronic
915948658 1:160172898-160172920 ATGTGCTAGGCATTGTGCTAGGG + Intronic
916405052 1:164489907-164489929 GTGTGCTAGGCGCTATGCTAAGG + Intergenic
916582329 1:166120148-166120170 CTGTGCCAGGTGCTGTGCTGGGG + Intronic
916921234 1:169469575-169469597 ATGTGCTAGGTACTGTTCTATGG - Intronic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
918153622 1:181821285-181821307 AGATTCTAGGAACTGTGCTAAGG + Intergenic
918370969 1:183861150-183861172 ATATGCCAGGTACTGTGCTAAGG - Intronic
920058574 1:203211954-203211976 ATGTGGCAGGAGCTGTGCTAGGG - Intergenic
921353703 1:214264167-214264189 ATATGCCAGGTGCTGTTTTAGGG - Intergenic
921498941 1:215876653-215876675 ATATGTTAGGGGATGTCCTATGG + Intronic
921839796 1:219816094-219816116 ATATGCCTGGTGCTATGCTAGGG - Intronic
923040028 1:230313130-230313152 GTATGCCAGGTGATGGGCTAGGG + Intergenic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
1062783824 10:243240-243262 ATGTGCTAGGTACTATGCTCAGG - Intronic
1063236141 10:4118336-4118358 ATATGCTATTTGGTTTGCTATGG + Intergenic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1063549290 10:7014504-7014526 ATAAACTAGGTGCTGGGCTAAGG + Intergenic
1063946434 10:11180693-11180715 ATGCGCTAGGTCCTGTACTAAGG + Intronic
1064098288 10:12440705-12440727 GTATGCCAGGTGCAGTGCTCAGG + Intronic
1064358393 10:14640636-14640658 TTATGCAAGGTGCTATCCTAGGG - Intronic
1064381995 10:14852498-14852520 AGAAGCTAGATACTGTGCTAAGG - Exonic
1064723920 10:18258111-18258133 GTTTGCTCAGTGCTGTGCTAAGG - Intronic
1065841751 10:29707761-29707783 ATATGCCAGGCACTGTGCTAAGG + Intronic
1067498990 10:46785598-46785620 ATATACTGGGTGCTGCACTAGGG - Intergenic
1067595652 10:47554775-47554797 ATATACTGGGTGCTGCACTAGGG + Intergenic
1067818916 10:49509224-49509246 CTAATCTAGGTTCTGTGCTAAGG - Intronic
1068990777 10:63148114-63148136 ATATGTTAGGCACTGAGCTATGG + Intronic
1069083058 10:64108509-64108531 AAATGATATGTGCTATGCTAGGG - Intergenic
1069183885 10:65397726-65397748 ATATGACAGGCGCTGTCCTAAGG - Intergenic
1070104556 10:73418960-73418982 ATTTGCTAGGTACTGTGTTAAGG + Intergenic
1071261404 10:83922688-83922710 ATATTGTTGGTGCTGTGCTGGGG - Intergenic
1071930321 10:90462380-90462402 GTATTCCAGGTGCTGTGCTAAGG + Intergenic
1072223366 10:93346490-93346512 ATGTGCTAGGGACTGTGTTAGGG - Intronic
1072307431 10:94121099-94121121 ACATGCCAAGTGCTGTGCTGAGG + Intronic
1072934453 10:99698920-99698942 CTGTGCCAGGTGCTGTGCAAAGG + Intronic
1072962806 10:99944616-99944638 ATGTGCCAGGCACTGTGCTAAGG - Intronic
1074424580 10:113339597-113339619 ATGTGCTAGGCTCTGAGCTAAGG - Intergenic
1074479225 10:113803464-113803486 CCATGCTAGGTCTTGTGCTAGGG - Intergenic
1075246567 10:120827600-120827622 ATAAGCCAGGTGCTGTGCTCAGG - Intergenic
1075248044 10:120841567-120841589 ATGTGCTAGGAGATGAGCTAAGG - Intergenic
1075429885 10:122371484-122371506 ATATGCTTAGTGCTGGGCTCTGG - Intergenic
1075558861 10:123453667-123453689 ACATCCTAGGTGCTGTGACAAGG - Intergenic
1075896308 10:125998125-125998147 ACTTGCCAGGTGCTGTGCTTTGG + Intronic
1076456234 10:130599722-130599744 AGATGGTAGGTGCTATGTTAAGG - Intergenic
1078740993 11:14066123-14066145 AAATGCTAAGTAATGTGCTAAGG + Intronic
1079234311 11:18676902-18676924 ATGTGCTAGGTGCTGGGCAGAGG - Intergenic
1079621576 11:22562023-22562045 CTGTGCCAGGTACTGTGCTAAGG + Intergenic
1080008202 11:27431452-27431474 GTATGTTAGGTGTTGGGCTAGGG - Intronic
1080502843 11:32886808-32886830 ATGTCTTAGGTCCTGTGCTAAGG - Intergenic
1080791716 11:35527350-35527372 ATGTGGTAGGCTCTGTGCTATGG - Intronic
1080816971 11:35767834-35767856 ATGTGCTAGGCCCTGTCCTAGGG - Intronic
1080929587 11:36795178-36795200 ATATACTAGCTTCTGTGCTTAGG - Intergenic
1081792354 11:45797208-45797230 GTGTGCAAGGTACTGTGCTAGGG + Intergenic
1082099174 11:48157695-48157717 ATATGTAAGATCCTGTGCTAGGG + Intronic
1083207242 11:61160059-61160081 ATATGCTGGGCACTGTTCTAGGG - Intronic
1084441664 11:69178022-69178044 GTATGCTAAGTTTTGTGCTATGG + Intergenic
1084851033 11:71940649-71940671 ATATGCTAGATACTGTGCTGGGG + Intronic
1085063755 11:73473089-73473111 ATGTGACAGGTACTGTGCTAAGG + Intronic
1085609055 11:77930059-77930081 ATATGCTAGGTGCAGTACTAAGG + Intronic
1086469650 11:87094556-87094578 ATAGGCTAGGTGTGGTGGTATGG + Intronic
1086849612 11:91793975-91793997 ATATGCTTGGCCCTGTTCTAAGG - Intergenic
1086961810 11:92985600-92985622 ATATGCCAGGCACTGTTCTAAGG + Intergenic
1087855379 11:103086333-103086355 ATATACCAGGTATTGTGCTAAGG + Intronic
1089181585 11:116586984-116587006 ATGTGCCAGGAACTGTGCTAAGG - Intergenic
1089254162 11:117185404-117185426 ATATGCCAGGTGGTATGCTAAGG + Intronic
1089561165 11:119343948-119343970 ATATGCCAGGTGCAGAGCTGGGG + Exonic
1089600042 11:119608256-119608278 TTGTGCTACGTACTGTGCTAAGG + Intergenic
1089618936 11:119711492-119711514 GTGTGCAAGGTGCTGAGCTAGGG + Intronic
1089654325 11:119935836-119935858 AAGTGCCAGGTGCTGTGCTGGGG + Intergenic
1090697140 11:129258147-129258169 ATATGTTCTATGCTGTGCTATGG + Intronic
1093426650 12:19035533-19035555 ATGTGCTAAGTGCTGTGATGGGG + Intergenic
1093566624 12:20613969-20613991 ATATGCCAGGCGCTTTTCTAAGG + Intronic
1096234078 12:49913958-49913980 ATATGCTAGGTCCCATGCTAAGG + Intergenic
1096513143 12:52142953-52142975 ATGTGCTAGGCACTTTGCTAAGG - Intergenic
1097900435 12:64867625-64867647 ATATGCCAGGGTCTGTGCTAAGG - Intronic
1098162222 12:67656708-67656730 ATATGAAAGGTGCTGTGATCTGG + Intronic
1098235557 12:68414826-68414848 ATATGCCAGGTGGTATGCCAGGG - Intergenic
1099346177 12:81502643-81502665 ATGTGCTAGGAACTGTGCTAGGG + Intronic
1099705246 12:86143984-86144006 ATGTGCTAGGCACTGTGCTAGGG - Intronic
1099947728 12:89263969-89263991 TTATGCTAAGTGCTGTGCCCTGG - Intergenic
1100233122 12:92630409-92630431 ATATGCCAGGCACTGAGCTATGG + Intergenic
1100293685 12:93240364-93240386 ATATAGTAGGTGCTATGATATGG - Intergenic
1100892191 12:99138087-99138109 ATATGCCAGATGTTATGCTAGGG - Intronic
1101653006 12:106694705-106694727 ATATGCCAGGTACTTTGCTTAGG - Intronic
1102522642 12:113488284-113488306 ATGTGCTAGGCACTCTGCTAGGG + Intergenic
1102622659 12:114209093-114209115 ATGTCTTAGGTGCTGTGCTAGGG - Intergenic
1102751495 12:115298544-115298566 GTGTGCCAGGTGCTGAGCTAAGG - Intergenic
1103251174 12:119501270-119501292 ATGGGCTAGGTTCTGTGCTAAGG + Intronic
1103906781 12:124331904-124331926 AACTGCCAGGCGCTGTGCTAGGG + Intronic
1104548647 12:129735290-129735312 AAATGCCAGGTGGTGTGATAGGG - Intronic
1104795530 12:131514547-131514569 ATGTGCTTGGTGCTGGGCCATGG - Intergenic
1105843765 13:24277715-24277737 GTATGCCAGGTACTATGCTAGGG + Intronic
1106064937 13:26336919-26336941 ATATGATAAGTGCTATGATATGG - Intronic
1106387220 13:29299534-29299556 TTATGCTAAGTGCTGTGAAAGGG + Intronic
1106698558 13:32204821-32204843 ACATGCTAGGCACTGTGCTTGGG + Intronic
1108278599 13:48838343-48838365 ATGTGCTAAGTGCTGTGCTTGGG + Intergenic
1108604720 13:52026098-52026120 GTGTGCCAGGTGCTATGCTAAGG + Intronic
1110036546 13:70693199-70693221 ATTTGCTCTGTGCTGAGCTAAGG + Intergenic
1110155520 13:72312171-72312193 ATATGCCAGGCACTATGCTATGG + Intergenic
1110681551 13:78319444-78319466 AAATGCAAGGTGATGTGTTATGG - Intergenic
1112193569 13:97202487-97202509 ATGTGCTAGGGGCTATTCTAAGG - Intergenic
1112550295 13:100413620-100413642 ATGTACTAGGTGCTGTTCTAAGG + Intronic
1114421148 14:22584161-22584183 ATGTGCTAGGTTCTCTGCCAAGG - Intronic
1114516664 14:23304134-23304156 ATGTGCTAGGTACTGTTGTAAGG + Intronic
1115519240 14:34216520-34216542 ATATGCCAGGCCCTGTGCAAAGG + Intronic
1115841152 14:37471914-37471936 ATGTGCTGGGCGCTTTGCTAGGG - Intronic
1116479362 14:45380175-45380197 ATATTATAGGTGCTTTGTTAGGG + Intergenic
1117405809 14:55402192-55402214 TTATGAAAGGTGCTGTGCTTGGG - Intronic
1118055556 14:62076127-62076149 ATATGCCAGGCACTGTGATAAGG + Intronic
1118337228 14:64863967-64863989 ATATGCCAGCTGCCATGCTAGGG - Intronic
1118417886 14:65563278-65563300 ACATGCCAGGTACTGTGCCAAGG + Intronic
1118685636 14:68287826-68287848 ATAGGCCGGGTACTGTGCTAAGG + Intronic
1118744250 14:68762552-68762574 ATGTGCCAGGTCCTGTGCTAGGG - Intergenic
1118778792 14:68992269-68992291 AAATGTTAGGCTCTGTGCTAAGG - Intergenic
1118805040 14:69228760-69228782 TTATGCTCGCTGCTGTGCTCAGG + Intronic
1119442194 14:74636015-74636037 CTGTCCCAGGTGCTGTGCTAGGG + Intergenic
1119518304 14:75265866-75265888 ATATGCCAGATACTGTGTTAGGG + Intronic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1119621073 14:76132287-76132309 CTGTGCTAAGTGCTGTGCCAAGG + Intergenic
1119820650 14:77613506-77613528 ATGAGCTAGATGCTGTGTTAAGG - Intronic
1119940537 14:78636463-78636485 ATCTGCTTGGTGCTGTAGTAAGG - Intronic
1120565692 14:86053309-86053331 ATATGCCAGCTGCTATGCTATGG + Intergenic
1121158258 14:91708052-91708074 ATATGCCAGATTCTGTGCTAAGG - Intronic
1121805801 14:96821205-96821227 ATGTGCCAGGAACTGTGCTAGGG - Intronic
1123509735 15:20985037-20985059 ATGTGCTAGGTGTTGGGCCAAGG - Intergenic
1123566955 15:21558776-21558798 ATGTGCTAGGTGTTGGGCCAAGG - Intergenic
1123603219 15:21996069-21996091 ATGTGCTAGGTGTTGGGCCAAGG - Intergenic
1124047607 15:26164465-26164487 ATGTGCCAGCTGCTGTGCTAGGG + Intergenic
1124867073 15:33502913-33502935 TTATGCCAGGTACTGTTCTAAGG - Intronic
1126691208 15:51290164-51290186 ATATGCCAGGCACTGTGCAAAGG - Intronic
1126800147 15:52290926-52290948 ATGTGTCAGGTGCTGTGCTAAGG + Intronic
1127698688 15:61475934-61475956 TTATGCCAGGTACTGTTCTAAGG - Intergenic
1129193784 15:73952576-73952598 GAAGGCCAGGTGCTGTGCTAGGG + Intergenic
1129745365 15:78015757-78015779 ATGTGCCAGGAGCTGTGCTAAGG - Intronic
1129931424 15:79414155-79414177 ATTTGTTATGTGCTGTGCTGGGG + Intronic
1130569080 15:85024299-85024321 ATATGCCAGGTACTGTGCCAGGG - Intronic
1130976340 15:88778487-88778509 ACATGTAAGGTGCTGGGCTAGGG - Intergenic
1131049631 15:89337968-89337990 AGCTGCCAGGTGCTGTTCTAAGG + Intergenic
1132104913 15:99056565-99056587 AAGTGCTAGGCCCTGTGCTAAGG + Intergenic
1202975316 15_KI270727v1_random:285870-285892 ATGTGCTAGGTGTTGGGCCAAGG - Intergenic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1132818932 16:1851526-1851548 GTATGCTGGGTGCTGTTCTGGGG - Intronic
1133071623 16:3250214-3250236 ATTTGCCAGGTACTCTGCTAGGG - Intronic
1133515263 16:6502533-6502555 ATGTGTTAGGTACTATGCTAAGG - Intronic
1134555675 16:15161945-15161967 ATATGCCAGGTCCTGTGCTATGG + Intergenic
1134916257 16:18073656-18073678 ATATGCCAGGTTCTGTGCTATGG + Intergenic
1137395495 16:48113960-48113982 ATATTCCAGGTGCAGAGCTAGGG + Intronic
1137476503 16:48814081-48814103 TTGTGCTAGGCACTGTGCTAGGG + Intergenic
1138263314 16:55641248-55641270 TTATGCTCGCTGCTGGGCTATGG - Intergenic
1139294602 16:65889432-65889454 ATGTGCTAGGCACTGTGTTAGGG - Intergenic
1140796735 16:78445404-78445426 ATAAGCCGGGTGCTTTGCTAGGG + Intronic
1141346686 16:83253034-83253056 CTGTGCCAGGTGCTGTGCTAAGG - Intronic
1141895432 16:86955948-86955970 ATGTTCTAGGTGCTTTGCTGTGG - Intergenic
1142637323 17:1266074-1266096 ATGTGCCAGGTACCGTGCTAAGG + Intergenic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1144049505 17:11486477-11486499 ATATGCAAAGTACTATGCTAAGG + Intronic
1146188461 17:30743704-30743726 ATGTGCTAGGTACTGTGGCAGGG + Intergenic
1146333335 17:31948020-31948042 ATGTGCTAGGTACTGTGGCAGGG + Intronic
1146733309 17:35214509-35214531 TTGTGCTAGGTGATGTACTATGG + Intergenic
1147951073 17:44108379-44108401 CTGTGCTAGGTGCTGGGCAATGG + Intronic
1148150483 17:45394099-45394121 CTGTGCCAGGTGCTGTGCTCTGG - Exonic
1148172579 17:45535149-45535171 AGATGCTAGGTAATTTGCTAAGG - Intergenic
1148977024 17:51538622-51538644 CTATTGTAGGTGCTGTGCTAGGG + Intergenic
1149388340 17:56164489-56164511 ATGTGCCAGCTACTGTGCTACGG - Intronic
1149732599 17:58961315-58961337 ATCTGCTAGGTACTATACTATGG + Intronic
1150203824 17:63385129-63385151 ATGTGTCAGGTTCTGTGCTAGGG - Intronic
1150494838 17:65599375-65599397 ATGTGCTGGGCACTGTGCTAAGG + Intronic
1150820554 17:68431012-68431034 CTATGCTAGGTGCACTGCTAGGG + Intronic
1150843353 17:68630204-68630226 ATGTGCTAAGCTCTGTGCTAAGG - Intergenic
1151184250 17:72351666-72351688 ACGTGCCAGGTGCTGTGCAAAGG - Intergenic
1152998584 18:431861-431883 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1153203832 18:2675168-2675190 ATATGCGAGGCTCTGTCCTAAGG - Intronic
1153484740 18:5585687-5585709 CTTTGCTAGGCACTGTGCTATGG + Intronic
1155465981 18:26135631-26135653 ATATGCTACATGCTATGCTGGGG - Intronic
1156234772 18:35191810-35191832 ATGTGCCAGACGCTGTGCTAGGG + Intergenic
1156385539 18:36601517-36601539 ATATGCCAGGCACTGTCCTAAGG + Intronic
1156588001 18:38453736-38453758 ATGTGCCCGGTGCTGTTCTAAGG + Intergenic
1156847337 18:41681808-41681830 ATGTGCTAACTGCTGTGGTAGGG - Intergenic
1158638910 18:59185588-59185610 ATGTGATAGGGGCTGTGCTAAGG - Intergenic
1158865479 18:61634316-61634338 ATGGACTAAGTGCTGTGCTAAGG + Intergenic
1159135879 18:64336414-64336436 ACATGCCAGGTGCTTTACTAGGG - Intergenic
1160048990 18:75414340-75414362 ACATGCCAAGTACTGTGCTAGGG + Intronic
1160057775 18:75501497-75501519 AAATGCTAGCTTCTGTGCTGTGG + Intergenic
1160301437 18:77684322-77684344 ATATGCCAGGTATTGTTCTAGGG + Intergenic
1161609329 19:5232279-5232301 ATGTGCCAGGTACTGTGCCAAGG + Intronic
1161609652 19:5234817-5234839 GTGTGCCAGGTGCTGTGCTGGGG + Intronic
1161653823 19:5500950-5500972 ATTTGCTATCAGCTGTGCTAGGG + Intergenic
1161758776 19:6155025-6155047 ATTTGCTAAGCACTGTGCTAAGG - Intronic
1161876354 19:6914071-6914093 AGCTGCTATGTGCTGGGCTAAGG + Intronic
1162528125 19:11218795-11218817 ATGTGCCAGATGCTGTTCTAAGG + Intronic
1162738212 19:12758212-12758234 ATGTGTTTGGCGCTGTGCTAGGG + Exonic
1164925001 19:32123789-32123811 GCATGCCAGGTGCTGTGCTGTGG - Intergenic
1165778793 19:38420338-38420360 AATTTCTAGGTGCTGAGCTAGGG + Intronic
1166397838 19:42455422-42455444 ATCTGCTATATGCTGTGCTGAGG - Intergenic
1166733846 19:45073103-45073125 ACATGCTAGGTGCTGAGCCATGG + Intronic
1166850593 19:45758806-45758828 CAATGCCAGCTGCTGTGCTAGGG + Intronic
1167078358 19:47262801-47262823 GAATGCTGGGTGCTGTGGTATGG + Intronic
1167355279 19:48999740-48999762 CTCTGTTAGGTCCTGTGCTAGGG - Intronic
1168073492 19:53965523-53965545 AGATGCCACGTGCTGTCCTAGGG - Intronic
1168208516 19:54870829-54870851 CTATGATAGGCCCTGTGCTAAGG + Intergenic
925296977 2:2783731-2783753 CTATGCCAGATGCTGTGCTAAGG - Intergenic
926079079 2:9969263-9969285 ATATGCTAGGTGCTGTGCTAAGG + Intronic
927491491 2:23524172-23524194 ACTTGCTCAGTGCTGTGCTAGGG + Exonic
928443678 2:31314520-31314542 ATGTGCTGGGTGCATTGCTAAGG - Intergenic
929165020 2:38873555-38873577 ATATGCTAGACACTGTGTTAAGG - Intronic
929920765 2:46169692-46169714 ATATGTCAGCTGCTGCGCTAGGG - Intronic
930016245 2:46972791-46972813 CTATGTGAGGTGCTGTTCTAGGG + Intronic
930036163 2:47086462-47086484 ATGTGCAAGGTGCTGAGCTGGGG - Intronic
931162467 2:59707833-59707855 ATGTGTCAGATGCTGTGCTAAGG + Intergenic
931787609 2:65634355-65634377 ATGTGCCAGCTGCTGTTCTAAGG + Intergenic
932606182 2:73167147-73167169 CTACGCTAGGTGCTGTGCAGTGG + Intergenic
933755163 2:85632778-85632800 AGGTGTTAAGTGCTGTGCTATGG + Intronic
934552342 2:95270173-95270195 ATATGCTGGGTTCTGTGTTCAGG + Intergenic
935355583 2:102196499-102196521 ATCTTCTTGGTGCTGTGCCAAGG + Intronic
935465179 2:103388468-103388490 CTATGCTAAATGCTGTGTTAGGG - Intergenic
935730104 2:106058195-106058217 CTGTGCTGGGTGCTGTGCTTGGG - Intergenic
935737960 2:106121143-106121165 GTATGCTAGGTACTGTTCTAGGG - Intronic
935856529 2:107280683-107280705 ATATGCTAGGTACTCTTTTAGGG + Intergenic
936797838 2:116228406-116228428 ATATGCCAGGAACTGTGCTGGGG + Intergenic
938754712 2:134368965-134368987 ATAAACAGGGTGCTGTGCTAGGG - Intronic
938983310 2:136547462-136547484 GTGAGCTAGGTGCTGTGCTAGGG + Intergenic
939729492 2:145764415-145764437 ATGTGCCAGATACTGTGCTAAGG - Intergenic
940435968 2:153654967-153654989 ATAAGTTAGGTGCTATGCTAGGG - Intergenic
940511900 2:154626313-154626335 ATGTGCCAGATCCTGTGCTAGGG - Intergenic
941365241 2:164602811-164602833 ATATGTTAGGTGCCCTGCTTAGG - Intronic
941512720 2:166433426-166433448 GTGTGTCAGGTGCTGTGCTAGGG + Intronic
942828087 2:180204780-180204802 ATATGCTAGGCACTGTTCTAGGG + Intergenic
944473032 2:200075698-200075720 ATGTGGTAAGTTCTGTGCTATGG - Intergenic
944662977 2:201936600-201936622 ATATGTTAGGTCCTATGCTATGG + Intergenic
946738165 2:222775159-222775181 ATCTGCTGAGTGCTGTGCTATGG - Intergenic
947158582 2:227188795-227188817 GTGTGCTAGGTGCTGTGTTATGG + Intronic
947817309 2:233046746-233046768 ATGTGTTATGTACTGTGCTAAGG + Intergenic
948681886 2:239640742-239640764 ATTTGCCGGGTGCTGTACTATGG - Intergenic
1168740846 20:190243-190265 ATAAGTTGAGTGCTGTGCTAAGG - Intergenic
1169479472 20:5965304-5965326 ATGTGCTAGGTTTTTTGCTAAGG - Intronic
1172074569 20:32284406-32284428 ATTTTCTAGGTGCTGAGTTAGGG + Intronic
1172119015 20:32586704-32586726 GTGTGCCAGGTGTTGTGCTAGGG - Intronic
1172834293 20:37863162-37863184 CAGTGCTAAGTGCTGTGCTATGG + Intronic
1172908098 20:38384551-38384573 ATGTGCCAGGTGCTGTTCTAGGG - Intergenic
1173025751 20:39305889-39305911 ATGTGCCAGGTACTGTGCTGGGG + Intergenic
1173133255 20:40414532-40414554 ATGTGCTAGGTGCCGTGGTGTGG - Intergenic
1173351422 20:42248923-42248945 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1173911325 20:46673167-46673189 AAAAGCCAGGTGCTGTTCTAAGG + Intronic
1174854142 20:54026864-54026886 AGATGCCAAGTGCTGTGCTGGGG - Intronic
1175031932 20:55963325-55963347 ATGTGCAAGGCACTGTGCTATGG + Intergenic
1175640720 20:60628030-60628052 ATGTGCCAGGCACTGTGCTAAGG - Intergenic
1176947178 21:14996535-14996557 ATCTCCGAGGTGCTCTGCTAGGG - Intronic
1177199481 21:17937861-17937883 ATGTGCCAGGTGCTATGTTAAGG + Intronic
1177636368 21:23791962-23791984 ATAAGCTAGTTACTGTTCTAAGG + Intergenic
1178461587 21:32807217-32807239 ATGTGCCAGGCCCTGTGCTAAGG - Intronic
1178769123 21:35485905-35485927 AAGTGCAAGGTACTGTGCTAGGG - Intronic
1178977734 21:37234016-37234038 ACATGCTGGGTGCTGTCCCAGGG - Intronic
1181545600 22:23600383-23600405 AAATGCTAGGTGCAGAGCTATGG - Intergenic
1181814707 22:25429516-25429538 AAATGCTAGGTGCAGAGCTATGG + Intergenic
1182214308 22:28703099-28703121 ATGTGCCAGGTGCTCTGCTGGGG + Intronic
1182392529 22:30010927-30010949 GTATGCTAGGCACTGTGCTGGGG + Intronic
1182575274 22:31268740-31268762 ATATGCTAGGCACTGGGCTGAGG + Intronic
1183224222 22:36538290-36538312 TTATGCCAGGCACTGTGCTATGG + Intergenic
1183272200 22:36869268-36869290 ATATGCCTGGTGTTGTTCTAAGG + Intronic
1183563977 22:38599653-38599675 GTGTGCCAGGCGCTGTGCTAAGG + Intronic
1184310786 22:43641031-43641053 ATGTGTTAGGTTCTGTGCGAGGG - Intronic
1184527290 22:45032418-45032440 ATGGGCCAGGTGCTGTACTAAGG + Intergenic
949202790 3:1399764-1399786 ATGTGCCAGGCACTGTGCTAGGG + Intronic
951806942 3:26655803-26655825 ATATGCCAGGTACTGGGCCAAGG + Intronic
952269967 3:31820918-31820940 AAGTGCTAGGTGCTGTGCTAAGG + Intronic
952925641 3:38317293-38317315 ACATGCTAGGCACTGTGCCAGGG + Intronic
955134104 3:56199035-56199057 ATATGACAGGCACTGTGCTAAGG + Intronic
955840110 3:63103601-63103623 ATGTGCTAGGAGCTGTTCTTGGG + Intergenic
956159126 3:66329995-66330017 ATGTGCCAGATGCTGTTCTAGGG + Intronic
956345797 3:68277058-68277080 ATGTGCCAGGCACTGTGCTAAGG + Intronic
956429609 3:69172574-69172596 ATATGCTAGATGCTTTCCTCAGG + Intronic
956611169 3:71124726-71124748 ATGTTTCAGGTGCTGTGCTAAGG - Intronic
958730452 3:97955153-97955175 GAGTGCTAGGTGCTTTGCTAGGG - Intronic
959502278 3:107120078-107120100 ATGTGATAAGTGCTGTGATAGGG - Intergenic
959635148 3:108558510-108558532 ATGTGCCAAGTGCTATGCTAGGG + Intronic
959670871 3:108975711-108975733 ATATGCTAGGCACAGTCCTAAGG - Intronic
960678756 3:120225148-120225170 ATGTGCACGGTGCTCTGCTAGGG + Intronic
962128759 3:132650316-132650338 CCATGCTAGGTGCTTTGCTAGGG + Intronic
962930341 3:140030180-140030202 ATGTGCCAGGTGCTGTCCTGGGG + Intronic
964598794 3:158471384-158471406 ATATACTAGGCTCTGTGATAAGG - Intronic
965611905 3:170553210-170553232 ATATGCTAGGCACTGTGCTTGGG - Intronic
965898107 3:173603375-173603397 ATATGCAAGATGCTGTGATTAGG + Intronic
965932017 3:174056005-174056027 ATATGCTAAGTATTGTGCTCTGG + Intronic
966883971 3:184364643-184364665 CTATGCTAGGCACTGTGCTGAGG - Intronic
967888784 3:194350573-194350595 ATGTGCCAGGCGCTGTGTTAAGG - Intronic
969179420 4:5425507-5425529 ACATGCTAGGCACTGTTCTATGG + Intronic
969202069 4:5614439-5614461 ATGTGATAGGTGCTATGGTAAGG + Intronic
969987231 4:11225009-11225031 ATGTGCCAGGTACTATGCTAAGG - Intergenic
970262772 4:14246018-14246040 GTATTCTAGGTGCTGAGATAAGG - Intergenic
970852772 4:20621308-20621330 ATATGCCAGGTACTATGCTCAGG + Intergenic
970907781 4:21237212-21237234 CAATGCTGGGTGATGTGCTAAGG + Intronic
971172716 4:24249862-24249884 ATGGGCTAGGTATTGTGCTAGGG - Intergenic
973551998 4:52044849-52044871 ATGTGCCAGTTGCTGTGCTGAGG + Intergenic
973720345 4:53717586-53717608 ACATCCCAGGTGCTGTTCTAAGG - Intronic
973839552 4:54846948-54846970 ATATACTTGGTTCTGTGCTAAGG - Intergenic
973869721 4:55153955-55153977 ATATGCCAGGTACTATTCTAAGG - Intergenic
974406017 4:61470682-61470704 ATGAGCAAGGTTCTGTGCTATGG + Intronic
975772519 4:77742630-77742652 ATATGATAGATTCTGTGATAGGG + Intronic
975859461 4:78661000-78661022 AAATGCTAGGTAATGTCCTAAGG + Intergenic
976468813 4:85403101-85403123 TTATGCTAGACACTGTGCTAAGG + Intergenic
978054003 4:104240209-104240231 ATATGCAAGGCACTGTGTTAAGG - Intergenic
979231257 4:118351968-118351990 CTATGCAAGGTGCTGAGCTCTGG - Intronic
979316706 4:119273519-119273541 ATATGCCATGTGCTGTTCTAGGG - Intronic
979898028 4:126185724-126185746 TTATGTTAGGTGCTGTTTTATGG - Intergenic
980264902 4:130502721-130502743 CTATGCTAGGCACTGTGATAGGG + Intergenic
980883406 4:138737409-138737431 ATGTGCCAGATGCTGTACTAAGG + Intergenic
981322811 4:143412475-143412497 ATGTACTAGGCACTGTGCTATGG + Intronic
982034695 4:151334170-151334192 ATATGCCAGGAGCTGTTCTAAGG - Intergenic
982163233 4:152590918-152590940 ATGTGCCAGGTACTGTTCTAAGG + Intergenic
982422252 4:155211190-155211212 ATATGCTATATAGTGTGCTAGGG + Intronic
982565461 4:156980295-156980317 ATGTGCCAGGTACTGTCCTAAGG + Intergenic
982610628 4:157569751-157569773 ATATGCTAGGCACTGTTCTAGGG + Intergenic
984090821 4:175373199-175373221 GTATGCCAGGCACTGTGCTATGG - Intergenic
984838897 4:184050183-184050205 ATATGCCAGGCGCTGGTCTAGGG + Intergenic
984926382 4:184810820-184810842 GTGTGTCAGGTGCTGTGCTACGG + Intronic
987346971 5:16987548-16987570 ATATGCCAGATCCTTTGCTATGG - Intergenic
988105115 5:26735533-26735555 ATATGCAAGTTGCTGTGTTAAGG - Intergenic
991524674 5:67543124-67543146 ATATGTTAGGTACTATCCTAGGG - Intergenic
992441288 5:76799865-76799887 ATGTGCCAGGTACTGTGTTACGG + Intergenic
992648469 5:78834115-78834137 CGATGTTAGGTTCTGTGCTACGG + Intronic
992867938 5:80976542-80976564 ATGTGCTGGGTTCTGTGCTGAGG + Intronic
992957942 5:81929790-81929812 ATGTGCAGGCTGCTGTGCTAGGG - Intergenic
993767104 5:91873874-91873896 ATGTGCTAGCCACTGTGCTAAGG + Intergenic
994337480 5:98585075-98585097 ATATGTTAGGCACTTTGCTAAGG + Intergenic
995500692 5:112803582-112803604 ATATGCCAGGGACTGTGTTAAGG - Intronic
995797097 5:115953044-115953066 ATATGCCAGATTCTGGGCTAGGG - Intergenic
997198590 5:131995867-131995889 ATATGCCAGATGCAGTGCAAGGG - Intronic
997258750 5:132449270-132449292 ATATGCCAGGCACTGTCCTAGGG - Intronic
997390346 5:133510039-133510061 GTATGCTAGGCCCTGTGCCAAGG + Intronic
997662080 5:135597041-135597063 ATATGCTAGGCACTATGCTGGGG - Intergenic
998714276 5:144864690-144864712 CTATGCTAGGGACTATGCTAGGG - Intergenic
999326405 5:150646908-150646930 GTATGACAGGTGCTGTTCTAGGG + Intronic
999387724 5:151166997-151167019 AAGTGCCAGGTGCTGTGCTAAGG + Intergenic
999582178 5:153051051-153051073 ATATGCTGGGTACTGTGAAAAGG + Intergenic
1000383342 5:160648619-160648641 CTCTGCCAGTTGCTGTGCTAAGG + Intronic
1001371752 5:171211052-171211074 ATGTGCTATGTACTATGCTAAGG - Intronic
1002372515 5:178766747-178766769 ATATGCTGGGTGCTGTTCCAGGG - Intergenic
1003267800 6:4581790-4581812 ATTTTCCAGGTCCTGTGCTAGGG - Intergenic
1003513152 6:6798356-6798378 ATGTGCCAGGTTCTGTGCTTGGG + Intergenic
1003667253 6:8122754-8122776 GTCTACCAGGTGCTGTGCTACGG - Intergenic
1005080500 6:21952421-21952443 ATATGCTAGATACTGCGCTAAGG + Intergenic
1005145369 6:22684091-22684113 ATGTGCCAGGTGCTATTCTAAGG - Intergenic
1005495901 6:26387803-26387825 AGATGCTTGGTGCTGTGATGGGG + Intronic
1005500593 6:26425962-26425984 AGATGCTTGGTGCTGTGATGGGG + Intergenic
1005505118 6:26462952-26462974 AGATGCTTGGTGCTGTGATGGGG + Intronic
1006671259 6:35731274-35731296 TTATGCTTGGGGCTGTGCTTAGG - Intergenic
1006888472 6:37402286-37402308 GTAGTTTAGGTGCTGTGCTAGGG - Intergenic
1006903778 6:37519561-37519583 ATGTGCCAGGTAATGTGCTATGG - Intergenic
1007111529 6:39315812-39315834 ATGTGCCAGGTGCTGTGCCAGGG - Intronic
1007179259 6:39916436-39916458 CTGTGCTAGGTGCTCTGCTGAGG + Intronic
1007462414 6:42028115-42028137 ACATGCTAGGCACAGTGCTAGGG - Intronic
1007698982 6:43754587-43754609 ATATACCAGGCCCTGTGCTAGGG - Intergenic
1007746678 6:44047486-44047508 CTGTGCCAGGTGCTGTGCTTGGG - Intergenic
1008055847 6:46945461-46945483 ATGTGCCAGGTACTGTGCTAGGG + Intronic
1008556134 6:52674571-52674593 ATGTGCTAGGTGCCATTCTAAGG - Intronic
1009767867 6:68105282-68105304 ATGAGCCAGGTTCTGTGCTAGGG + Intergenic
1011261367 6:85473351-85473373 ACATACTAGGCCCTGTGCTAAGG - Intronic
1011321993 6:86105512-86105534 AGAAGCTAGGTGCTCTCCTATGG + Intergenic
1011520124 6:88195801-88195823 ATGTGTTAGATGCTGTGCCAGGG + Intergenic
1012122434 6:95384866-95384888 ATCTGCAAGGTGCTGAGCAAGGG - Intergenic
1012559586 6:100563882-100563904 ATATGGTAGGTAATGTACTAAGG + Intronic
1013203886 6:107929014-107929036 GTATGCTAGAATCTGTGCTAGGG - Intronic
1013858206 6:114601542-114601564 CTCTGCTAGCTGCTATGCTAGGG + Intergenic
1014088792 6:117378866-117378888 ATATGGTAAGTGCTGTGATGGGG - Intronic
1015622331 6:135144255-135144277 AAATGCTAGGCTCAGTGCTAGGG + Intergenic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1016360027 6:143257776-143257798 AAGTTCTAGGTGCTGTGCTAAGG + Intronic
1018332429 6:162744912-162744934 ATTTGCTAGGTTCTGTGATATGG - Intronic
1019839552 7:3426546-3426568 ACGTGCTAGGTACTGTCCTATGG - Intronic
1020263591 7:6545697-6545719 ATGTGCCAGGCGCTGTGCTTGGG - Intronic
1022348933 7:29548055-29548077 ATGTGTCAGGTACTGTGCTAGGG + Intergenic
1022410062 7:30132667-30132689 ATGTGCTAGGTTCTGGGATAAGG + Intergenic
1022833736 7:34094208-34094230 ACATGCTAGGTTCTGTCATAGGG + Intronic
1023117232 7:36874454-36874476 ATATGCTAGGCCCTGTGCTAAGG - Intronic
1023143738 7:37128801-37128823 ATGTGCTAGGCTCTGTGCCAGGG + Intronic
1023656835 7:42431803-42431825 ATATGTTAGGAACTGTGCTAGGG + Intergenic
1024880211 7:54076734-54076756 ATATGTCAGATCCTGTGCTAGGG + Intergenic
1025234679 7:57226674-57226696 CTGTGCCAGGTGCTGTGCTCAGG + Intergenic
1025843841 7:65177750-65177772 ATATGCTAGGTGCAGTACTAAGG - Intergenic
1025894174 7:65684061-65684083 ATATGCTAGGTGCAGTACTAAGG - Intergenic
1027275935 7:76555793-76555815 ATGTGCCAGGTGCTGTTCTAAGG - Intergenic
1027419667 7:78006681-78006703 GTGTGCCAGGTGCTGTGCAAGGG - Intergenic
1027473690 7:78603908-78603930 ATATGACAGGTACTGTGGTAGGG + Intronic
1029253308 7:99252151-99252173 ATAAGAGAGGTGCTGTCCTAGGG + Intergenic
1032443812 7:131962781-131962803 ATATGCTTGGTACTGACCTAAGG - Intergenic
1032490313 7:132319380-132319402 ATATTCCAGGTGCTGTGATGAGG + Intronic
1033461854 7:141553606-141553628 ATATGGTAGGCTCTGTGCTGGGG - Intronic
1035012344 7:155730461-155730483 ATTTGCTAGGTACTGTCCTAAGG + Intronic
1035134486 7:156687763-156687785 ATGTGCCAGGCGCTATGCTAAGG + Intronic
1036200079 8:6763479-6763501 CTGTGTTAGGCGCTGTGCTAGGG + Intergenic
1036203381 8:6787513-6787535 TTGAGCCAGGTGCTGTGCTAAGG - Intergenic
1036287934 8:7461050-7461072 CTATTCTAGGTACTGTGCAATGG - Intronic
1036333542 8:7850478-7850500 CTATTCTAGGTACTGTGCAATGG + Intronic
1036993338 8:13625887-13625909 AAATGATAGGTGGTGTACTATGG - Intergenic
1037062926 8:14538760-14538782 AGATGCTATATGCTGTGTTAAGG + Intronic
1037506869 8:19539452-19539474 ATATGCCAGGCCCTGTGCTGAGG - Intronic
1038826782 8:31011784-31011806 TTTTGCCAGGTTCTGTGCTAGGG - Intronic
1039247140 8:35621349-35621371 ACATGCTAGGTACTCTGCTATGG - Intronic
1039889459 8:41674250-41674272 ACATGCCAGGCACTGTGCTATGG + Intronic
1041694432 8:60720822-60720844 ACATGCCAGGCCCTGTGCTAAGG - Intronic
1042577950 8:70241802-70241824 ACATGCCAGGTCCTGTTCTATGG - Intronic
1042777675 8:72451920-72451942 ATATGCCAGATCCTGTTCTAGGG - Intergenic
1042837187 8:73089790-73089812 ACATGCCAGGTGCAGTGCTCTGG + Intronic
1043000746 8:74756826-74756848 ATATACTAGGTGCTGGGGTTGGG - Exonic
1043388740 8:79770925-79770947 ATGTGCCATGTGCTGTGCTAGGG + Intergenic
1044656545 8:94554180-94554202 ATTTCCTAGTTGCTCTGCTAAGG - Intergenic
1046493981 8:114989610-114989632 ATATGCTAGGTACTGCTCTAAGG - Intergenic
1046731438 8:117730494-117730516 AAGGGCCAGGTGCTGTGCTACGG - Intergenic
1047014257 8:120706094-120706116 TTGTGCTAGATGCTGTTCTAAGG - Intronic
1047773136 8:128046631-128046653 ATTTCTCAGGTGCTGTGCTAAGG - Intergenic
1048284518 8:133131317-133131339 ATTTGCCAGGTACTGTGCTGCGG + Intronic
1048315456 8:133358595-133358617 ATATGCCAGGTACTCTTCTAAGG - Intergenic
1050267190 9:3903616-3903638 ATATGCCAGGCACTGTTCTAGGG + Intronic
1050607861 9:7319789-7319811 ATGTGTCAGGTGCTATGCTATGG + Intergenic
1050740504 9:8814063-8814085 ATGTGTCAGGTGCTGTGCTCTGG - Intronic
1051897286 9:22000939-22000961 AGATACTAGGTACTGAGCTATGG - Intronic
1051916343 9:22212525-22212547 ATATGCCAGACGCTGTACTAGGG + Intergenic
1051951691 9:22642504-22642526 ATATACTATGTGCTGTCCAATGG - Intergenic
1052168694 9:25366222-25366244 ATGTGCCAGGTGCTGTGCTAAGG + Intergenic
1055507636 9:76964474-76964496 AAATGCTAGGCACTGTCCTAAGG + Intergenic
1055955561 9:81770145-81770167 ATGTACCAGGTACTGTGCTAAGG + Intergenic
1057105796 9:92414601-92414623 ATGTGCTATGTGGTGAGCTAGGG + Exonic
1058586395 9:106511022-106511044 ATATGCCAGGTACTATTCTAGGG - Intergenic
1058652796 9:107192538-107192560 ATGTGCTAGGCACTGTTCTAAGG + Intergenic
1058749607 9:108026406-108026428 ATGTGCTAGGTCCTGTTTTAAGG + Intergenic
1058793502 9:108474104-108474126 ATCTGCTAGGCACTGAGCTAGGG + Intergenic
1059474361 9:114532488-114532510 ATATCCTAGATGCTATGCTAAGG + Intergenic
1059635463 9:116166109-116166131 ACATGCTAGGTCATGTGCTTTGG - Intronic
1059742503 9:117165653-117165675 GTGTGCTGGGTGCTGGGCTAAGG - Intronic
1060038505 9:120279956-120279978 ATATCCCAGGAGCTGTACTAGGG - Intergenic
1060339002 9:122756747-122756769 CTATGCTAGGTGATGTGTCATGG + Intergenic
1060485869 9:124045791-124045813 ATCTGATAGGGGCTGTGCCAGGG + Intergenic
1060521625 9:124297322-124297344 ATGTGCCAGGCTCTGTGCTAAGG + Intronic
1060587271 9:124794466-124794488 ACGTGCCAGGCGCTGTGCTAGGG - Intronic
1060887753 9:127167541-127167563 AAATGCCAGGGACTGTGCTAAGG - Intronic
1060925522 9:127452602-127452624 ATGTGCCAGGTACTGTACTAGGG + Intronic
1060989812 9:127842000-127842022 ATGTGCTAGAGACTGTGCTAGGG - Intronic
1186839091 X:13467267-13467289 ATGTGATTGCTGCTGTGCTAGGG + Intergenic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1188879594 X:35475297-35475319 CAATGCTAGATGCTCTGCTAGGG - Intergenic
1189818264 X:44845636-44845658 ATGTGCCAGGTACTATGCTAAGG - Intergenic
1190225889 X:48544734-48544756 ATGTGCAAGGTACTGTGCCAAGG - Intronic
1190879858 X:54484393-54484415 ATGTGCTAGGCCCTGTGCTTAGG - Intronic
1193095688 X:77546281-77546303 TTATGCCAGGAACTGTGCTAAGG - Intronic
1194745849 X:97627605-97627627 ATTTGCTAGGCACTGTGCTAGGG + Intergenic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1196038843 X:111178545-111178567 ATGTGCCATGTACTGTGCTAAGG - Intronic
1196388094 X:115180822-115180844 ATTTGCTAGGTACTGTTCCAGGG + Intronic
1197342655 X:125291731-125291753 ATATGGTAAGTGCAGTGATAAGG + Intergenic
1198254127 X:134910457-134910479 ATATACAAGGCACTGTGCTAGGG + Intronic
1198414114 X:136402404-136402426 GCATTCTAGGTGCTGTGCTTGGG + Intronic
1198524071 X:137482365-137482387 TTGTGCTAGGTGCTATGCCAGGG - Intergenic
1198524309 X:137485080-137485102 TTGTGCTAGGTGCTATGCCAGGG + Intergenic
1198884749 X:141322257-141322279 ATATGCCACCTGCTGTTCTATGG + Intergenic
1199296443 X:146164271-146164293 CTGTGCCAGGTTCTGTGCTAAGG - Intergenic
1199822300 X:151461487-151461509 ACATGCTAGGCACTGTGCTGAGG - Intergenic