ID: 926081187

View in Genome Browser
Species Human (GRCh38)
Location 2:9987709-9987731
Sequence GGCTGAGCTGGATTCAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926081183_926081187 -6 Left 926081183 2:9987692-9987714 CCCAGTGCAGAGCCAGGGGCTGA 0: 1
1: 1
2: 3
3: 33
4: 382
Right 926081187 2:9987709-9987731 GGCTGAGCTGGATTCAATGCAGG 0: 1
1: 0
2: 4
3: 15
4: 145
926081184_926081187 -7 Left 926081184 2:9987693-9987715 CCAGTGCAGAGCCAGGGGCTGAG 0: 1
1: 1
2: 1
3: 50
4: 475
Right 926081187 2:9987709-9987731 GGCTGAGCTGGATTCAATGCAGG 0: 1
1: 0
2: 4
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926081187 Original CRISPR GGCTGAGCTGGATTCAATGC AGG Intronic
900932247 1:5744528-5744550 GGCTGAGCTGGAAGCAGAGCTGG - Intergenic
901228412 1:7628467-7628489 GGCTGAGCTGGACACAACTCTGG - Intronic
901785688 1:11622974-11622996 GGCTAAGCTGGATTAAATGGTGG - Intergenic
902589011 1:17460269-17460291 GGCAGAGCTGGATTCAACCCAGG + Intergenic
902689946 1:18104846-18104868 GGCTGAGCTGGAGTCCTTGGCGG - Intergenic
902812936 1:18899387-18899409 GGCTGAGCTGGAGTCATGTCTGG + Intronic
904304174 1:29576705-29576727 CCCTGAGTTGGAGTCAATGCTGG - Intergenic
906995452 1:50788930-50788952 GGCTGGGGTGGATTGATTGCTGG - Intronic
913140808 1:115939620-115939642 GGGTGTGCTGGATGCAATACGGG + Intergenic
913487886 1:119350466-119350488 GGCACAGCTGGATTCATTACAGG - Intergenic
916028478 1:160855884-160855906 GGCTGAGCGGGACTCACTGCTGG - Intronic
916142706 1:161713108-161713130 TGAGGAGCTGGATTCAATGTGGG - Exonic
918960031 1:191262712-191262734 GGCTGAGTTGTATTCCATGGTGG - Intergenic
920041272 1:203099195-203099217 GCCTGAGATGGATTAAAGGCTGG - Intronic
921349727 1:214223226-214223248 GGCAGAGCCGGATTCAAACCAGG + Intergenic
921775006 1:219087629-219087651 GGCAGAGCTGGCTTGAATTCTGG + Intergenic
922050338 1:221983356-221983378 GGCTTAGCTGGAGTGAATGTTGG - Intergenic
1063424070 10:5937782-5937804 GCCTTGGCTGGATTCAGTGCTGG - Intronic
1064106139 10:12502430-12502452 GGCAGCGCTGGGTTCAAGGCAGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1068715620 10:60184721-60184743 GGCTAAGATGAATTCAAGGCTGG + Intronic
1069740711 10:70685433-70685455 CGCTGAGCTGGGATCCATGCAGG - Intronic
1070920674 10:80183661-80183683 AGCTGAGCTGGCTTCACTGGTGG + Intronic
1072613568 10:97035028-97035050 GGCAGAGCCAGATTCAAAGCCGG + Intronic
1073532068 10:104241433-104241455 GGCAGAGTTGGATTCAATCATGG + Intronic
1078150672 11:8757120-8757142 GGCAGGGCTGGACTCAAGGCAGG - Intronic
1079655223 11:22978336-22978358 GGCAGAGCTGAATTAAATTCAGG - Intergenic
1081721474 11:45292341-45292363 GGCTGGGCAGGATTCTATGATGG - Intergenic
1081724729 11:45320408-45320430 GACTGATCTGGAGACAATGCTGG + Intergenic
1083610573 11:64002398-64002420 GAGGGAGCTGGAATCAATGCTGG + Intronic
1084732891 11:71084774-71084796 GGCTGAGCTGGATTCACTCCTGG - Intronic
1087840043 11:102910956-102910978 GGCTGAGCAGGAATTGATGCAGG - Intergenic
1088707135 11:112474163-112474185 GGCAGAACTGGATTCAACCCTGG + Intergenic
1088711263 11:112511070-112511092 GGCTGGCCAGGATACAATGCTGG - Intergenic
1090711342 11:129388676-129388698 GGCTGAGCTGGAGTGGATTCTGG + Intronic
1092934248 12:13345829-13345851 GGCAAAGCTAGATTCACTGCAGG - Intergenic
1094473948 12:30827192-30827214 GGCTGAGAGGGATTCCATCCAGG + Intergenic
1096053167 12:48628843-48628865 GGCTAAGCTGAAATCAATCCAGG - Intergenic
1099942850 12:89210586-89210608 GGCAGAGCTGGAGCCAAAGCAGG + Intergenic
1102341586 12:112125915-112125937 GGCGGAGCTGGGCTCAGTGCCGG + Exonic
1107014176 13:35695533-35695555 GGCTCAGCTGGGTTCCAGGCGGG + Intergenic
1107816149 13:44246291-44246313 GTATGAGCTGCATTCAATGGAGG - Intergenic
1108098926 13:46934696-46934718 GGCTGAGCTGGTATCCATGTTGG - Intergenic
1112637705 13:101233896-101233918 GGCTGGGCTGCAACCAATGCAGG - Intronic
1114056019 14:18967491-18967513 GGCTGAGGCTGGTTCAATGCCGG + Exonic
1114106530 14:19434262-19434284 GGCTGAGGCTGGTTCAATGCCGG - Exonic
1118328307 14:64796473-64796495 GGCTGGGCTGGAGTCCAAGCTGG - Intronic
1118922547 14:70162953-70162975 GGCTGAGATGGATTGAATAAAGG - Intronic
1119688562 14:76652799-76652821 GGCAGTGCTGGTTTCAAAGCTGG + Intergenic
1120388169 14:83871830-83871852 GGAAGAGCTGAAATCAATGCTGG - Intergenic
1120457505 14:84751296-84751318 GGCTGAGCACGATTCACTTCTGG - Intergenic
1122135489 14:99630460-99630482 TGCTGAGCTGGAATCTAGGCTGG - Intergenic
1123668410 15:22628720-22628742 GGCAAGGCTGGATTCAGTGCTGG - Intergenic
1124524389 15:30435181-30435203 GGCAAGGCTGGATTCAGTGCTGG - Intergenic
1124534276 15:30531042-30531064 GGCAAGGCTGGATTCAGTGCTGG + Intergenic
1124764372 15:32476569-32476591 GGCAAGGCTGGATTCAGTGCTGG - Intergenic
1124774262 15:32572529-32572551 GGCAAGGCTGGATTCAGTGCTGG + Intergenic
1125525110 15:40369633-40369655 GGCTGTGCTGGTGTCAAAGCTGG - Exonic
1125921872 15:43529816-43529838 GGCTGTGCTGGATGCCCTGCTGG + Exonic
1128794039 15:70451896-70451918 GGCGGGGCTGGATTCAAACCTGG - Intergenic
1130185626 15:81678369-81678391 GGCTGAGATGGCTTAAATGACGG + Intergenic
1140128774 16:72139229-72139251 GGCTGAGCTGGGTTTGATTCTGG - Intronic
1141908505 16:87042917-87042939 GGCTGAGCTGGCTCCAGGGCTGG + Intergenic
1142107966 16:88316356-88316378 AGGTGAGCTGGATGCAAGGCTGG - Intergenic
1144053048 17:11514525-11514547 AGCAGAGATGGATGCAATGCAGG - Intronic
1144814009 17:18020607-18020629 AGGTGAGATGGATACAATGCAGG + Intronic
1145018593 17:19413926-19413948 GGCTGGGCTGGCCTCAAGGCCGG - Intronic
1146059056 17:29594947-29594969 TGCAGAGCTGGATGCCATGCAGG - Intronic
1147040875 17:37717950-37717972 TGCTGGGCTGGTTTCAATTCCGG + Intronic
1147183754 17:38702912-38702934 GGCTGGGCTGGATTCGTGGCGGG - Intergenic
1149639122 17:58191819-58191841 GACAGGGCTGGATTCAATCCAGG + Intergenic
1151970434 17:77454831-77454853 GCCTGAGCTGGGTTCCCTGCTGG + Intronic
1152572508 17:81126986-81127008 GGCTGGGCTGGATCCCCTGCTGG - Intronic
1157247835 18:46070127-46070149 GGCAGAACTGGATTCAAGCCCGG + Intronic
1157713776 18:49868491-49868513 GCCAGAGCTGGATTCAAATCAGG - Intronic
1160423018 18:78761622-78761644 GGCTGAGCTGGGGTCCATGCAGG - Intergenic
1160831560 19:1106922-1106944 GGCTGTGCTGGCTGCAGTGCTGG + Intergenic
1162295567 19:9811120-9811142 GGCTGTGCTGGAGGGAATGCCGG - Exonic
925904735 2:8533730-8533752 GGCAGAGCTGGATTTAAACCTGG - Intergenic
926081187 2:9987709-9987731 GGCTGAGCTGGATTCAATGCAGG + Intronic
927091265 2:19714603-19714625 GGATTAGAAGGATTCAATGCGGG - Intergenic
929283913 2:40114437-40114459 GGCTTAGCTGGGCTGAATGCTGG + Intronic
929977819 2:46652489-46652511 GGCAGAGCTGGATGTAATCCAGG - Intergenic
931076154 2:58715339-58715361 TGTTGAGCTGCATTCAATGCTGG - Intergenic
932049700 2:68386414-68386436 GGGTGAGCTGGAGTCAGTTCAGG + Intronic
934114021 2:88766448-88766470 GGCTGAGGTGGATGGAATGAAGG + Intergenic
934835775 2:97589251-97589273 GGCTGAGGTGGATGGAATGAAGG - Intronic
936970186 2:118169532-118169554 GGCAGAGCCGGCTTCAATTCCGG + Intergenic
938286293 2:130120488-130120510 GGTTGAGGTTGATTCCATGCCGG - Exonic
938336933 2:130509208-130509230 AGCTGAGGTTGATTCAATGCCGG - Exonic
938352908 2:130611538-130611560 AGCTGAGGTTGATTCAATGCCGG + Exonic
938429314 2:131218408-131218430 GGTTGAGGTTGATTCCATGCCGG + Exonic
938474158 2:131591700-131591722 GGCTGAGGTTGATTCAATGCCGG + Intergenic
942593879 2:177573903-177573925 ATCTGAGCTGGATTGAAGGCTGG - Intergenic
947436960 2:230081040-230081062 GGCTGAGCTGGATTTGAATCAGG + Intergenic
947653045 2:231803361-231803383 GGCTGAGATGGCTTGAGTGCAGG + Intronic
948060645 2:235041371-235041393 GGCTGAGCTGGATTCGGTGAAGG - Exonic
1169976744 20:11337878-11337900 GGCTGAGCTGGGATCTATCCAGG + Intergenic
1171426118 20:25049785-25049807 GGCAGAGCTGGATTCAACGCAGG + Intronic
1173448671 20:43143041-43143063 GGCTGAGCTGGATTCAAACCGGG + Intronic
1176412820 21:6458099-6458121 GGGTGAGCAGGAATCAATGGGGG - Intergenic
1176914930 21:14614028-14614050 AGCTCAGCTGGATTCAGTTCAGG - Intronic
1179688313 21:43066421-43066443 GGGTGAGCAGGAATCAATGGGGG - Intronic
1180474498 22:15690083-15690105 GGCTGAGGCTGGTTCAATGCCGG + Exonic
1181568407 22:23753160-23753182 GGCCCAGCTGGATGCACTGCTGG - Exonic
1184889850 22:47373008-47373030 TGCTGAACTGTATTCCATGCTGG - Intergenic
1185081324 22:48710883-48710905 GGGTGAGCTGGAGTGACTGCTGG + Intronic
1185142747 22:49112545-49112567 GGCTGAGCTGGAGTCTTTGATGG + Intergenic
949452052 3:4196750-4196772 GGGTGAGATGGATACATTGCAGG - Intronic
950042557 3:9929707-9929729 GGCAGATGTGGATTCAAGGCTGG - Intronic
950522781 3:13506538-13506560 GGCAGAGCTGGATTCAAGCCTGG - Intergenic
953926693 3:46986174-46986196 GGCTGAGCTGGGTTCAGGGCTGG - Intronic
954211323 3:49099139-49099161 GGCTGTGCTGGAGTCACTACGGG - Exonic
954863556 3:53710238-53710260 TGCTGAGCTGGATTCCTAGCAGG + Intronic
955663510 3:61326298-61326320 TGCTCAGCTGGTTTCACTGCAGG - Intergenic
955986665 3:64580836-64580858 GGCTGAACTGGTTTCTATTCAGG + Intronic
956820653 3:72950860-72950882 GGCTGAGCAGGGTTCACTGGAGG + Intronic
960777314 3:121271836-121271858 GGCTGTGCTGGAAGCAAAGCTGG + Intronic
962483215 3:135815837-135815859 GGCAGAATTGAATTCAATGCAGG - Intergenic
966325059 3:178744756-178744778 GGCTGCCCTGGGTTCATTGCAGG - Intronic
970015870 4:11511987-11512009 GGCAGGGCTGGATTCAAACCTGG - Intergenic
973227381 4:47801858-47801880 TGCTGAGCTGGGTTCAGAGCCGG + Intronic
973240200 4:47948676-47948698 GGCAGTGCTGTATACAATGCAGG + Intronic
974119582 4:57622854-57622876 TGCAGAGCTGAATTCAATTCTGG + Intergenic
976082938 4:81376008-81376030 GGCAGCACTGGATTCAATGCAGG + Intergenic
985368761 4:189262227-189262249 GGCTCAGGTGGTTTCAATGGTGG - Intergenic
985604428 5:850768-850790 GGCTGGGCTGGAGTCGGTGCAGG + Exonic
988091976 5:26554799-26554821 GGCTGAGCAGTATTCCATGGTGG - Intergenic
989760678 5:45012622-45012644 TGCAGAGCAGGATTCAATGGAGG - Intergenic
991548321 5:67808261-67808283 GGCAGAGCTGGACTCAAACCAGG + Intergenic
993561633 5:89417737-89417759 GGCTGGGGTGGATGGAATGCAGG - Intergenic
994414089 5:99445717-99445739 GGCAGTGAGGGATTCAATGCAGG - Intergenic
998229406 5:140350475-140350497 GGCTGTGCAGGATTCACTTCTGG - Intergenic
1002910445 6:1487320-1487342 TGATGAGCTGCATTCAGTGCTGG + Intergenic
1004352679 6:14903937-14903959 AGCTGAGCTGAATTCAAGGCAGG + Intergenic
1005153084 6:22775205-22775227 GGCTGACCTGGATTCCTTCCAGG + Intergenic
1006948228 6:37799894-37799916 GGCTGAGCTGGGTACATTGCGGG + Intergenic
1008251081 6:49240570-49240592 GGATGAGCTGGAATCAATATTGG - Intergenic
1008973770 6:57401094-57401116 GGCTGAGCTGGCTGAAATGACGG - Intronic
1009162660 6:60302607-60302629 GGCTGAGCTGGCTGAAATGATGG - Intergenic
1009682885 6:66921912-66921934 GGCTGAGCTGGCACCATTGCAGG - Intergenic
1017753375 6:157509530-157509552 GGCAGAGCTGGATTCACACCTGG + Intronic
1019723874 7:2589971-2589993 CGCAGAGCTGGATGCAAGGCAGG - Exonic
1023024484 7:36038409-36038431 GGCTCAGCTGGGTCCACTGCTGG - Intergenic
1024692934 7:51822509-51822531 GGCAGAGCTGGATTCAAACTAGG - Intergenic
1026458332 7:70592288-70592310 GGCAGAGCTGAATTCAAACCTGG - Intronic
1027226185 7:76244980-76245002 GGCTGGTCTGTATCCAATGCTGG - Intronic
1027233183 7:76283414-76283436 TGCAGAGCTGAATTCCATGCCGG - Intronic
1030213672 7:107021435-107021457 GGCTGACTTGAATTCCATGCTGG + Intergenic
1037210104 8:16375872-16375894 TGCTGACCTGGAATCAAGGCTGG + Intronic
1037273966 8:17157278-17157300 GGCGGAGCTGGATCCCTTGCTGG + Intronic
1041092430 8:54315646-54315668 GGCTGAGCTGGGCTCGGTGCCGG + Intergenic
1041898464 8:62954318-62954340 GGAGGACCTGGATTCACTGCAGG - Intronic
1047155060 8:122307668-122307690 GGCTGAGGTGGGTGGAATGCAGG + Intergenic
1047754150 8:127905853-127905875 GGCTGGCCTGGATTGAATCCTGG + Intergenic
1050348547 9:4717529-4717551 GGCAGGGCTGGAATGAATGCTGG - Intronic
1050366776 9:4880115-4880137 GGCAGAGCTGGCTGCAAGGCAGG - Intronic
1050433736 9:5587750-5587772 GGCAGAGCTGGATTCAACTCAGG - Intergenic
1051281313 9:15444049-15444071 GGCTGAACTGGTTTAGATGCAGG - Intronic
1052069961 9:24069670-24069692 GGCAGAGCTGGGTTCAACCCGGG + Intergenic
1060394032 9:123303216-123303238 GGCTGAGCTGGAGTCACAGCTGG + Intergenic
1061296775 9:129681159-129681181 GGGAGAGCTGGTTTCAGTGCTGG + Intronic
1198516477 X:137413438-137413460 GGCTGAGCTGGATGCAAATGGGG - Intergenic
1200019300 X:153188428-153188450 GGATGTGCAGGGTTCAATGCAGG + Intergenic
1202584744 Y:26410197-26410219 GGCTGAGGTGGATGGAATGAAGG + Intergenic