ID: 926081599

View in Genome Browser
Species Human (GRCh38)
Location 2:9991022-9991044
Sequence GTGTTGTCATTTTTCAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926081599_926081601 6 Left 926081599 2:9991022-9991044 CCAGTCTTGAAAAATGACAACAC 0: 1
1: 0
2: 2
3: 45
4: 390
Right 926081601 2:9991051-9991073 CATGAATCACTGTTAAAATTGGG 0: 1
1: 0
2: 4
3: 25
4: 260
926081599_926081600 5 Left 926081599 2:9991022-9991044 CCAGTCTTGAAAAATGACAACAC 0: 1
1: 0
2: 2
3: 45
4: 390
Right 926081600 2:9991050-9991072 GCATGAATCACTGTTAAAATTGG 0: 1
1: 0
2: 0
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926081599 Original CRISPR GTGTTGTCATTTTTCAAGAC TGG (reversed) Intronic
900249829 1:1662605-1662627 GTGTTCTCATCTTTCCAGGCAGG + Exonic
900260869 1:1728512-1728534 GTGTTCTCATCTTTCCAGGCAGG + Intronic
901201143 1:7468077-7468099 GTGTTGTCATGTGTCAGGAAGGG + Intronic
902006237 1:13234553-13234575 TTGTTTTCCTTTTTCGAGACAGG - Intergenic
902281909 1:15381007-15381029 CTGTTGTCATTTTTCACCCCCGG + Intronic
902850944 1:19156010-19156032 TTGTTATCATTTTTAGAGACAGG + Intronic
903612219 1:24623683-24623705 TTTTTTTCTTTTTTCAAGACAGG + Intergenic
903731428 1:25498579-25498601 CTGTTGTCATTTTTAAAAAGGGG + Exonic
904501620 1:30915975-30915997 TTGTTGTTATTTTTAGAGACAGG + Intergenic
904644859 1:31958060-31958082 GTGGTGTCATTCATCAAGATTGG - Intergenic
905021582 1:34818569-34818591 GTTTTTTTCTTTTTCAAGACAGG - Intronic
906329456 1:44872642-44872664 TTTTTGTTTTTTTTCAAGACAGG - Intronic
906751009 1:48259869-48259891 GTTTTGTGTTTTTTCAAGATGGG + Intergenic
907632665 1:56098833-56098855 CTGTTATCATTTTTCACCACAGG - Intergenic
909737861 1:78987764-78987786 CTCTTATCATTTTCCAAGACAGG + Intronic
910843277 1:91581989-91582011 TCATTGTCATTTCTCAAGACAGG - Intergenic
911330332 1:96519284-96519306 GTTTTTTCATTTTTGGAGACAGG - Intergenic
912433250 1:109640883-109640905 TTGTTTTTGTTTTTCAAGACCGG + Intergenic
913053625 1:115138280-115138302 GTGATGTCATTCGTCAAGCCAGG - Intergenic
913531161 1:119735291-119735313 GTGTTGTCATTCAGCAAGCCTGG - Exonic
913722083 1:121606694-121606716 GTTTTGTAATTTTGAAAGACAGG + Intergenic
913741868 1:121854274-121854296 GTTTTGTAATTTTGAAAGACAGG + Intergenic
913968241 1:143394383-143394405 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
914062620 1:144219975-144219997 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
914116530 1:144746379-144746401 ATGTTGTCATTGTTCAAGCCAGG - Intergenic
914688104 1:150000467-150000489 TTGTTTTCTTTTTTTAAGACAGG - Intronic
914693957 1:150058525-150058547 TTATTTTTATTTTTCAAGACAGG - Intergenic
916516727 1:165525350-165525372 GATTTGTCACTTTTCTAGACAGG - Intergenic
916893300 1:169135166-169135188 TTGTTTTTGTTTTTCAAGACAGG - Intronic
917184151 1:172333827-172333849 GTGTTGTCATTATGCAAAGCTGG - Intronic
917854709 1:179091037-179091059 GTGTTCTCATTTATAAAGTCAGG - Intronic
917992697 1:180398801-180398823 ATGTTGTCATTTATAAAGAATGG + Intronic
918164199 1:181928920-181928942 TTATTATTATTTTTCAAGACAGG + Intergenic
919164945 1:193880633-193880655 GTTTTCTCAAGTTTCAAGACTGG - Intergenic
919526573 1:198660106-198660128 ATGTTTTCATTTTTTAACACAGG - Intronic
919663217 1:200268355-200268377 GGTTTGTAATTTTTAAAGACAGG - Intergenic
919874452 1:201853237-201853259 TTGTTGTTATTTTTCCAGACAGG + Intronic
920690291 1:208141524-208141546 GTCTTGTCATTTTTCTTAACAGG - Intronic
921013665 1:211167800-211167822 GTGTTGACATTTTTAAAGAATGG + Intergenic
921666064 1:217872716-217872738 ATTTTGTCATTTTTGAAGCCTGG + Intergenic
922450845 1:225736020-225736042 CTACTGTCAGTTTTCAAGACAGG - Intergenic
923560424 1:235036048-235036070 GTTTTCTCTTTTTTCAAGATAGG + Intergenic
923702856 1:236316438-236316460 TTTTTTTAATTTTTCAAGACAGG - Intergenic
924532608 1:244905959-244905981 GTTTTTTGTTTTTTCAAGACAGG - Intergenic
1063247913 10:4242312-4242334 ATTTTGTAATTTTTCAATACAGG - Intergenic
1063519946 10:6732239-6732261 ATGTTTTCATTTTTCAACAAAGG - Intergenic
1064135221 10:12744893-12744915 GTTTTGTTATTTTTAGAGACAGG - Intronic
1064527106 10:16268421-16268443 ATGTTGACATTTTAAAAGACTGG - Intergenic
1064856200 10:19770355-19770377 GTATTGTTATGTTTCAAGATAGG - Intronic
1065380343 10:25083819-25083841 GTGTAGCCATTCTTCAACACTGG - Intergenic
1065735958 10:28752678-28752700 GTGTTTTGTTTTTTAAAGACAGG + Intergenic
1067673093 10:48343950-48343972 GGGTTGGTATTTTGCAAGACAGG + Intronic
1067727280 10:48779797-48779819 CTGTTGTCATTTTTCATGAGAGG + Intronic
1068381562 10:56260382-56260404 GTTTTGTCCTTTATCAAGAATGG - Intergenic
1068519826 10:58065929-58065951 GTATTGTCATTTATCAAGCTGGG + Intergenic
1068945062 10:62721571-62721593 GTGCTGGCTTCTTTCAAGACAGG + Intergenic
1070709001 10:78663933-78663955 GGGTTGTAATGTTTAAAGACAGG + Intergenic
1070896920 10:79992130-79992152 GTATTTTTATTTTTCAAGGCAGG - Intergenic
1071684468 10:87740341-87740363 GTGTTGACATATTTCATTACAGG - Intronic
1073269874 10:102253253-102253275 GTGATGTTATTTTTCAAGCTGGG - Intronic
1073646071 10:105305474-105305496 GTGGTGTAATTTCTCAAGATGGG - Intergenic
1073706083 10:105985957-105985979 GTGTTCTCTTTTTTCATCACAGG + Intergenic
1075047873 10:119160171-119160193 TTATTGTCATTTTTAGAGACAGG - Intronic
1077783263 11:5355069-5355091 GTGATGTGATTCTTCAAGTCAGG - Intronic
1078475996 11:11630677-11630699 ATGTTGTCATTTATCGAGACTGG - Intergenic
1079183759 11:18217246-18217268 TTATTGTCATTTTTTGAGACAGG - Intronic
1080326676 11:31082420-31082442 GTGTTCTCATTTTACAAGTGAGG + Intronic
1080407449 11:31992308-31992330 TTGTTTTGTTTTTTCAAGACAGG + Intronic
1080691200 11:34559722-34559744 TTGTTTTCATTTTTACAGACAGG - Intergenic
1081203624 11:40248693-40248715 CTTTTTTCATTTTTCAAGACAGG - Intronic
1082238355 11:49847469-49847491 GCGTTGTCATTTTTAGAGCCTGG + Intergenic
1082611638 11:55305984-55306006 GTGTTGTCCTTTTTAGAGCCTGG + Intergenic
1082658274 11:55877677-55877699 GTGTTGTCCTTTTTAGAGCCTGG - Intergenic
1083098091 11:60273335-60273357 GTATTGACCTTTTCCAAGACTGG - Intergenic
1083437199 11:62650711-62650733 CTGTTTTTGTTTTTCAAGACAGG + Intronic
1083546616 11:63553642-63553664 TTATTGTTATTTTTTAAGACAGG - Intronic
1085468373 11:76739470-76739492 GTTTTGTCATTTGCCCAGACTGG - Intergenic
1085576005 11:77604115-77604137 GTTTTGTTTTTTTTCGAGACAGG + Intronic
1085611740 11:77956403-77956425 CTGTATTTATTTTTCAAGACAGG - Intronic
1085687060 11:78633129-78633151 GTGATGGCATTTTTCCAGAGAGG + Intergenic
1086079791 11:82891161-82891183 GAGTTGTCATTTACCAAGAAGGG - Intronic
1086690429 11:89784300-89784322 GTGTTGTCCTTTTTAGAGCCTGG + Intergenic
1086698227 11:89868680-89868702 GTGTTGTCCTTTTTAGAGCCTGG - Intergenic
1086707937 11:89975808-89975830 GTGTTGTCCTTTTTAGAGCCTGG + Intergenic
1086715370 11:90055343-90055365 GTGTTGTCCTTTTTAGAGCCTGG - Intergenic
1087237437 11:95735821-95735843 TTGTTTTCACTTCTCAAGACTGG - Intergenic
1087250751 11:95896474-95896496 GCGTAGTCATTAATCAAGACAGG - Intronic
1088871524 11:113894196-113894218 GTTTTGTCATTTGGCCAGACTGG - Intergenic
1089154679 11:116392199-116392221 TTGTTCTTATTTTTCAAGAATGG - Intergenic
1090175569 11:124646027-124646049 CTGTTGTCATGTTTTAAGATGGG + Intronic
1091230262 11:133983770-133983792 GTGTTTTCACTTTACAGGACTGG + Intergenic
1095150003 12:38782849-38782871 GTTTTTTCATTTTTTTAGACAGG + Intronic
1097407568 12:59209934-59209956 GTGTTTTAATTTTTTGAGACAGG + Intergenic
1098153403 12:67572005-67572027 TTGTTTTTGTTTTTCAAGACGGG + Intergenic
1098159503 12:67635892-67635914 TTGTTGTTGTTTTTCAAGATGGG - Intergenic
1098604929 12:72378960-72378982 GTGATGTAATATTTCAAAACAGG - Intronic
1100147305 12:91693840-91693862 TTTTTTTCTTTTTTCAAGACAGG + Intergenic
1100460180 12:94791683-94791705 GTGTTCTCATTGTTCAACAAGGG - Intergenic
1101134475 12:101727128-101727150 CTGTTTTCATTTTTCATGAAAGG - Intronic
1101134764 12:101731364-101731386 TTGTTGGGATTATTCAAGACAGG - Intronic
1102193659 12:111008554-111008576 GTGTTGTCTTCATTCTAGACAGG - Intergenic
1102428739 12:112864950-112864972 GTGGTGACATTTCCCAAGACTGG + Intronic
1102816679 12:115871545-115871567 GTGTTGTCATTGTTCCAGGTTGG + Intergenic
1102890876 12:116557767-116557789 GTGTTGTTATTGTTTGAGACAGG + Intergenic
1107617339 13:42183281-42183303 GTGTTTTTTTTTTTTAAGACGGG - Intronic
1107738142 13:43419546-43419568 GTTTTGTCTTTTTTTAAGACAGG - Intronic
1108081120 13:46737269-46737291 TTGTTATGATTTTTTAAGACAGG + Intronic
1108730052 13:53225567-53225589 CTGTTTTGTTTTTTCAAGACAGG - Intergenic
1108829809 13:54463678-54463700 GTGTTTTCATTTTTAAAAACTGG - Intergenic
1110212244 13:72987386-72987408 GTGTCTTCATTTTTAAAGCCTGG + Intronic
1110634892 13:77755315-77755337 TTTTTTTCTTTTTTCAAGACAGG - Intronic
1111642905 13:90993581-90993603 GAGTGGTCCTTTTTCAAGACAGG - Intergenic
1112559138 13:100496387-100496409 ATCTTGACATTTTTGAAGACAGG + Intronic
1113326582 13:109288139-109288161 GAGTTGTCATTTTTCCATGCTGG - Intergenic
1113439152 13:110314520-110314542 GTGGAGTCATTTGTGAAGACGGG + Intronic
1113560578 13:111276687-111276709 ATGTTGTGATTCTTCAAGAGGGG + Intronic
1115525483 14:34276003-34276025 GTGCTGTAATTTTTCAAGGTAGG + Intronic
1115544107 14:34449387-34449409 TTTTTGTTTTTTTTCAAGACAGG - Intronic
1117226456 14:53665694-53665716 GTGTTGTCCTTTCTGAAGCCTGG - Intergenic
1117975465 14:61292469-61292491 GTTTTGTCTTTTTTTGAGACAGG - Intronic
1119053574 14:71394948-71394970 GTGTTGTCATTTTTAATAATGGG + Intronic
1119683251 14:76608813-76608835 GTTTTGTTTTTTTTCCAGACGGG - Intergenic
1119794980 14:77388038-77388060 GTGTATTTATTTATCAAGACAGG - Intronic
1119885743 14:78139911-78139933 TTGTTGTTTTTTTTCAATACTGG - Intergenic
1120027140 14:79599330-79599352 GTGTTGTGATTCTTCTAGAGTGG + Intronic
1120969724 14:90197368-90197390 TTGTTGTTATTTTTAGAGACAGG + Intergenic
1122158384 14:99764941-99764963 TTGTTGTCGTTTTTAGAGACAGG + Intronic
1123978103 15:25571780-25571802 GTGTTTTCTTTTTTCCATACAGG + Intergenic
1124498327 15:30202327-30202349 GAGTTCTCATCTTGCAAGACTGG + Intergenic
1124745256 15:32336347-32336369 GAGTTCTCATCTTGCAAGACTGG - Intergenic
1125515580 15:40318488-40318510 GTTTTGCCATTTTGCCAGACTGG - Intergenic
1125703020 15:41705361-41705383 GTCTTTTTTTTTTTCAAGACAGG + Intronic
1126368986 15:47926055-47926077 GTTTGGTCATGATTCAAGACAGG + Intergenic
1127926107 15:63544617-63544639 GTGTTTTCATTTTTGGAGAATGG + Intronic
1127960956 15:63890621-63890643 GTTTTGTTTTTTTTAAAGACAGG + Intergenic
1128561274 15:68669437-68669459 GTGTGGTCAGTTTTCCAGCCTGG + Intronic
1130092757 15:80834996-80835018 GTGTTGTTATTTTTCAAAATAGG + Intronic
1131023138 15:89116743-89116765 GTGATGTCATTATCCATGACAGG + Intronic
1131479907 15:92771916-92771938 TTGTTTTGTTTTTTCAAGACAGG + Intronic
1131693205 15:94848066-94848088 GTGCTGTTATTTTTGAAGACAGG + Intergenic
1131754812 15:95548348-95548370 GAGTTGCCATTTTTTAAGATGGG - Intergenic
1132014887 15:98306808-98306830 GTTTTCTGTTTTTTCAAGACAGG + Intergenic
1133652085 16:7821950-7821972 GTTTATTTATTTTTCAAGACAGG - Intergenic
1134119541 16:11574019-11574041 TTGTTGTTGTTTTTAAAGACAGG + Intronic
1134179854 16:12038759-12038781 GTGACTGCATTTTTCAAGACAGG + Intronic
1134218792 16:12337345-12337367 TTGTTGTTGTTGTTCAAGACAGG + Intronic
1134390716 16:13817373-13817395 GTGTTGTCATCTTCCAAAGCAGG - Intergenic
1135306600 16:21372527-21372549 GTGACTGCATTTTTCAAGACAGG + Intergenic
1135582831 16:23642486-23642508 GTGTTTTTATTTTTTGAGACAGG + Intronic
1135608002 16:23839468-23839490 GTCTTGTGATGTTGCAAGACTGG + Intronic
1136303342 16:29351669-29351691 GTGACTGCATTTTTCAAGACAGG + Intergenic
1136625078 16:31457421-31457443 GTGTTCTGATTCTTCCAGACTGG + Intergenic
1137641564 16:50035399-50035421 GTCTTTTCATTTTTGCAGACAGG + Exonic
1137939825 16:52673285-52673307 GTTTTTTGATTTTTCGAGACAGG + Intergenic
1138173970 16:54879178-54879200 GTGTTGCCTTTTTTCAATATTGG - Intergenic
1139627006 16:68198146-68198168 CTTTTGTAATTTTTCCAGACAGG - Intronic
1139649031 16:68352623-68352645 GTGTTGTCATTTTACAATTGTGG + Intronic
1139892053 16:70259486-70259508 GTCTTTTCATTTTTAGAGACAGG + Intronic
1139939337 16:70593521-70593543 TTGTTGTTATTTTTTGAGACAGG + Intronic
1139945067 16:70635166-70635188 GGATTGTCATTTTGGAAGACTGG - Intronic
1140031277 16:71341161-71341183 TTTTTGTTTTTTTTCAAGACAGG - Intergenic
1140174544 16:72643560-72643582 GAATTGTCATTTTTGAAAACAGG - Intergenic
1140829009 16:78734052-78734074 GTGTTTTTTTTTTTCCAGACAGG - Intronic
1140957488 16:79878750-79878772 GTGTTGTTTTTTTTAAAGAGAGG - Intergenic
1141504774 16:84468968-84468990 GTGTTTTCATTTTCCTAGATTGG - Intergenic
1142258685 16:89031774-89031796 ATGTTGTCATCTTTAAAGATGGG + Intergenic
1143069086 17:4275095-4275117 GTGTTGTTTTTTTTTAAGACGGG - Intronic
1144453820 17:15402964-15402986 GTGGTGACATTTACCAAGACAGG + Intergenic
1145831506 17:27920151-27920173 TTTTTTTCACTTTTCAAGACGGG - Intergenic
1146134808 17:30309988-30310010 AAGTTATTATTTTTCAAGACAGG + Intergenic
1147270151 17:39263506-39263528 TTTTTTTCATTTTTTAAGACAGG - Intronic
1147716368 17:42511506-42511528 TTTTTTTCTTTTTTCAAGACAGG - Intronic
1149732277 17:58958123-58958145 TTGTTGTCATTGTTTGAGACAGG - Intronic
1150582839 17:66491027-66491049 GTGTTCTCAGTTTTAAAGCCAGG + Intronic
1151976397 17:77485844-77485866 GTGTTGTGTTTTTTTGAGACAGG + Intronic
1152092664 17:78255737-78255759 GTTTTTTAATTTTTTAAGACAGG + Intergenic
1152512078 17:80797136-80797158 TTGTTGTTGTTTTTCCAGACAGG + Intronic
1155638430 18:27983112-27983134 ATATTGTCATTTTTAAAGCCTGG + Intronic
1157674013 18:49554840-49554862 GTGTTGTGAATCTTCAAGAAAGG - Intergenic
1157760539 18:50260654-50260676 CGGTTGTCATTTTTTGAGACAGG - Intronic
1158306143 18:56107922-56107944 GTGTTGCCCTTTTCCAAGAAAGG + Intergenic
1161094285 19:2380276-2380298 TTGTTGTTTTTTTTTAAGACAGG - Intergenic
1161675312 19:5644085-5644107 GTTTTGCTTTTTTTCAAGACAGG + Intronic
1162755151 19:12853548-12853570 TTAATTTCATTTTTCAAGACAGG - Intronic
1162857248 19:13478325-13478347 TTGCTGTCATTTTTACAGACAGG + Intronic
1163119271 19:15206971-15206993 TTATTATTATTTTTCAAGACAGG + Intergenic
1164173036 19:22743201-22743223 GTGTTGTTTGTTCTCAAGACTGG + Intergenic
1165216184 19:34274506-34274528 GTGATGTCATTTGCCAAGACTGG + Intronic
1165555729 19:36630240-36630262 GTGCTGTCATTTCTCAACAAAGG + Intergenic
1202702028 1_KI270712v1_random:171847-171869 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
925123105 2:1434781-1434803 GTGTTCTAAATTTTCAAGATGGG - Intronic
926081599 2:9991022-9991044 GTGTTGTCATTTTTCAAGACTGG - Intronic
928981826 2:37143877-37143899 TTGTTGTCGTTTTTTGAGACAGG - Intronic
929108289 2:38385238-38385260 TTGTTTTTTTTTTTCAAGACAGG - Intergenic
930185063 2:48405168-48405190 GTGTTGGCCATTTTCAGGACTGG + Intergenic
930345481 2:50175210-50175232 GTGTTGTCTTATTTCAGGAGGGG - Intronic
930880034 2:56259993-56260015 GTGTTGTCATATTTGAATAGGGG + Intronic
931806046 2:65805601-65805623 TTTTTGTCTTTTTTCAATACTGG - Intergenic
932074625 2:68651359-68651381 GTTTTGTCTTTTTAAAAGACAGG - Intronic
932385156 2:71325477-71325499 TTTTTGTCCTTTTTCAGGACAGG + Intronic
933463642 2:82622001-82622023 GTGTTCTCATTTTATAAGAAGGG + Intergenic
934172940 2:89555297-89555319 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
934283254 2:91629654-91629676 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
934588008 2:95522030-95522052 GTGTTGTCCTTTTTAGAGCCTGG + Intergenic
936679623 2:114755297-114755319 CTGTTGTTATTTTTAGAGACAGG + Intronic
936717226 2:115201700-115201722 GTGGAGTCATTTTTCAAGAAAGG - Intronic
937024465 2:118686553-118686575 GGGTTCTCATTTTTCAATACAGG - Intergenic
937140418 2:119595450-119595472 GTTTTGTGATTTTTGAAGAAGGG + Intronic
937589816 2:123599365-123599387 CTGTTGCCTTTTTTCAAGAGAGG - Intergenic
938166207 2:129029199-129029221 GTGTTGTCATTTTGCAGGAAAGG + Intergenic
940311770 2:152286681-152286703 TTGTTTTTATTTTTCAAGACAGG + Intergenic
940547853 2:155112835-155112857 GTATTTTCATTTCTTAAGACAGG + Intergenic
940766297 2:157793165-157793187 GTGTTCTCTTTTATAAAGACAGG - Intronic
941391772 2:164923789-164923811 TTTTTTTTATTTTTCAAGACAGG - Intronic
941415458 2:165215575-165215597 GTGTTATCATGTTTTAAGCCTGG + Intergenic
942901322 2:181122736-181122758 GTGTGGTCATTTTTCATGCAAGG - Intergenic
944859997 2:203806679-203806701 TTTTTAGCATTTTTCAAGACAGG + Intergenic
944936626 2:204576253-204576275 GTGCTGCTATTTTTGAAGACAGG + Intronic
945368274 2:208983662-208983684 GTTTTGTGATTTTTCAGAACAGG - Intergenic
946296924 2:218791905-218791927 CTATTGTCATTTTTCAATGCAGG - Intronic
946423590 2:219579400-219579422 GTTTTGTTTTGTTTCAAGACAGG + Intergenic
947302733 2:228706322-228706344 GGGATGTCATTTTCCAAGAAGGG + Intergenic
947485945 2:230548844-230548866 GTCTTGTCATTTTTCTCGATTGG + Intergenic
948510944 2:238464829-238464851 GTGATGTCATTTATCAACACTGG - Intergenic
1169836877 20:9890249-9890271 GTGTTTTCATTTTTCCAGAAAGG - Intergenic
1170175389 20:13463221-13463243 GTTTAATGATTTTTCAAGACGGG + Intronic
1170623316 20:18011770-18011792 GTGATGTCATTTTTTTATACAGG - Intronic
1170647261 20:18208621-18208643 CTGTTTTCTTTTTTTAAGACAGG - Intergenic
1173185774 20:40839091-40839113 GTTTTTTGTTTTTTCAAGACAGG + Intergenic
1174039303 20:47687711-47687733 GTGTTTTTTTTTTTCGAGACAGG + Intronic
1174722568 20:52829098-52829120 CTGTTTTCATTTTTTAAAACTGG + Intergenic
1174791636 20:53483749-53483771 GTGTTGTGAATTTCCAAGACAGG + Intronic
1175083405 20:56439674-56439696 GTTTTATTATTTTTTAAGACAGG - Intronic
1179451135 21:41469149-41469171 GTGGTGCCATTTTTCAAGCCAGG - Intronic
1180684493 22:17654725-17654747 GTCTTCTCTTTTTTTAAGACAGG + Intronic
1181384367 22:22533115-22533137 GTGTTTTGTTTTTTTAAGACAGG + Intergenic
1181761406 22:25061292-25061314 ATTTTGTCATATTTCAAGCCTGG + Intronic
1182318156 22:29461503-29461525 ATTTTTTTATTTTTCAAGACAGG + Intergenic
1182857814 22:33533738-33533760 GTGTTGACATTTTTAAAAATGGG - Intronic
1183838897 22:40481100-40481122 TTGTTGTTATTTTTTGAGACAGG - Intronic
1183900196 22:40999693-40999715 TTGTTTTTGTTTTTCAAGACAGG + Intergenic
1183917157 22:41130521-41130543 GTTTTGTTTTTTTTAAAGACAGG - Intronic
1184288165 22:43483661-43483683 GTGTTGTCATTTTAGATGGCAGG + Intronic
950048507 3:9967178-9967200 TTGATTTCTTTTTTCAAGACAGG + Intronic
950445557 3:13035474-13035496 GTGTGGTGATTATTCAAGAGAGG - Intronic
950973767 3:17217450-17217472 GTGTAGTCACTTTTGAAAACTGG - Intronic
952133810 3:30394839-30394861 GGGATGTCATTTTTTAAGATAGG - Intergenic
953952794 3:47205038-47205060 TTGTTGTTATTTTTTGAGACAGG + Intergenic
953992123 3:47492107-47492129 TTGTTGTTGTTGTTCAAGACAGG + Intergenic
954093428 3:48302772-48302794 GGGTTGTCATTTTTGGAGTCAGG - Intergenic
954904011 3:54044254-54044276 TTGTTGTCATTTTACTAGAGAGG + Intergenic
954969980 3:54643439-54643461 GTGATGGCTCTTTTCAAGACTGG - Intronic
955029620 3:55203726-55203748 GTTGAGTCATTTTGCAAGACGGG - Intergenic
955049676 3:55397868-55397890 GTGGTGTCATTTACCAAGATAGG + Intergenic
955426388 3:58795617-58795639 ATGTTTTCCTTTTTGAAGACAGG - Intronic
956676708 3:71740725-71740747 GTTTTGTTGTTTTTCGAGACAGG - Intronic
959195288 3:103172667-103172689 GTGTTTTCATTTTTAATGTCTGG + Intergenic
959968708 3:112384417-112384439 GTTTTGTCATTTGGCAAGACTGG - Intergenic
960224144 3:115149134-115149156 GTGGTGTCAATTTTGAAGTCTGG + Intergenic
960699167 3:120424294-120424316 TTGTTGTTATTTTTAGAGACAGG - Intronic
961131935 3:124476872-124476894 ATGCTGTCCTTTTTCAAGATGGG + Intronic
961916265 3:130378273-130378295 GTGCTGTCTTTTTTCAAGATAGG - Intronic
962703292 3:138019739-138019761 GTGTGGTTTTTTTTCAACACAGG - Intronic
963587714 3:147214220-147214242 CTGGTGTCATTTTTCAAGATAGG - Intergenic
964975092 3:162608895-162608917 GTGTTGTGATTTTTCAACGTCGG + Intergenic
966602514 3:181789539-181789561 TTGTTGTTGTTTTTCTAGACAGG + Intergenic
966699788 3:182835499-182835521 GTGATGTTATTTGTCAAGATGGG + Intronic
968539703 4:1159169-1159191 GTATTGTTATTTTTTGAGACAGG - Intergenic
969231616 4:5835848-5835870 TTGTAATCATTTTTAAAGACTGG - Intronic
969727212 4:8927567-8927589 TTGTTGTTGTTTTTTAAGACAGG - Intergenic
969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
969912381 4:10457935-10457957 GTGTCTTCATTTCTGAAGACGGG + Intergenic
971595372 4:28520912-28520934 TTATTTTCATTTTACAAGACAGG - Intergenic
971864855 4:32156355-32156377 GTGTTCTCATTGTTCATTACTGG + Intergenic
972138008 4:35917078-35917100 GAGTTTTCATTTTGTAAGACAGG - Intergenic
973319918 4:48799590-48799612 ATGTTGTAATTTTTTAAGAAAGG - Intergenic
974150952 4:58008582-58008604 GTGGTGTTATTTTTGAGGACTGG + Intergenic
976023509 4:80660674-80660696 GTGGTGCCATTTGCCAAGACAGG + Intronic
976039971 4:80871554-80871576 GTGATGCCATTTGCCAAGACAGG - Intronic
976397581 4:84572741-84572763 GTGTTGTCATTCCTGGAGACTGG - Intergenic
976417355 4:84793138-84793160 GTTGTGTCATTTATCAACACAGG + Intronic
977326927 4:95585554-95585576 GTGTTGTCACTTTTTAAGACTGG + Intergenic
977779668 4:100966049-100966071 ATGTTGTTATTGTTCATGACTGG - Intergenic
978586121 4:110277570-110277592 GTGTTTTCTTTTTTTAAGACAGG - Intergenic
979325220 4:119371311-119371333 ATGTTGTCATTTTGAAAAACAGG - Intergenic
979956017 4:126955206-126955228 CTGTTGTAATTTTACAAGCCAGG + Intergenic
979978957 4:127231141-127231163 GTATTGTCATTTATCAAAATAGG - Intergenic
980164624 4:129210189-129210211 GTTTTTTCATTTTTCAAAACGGG + Intergenic
980314295 4:131176535-131176557 ATTTTGTCATTTTTTAAGATTGG - Intergenic
981732873 4:147918477-147918499 GTGTTATCATTTTTCGATATGGG - Intronic
982613773 4:157613688-157613710 TTGTATTCATTTATCAAGACAGG + Intergenic
982822558 4:159961176-159961198 TTATTGTAATTTTTCAAGAGAGG - Intergenic
983243124 4:165256329-165256351 ATGTTGTCATTTTGAAAAACGGG - Intronic
984137094 4:175954446-175954468 GTGTTTTCATTTTTCAGGTGAGG - Intronic
984284829 4:177716016-177716038 GTATTGTCATTTTTAAAGATAGG + Intergenic
985714465 5:1447509-1447531 GTGTTGTTTTGTTTCGAGACAGG - Intergenic
985766540 5:1782628-1782650 GTGTTTTCATTTTCCTAAACGGG + Intergenic
989841106 5:46071623-46071645 GTCATGTCCTTTTTCAAGATAGG - Intergenic
990396308 5:55383773-55383795 GTTTTGTCATTTTTAGAGACAGG + Intronic
991411422 5:66349174-66349196 GTTGTGTCATTCTTCAAGTCAGG - Intergenic
991472258 5:66981736-66981758 GAGATTTCATTTTTCAAGAGAGG + Intronic
992056974 5:73000009-73000031 GTGAATTAATTTTTCAAGACAGG + Intronic
992151138 5:73904473-73904495 TTGTTCTCATTTTTAAAGTCTGG - Intronic
993355677 5:86904259-86904281 GTATGGTCAGTTTTCAAAACTGG + Intergenic
993627894 5:90247850-90247872 GTGTTGGCATTTTTTAAAAAAGG + Intergenic
994772513 5:104001526-104001548 TTGTCTCCATTTTTCAAGACCGG + Intergenic
995092041 5:108189409-108189431 TTGTTGTTATTTTTCATGAGAGG + Intronic
995288820 5:110425549-110425571 GTCTAGTCAATTTTTAAGACTGG + Intronic
995513019 5:112926741-112926763 ATTTTTTTATTTTTCAAGACAGG + Intergenic
995754906 5:115492618-115492640 GTGTGGTTATTTTTGGAGACGGG - Intergenic
996747350 5:126856832-126856854 TTGTTTTCTTTTTTTAAGACAGG - Intergenic
996854840 5:127993931-127993953 GGGGTGTCATTTTTTAAAACTGG + Intergenic
997385931 5:133472806-133472828 GTGTATTCATCTTTCAAGGCTGG - Intronic
998928296 5:147152457-147152479 TTGCTTTCTTTTTTCAAGACAGG + Intergenic
999033803 5:148324165-148324187 ATGTTTTCATTTTTCAAGCAAGG - Intronic
999342683 5:150786291-150786313 TTGTTGTTGTTTTTCGAGACAGG + Intronic
1000920193 5:167129017-167129039 GTGTTGGTATTTTTTAAGTCAGG + Intergenic
1001105485 5:168850391-168850413 GAGTTGTCAGTTTTATAGACAGG - Intronic
1001821221 5:174711962-174711984 GTTTTTTTTTTTTTCAAGACAGG + Intergenic
1001868382 5:175126174-175126196 TTGTTCTCTTTTTTCAAGACTGG - Intergenic
1003048506 6:2759120-2759142 TTGTTGTTATTTTTAGAGACAGG + Intergenic
1003206683 6:4019010-4019032 CTGTTGTAATTTTCAAAGACTGG - Intergenic
1003524818 6:6888894-6888916 CTCTTTTCATTTTGCAAGACTGG - Intergenic
1004685801 6:17942293-17942315 GTGTTTTGTTTCTTCAAGACAGG - Intronic
1005067750 6:21834974-21834996 GTGTTATCATTTATCAAGTTGGG + Intergenic
1005715014 6:28538864-28538886 TTGTTTTGTTTTTTCAAGACAGG + Intergenic
1005950860 6:30630313-30630335 TTGTTTTCATTTTTGGAGACAGG - Intronic
1006027352 6:31155785-31155807 TTGTTGTCGTTTTTAGAGACAGG + Intronic
1006116477 6:31778512-31778534 GTTTTGTTTTTTTTCCAGACAGG + Intronic
1007512493 6:42384808-42384830 GGGTTTTTTTTTTTCAAGACAGG + Intronic
1007648902 6:43404686-43404708 TTGTTGTTATTTTTCAAAAGTGG + Intergenic
1008572967 6:52832691-52832713 GTGTTTTCATTCTTCAAAATTGG + Intronic
1010385535 6:75275519-75275541 GAGTTGTCATTTTTCAAGATGGG - Intronic
1010568338 6:77446253-77446275 TCTGTGTCATTTTTCAAGACTGG - Intergenic
1011412216 6:87077570-87077592 GTTTACTTATTTTTCAAGACAGG - Intergenic
1012761388 6:103307308-103307330 TTGTTGACATTTCTCTAGACTGG - Intergenic
1012854018 6:104479858-104479880 GTCTTGACATTTTTGAAGACTGG + Intergenic
1013885592 6:114961567-114961589 ATGTTGTCATTTTGCAAATCTGG + Intergenic
1014240470 6:119012509-119012531 ATGTTGTCCTTATACAAGACAGG + Intronic
1014287919 6:119523033-119523055 GTGCTGTCACTTTTCAATTCTGG - Intergenic
1015060042 6:128952159-128952181 TTGTTTTCTTTTTTCAAGACAGG - Intronic
1015340647 6:132096219-132096241 GTTTTGTCTTGTTTAAAGACAGG - Intergenic
1016115913 6:140285727-140285749 GTGTTGTCTTCTTACAAGAAAGG - Intergenic
1016332481 6:142968135-142968157 GTTTTGTTTTTTTTCGAGACAGG - Intergenic
1016734163 6:147458081-147458103 GTGTTGTAATTTATCATGAGAGG - Intergenic
1016982466 6:149864993-149865015 TTGTTTTTATTTTTAAAGACAGG - Intergenic
1020045605 7:5037922-5037944 GTGTTGTCAATTCTCGAGGCTGG + Intronic
1020291004 7:6722115-6722137 GTGTTGTCAATTTTCGAGGCTGG + Intergenic
1022175545 7:27868784-27868806 TGGTTGTCATTTTTCAAGTGGGG - Intronic
1023356465 7:39371919-39371941 GTTTTCTTCTTTTTCAAGACAGG + Intronic
1025008144 7:55371242-55371264 GTTTTGTTTTTTTTCGAGACAGG + Intronic
1025138712 7:56444119-56444141 CTGGTGTCAATTTACAAGACTGG + Intergenic
1027127837 7:75569601-75569623 GTTTTGTTTTGTTTCAAGACAGG - Intronic
1027413418 7:77947114-77947136 TTGTTGTTGTTTTTAAAGACAGG - Intronic
1028096963 7:86772885-86772907 GTGTTGAAATTTTTCAAGAAAGG - Intronic
1028341998 7:89733470-89733492 GTGATGTTATTTTGCAGGACTGG - Intergenic
1028909909 7:96196195-96196217 CTGTGGTCATTTTTCACTACAGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1029912499 7:104169070-104169092 TTGTTGTTTTTTTTAAAGACAGG - Intronic
1030053600 7:105561564-105561586 TTGTTGTCATTTTTTGAGACGGG + Intronic
1030567467 7:111177183-111177205 TTGTTTTTATTTTTGAAGACTGG + Intronic
1031444751 7:121838140-121838162 CTGTTGTCATTTATAAAGTCAGG + Intergenic
1031450908 7:121916765-121916787 GTGCTGTCATTGGTCAAGATAGG + Intronic
1031931306 7:127688510-127688532 ATGTTGTCAGTTGTCAGGACTGG - Intronic
1032099326 7:128960200-128960222 GTGTTGTCCTTTTATATGACTGG - Intronic
1032355716 7:131208591-131208613 TTATTATTATTTTTCAAGACAGG - Intronic
1032617654 7:133492336-133492358 ATGATGTCATTTGTTAAGACAGG + Intronic
1033184102 7:139209834-139209856 GTGGGGACATATTTCAAGACAGG + Intergenic
1033264523 7:139873327-139873349 GTGTTAACATTTTTGAGGACAGG + Intronic
1033575402 7:142678062-142678084 GTGTGGTCAATTTTTCAGACTGG + Intergenic
1033849350 7:145476203-145476225 TTGTTGTTGTTTTTTAAGACTGG + Intergenic
1033947161 7:146734236-146734258 GTATTATTATTTTTCAAGGCTGG + Intronic
1035162723 7:156962844-156962866 GTTTTGGCATTTTTCCAAACAGG + Intronic
1035419643 7:158716987-158717009 GTGTTGTCAGTGTTCCAGACTGG - Intergenic
1037118630 8:15256234-15256256 GTGTTGTTGTTTTTAGAGACAGG - Intergenic
1037188464 8:16093134-16093156 GTGTTCTCATGTTTTATGACAGG - Intergenic
1039249480 8:35646155-35646177 GTGTTGTCATTTTGCTAGGTTGG + Intronic
1039261385 8:35775489-35775511 GAGATGTCATTTTTCAGGGCAGG - Intronic
1039990377 8:42482714-42482736 GTTTTGTTTTTTTTAAAGACAGG - Intronic
1040400746 8:47046738-47046760 GTGTTGTCATTTTGAAGGAGAGG - Intergenic
1041684333 8:60628938-60628960 TTGTTGTCATTTATAGAGACAGG - Intergenic
1042194116 8:66217451-66217473 GAGGTGTCATATTTCCAGACTGG - Intergenic
1042589049 8:70377914-70377936 GAGTTATCATTGTTAAAGACTGG - Intronic
1042955131 8:74241850-74241872 GTGTAGTCATTTTTCAGAATGGG + Intronic
1043397906 8:79856564-79856586 GTATTTTCATTTTTAGAGACAGG - Intergenic
1043508159 8:80923154-80923176 GTGTTTTTGTTTTTCAAGACAGG + Intergenic
1044682040 8:94789901-94789923 GCTCTGTTATTTTTCAAGACTGG - Exonic
1045040635 8:98220602-98220624 GTCTTGTCATGTTGCCAGACTGG + Intronic
1045996093 8:108363899-108363921 GTTTTGTCATTTGCCAAGGCTGG + Intronic
1046472194 8:114690395-114690417 ATGTTGTAATGTTTAAAGACAGG - Intergenic
1046973830 8:120251302-120251324 GTGTTGGCATTTTTCAAATTAGG + Intronic
1047054255 8:121146508-121146530 CTGTTCTAATTTTTCAAGAAAGG - Intergenic
1047057981 8:121189129-121189151 GTGTCATCATTTGACAAGACAGG - Intergenic
1047071449 8:121348515-121348537 GTGTTTTCACTTTTCTAGTCAGG - Intergenic
1047182135 8:122599027-122599049 GATTTGTCATTTGTCAAAACAGG + Intergenic
1047393925 8:124476373-124476395 GTATTGTCATTTTACAAACCAGG + Intronic
1047941804 8:129833466-129833488 TTCTTTTCTTTTTTCAAGACAGG - Intergenic
1048477079 8:134753193-134753215 GTGTTGTTTTTTTTAGAGACAGG - Intergenic
1049298808 8:141858708-141858730 CTGTTGTTTTTTTTTAAGACTGG + Intergenic
1050146655 9:2575254-2575276 GTGTTTTGTTTTTTAAAGACAGG - Intergenic
1050664224 9:7916952-7916974 GGTTTGTAATCTTTCAAGACTGG + Intergenic
1051056747 9:12996257-12996279 CTGTAGACATTTTTCAAAACTGG + Intergenic
1051515713 9:17928534-17928556 ATATTGACATTTTTCAAGATAGG + Intergenic
1051643661 9:19247399-19247421 GCTTTTTCGTTTTTCAAGACAGG + Intronic
1055451117 9:76432346-76432368 GTTTTTTGTTTTTTCAAGACAGG + Intronic
1055505482 9:76944017-76944039 TTGTTGTCATTTTTAGAGACTGG - Intergenic
1056513828 9:87331498-87331520 GTGTTGTCATTTTTTGAATCAGG - Intergenic
1056733841 9:89187683-89187705 GTTTTGTCAGTTTTCACCACTGG + Intergenic
1058142180 9:101368317-101368339 GTTTTGTTATTTTTCAGGAGAGG - Exonic
1059063838 9:111061476-111061498 GTTTTCTCATTTTTCAAAAGTGG + Intergenic
1059164978 9:112068928-112068950 GTGATGTCATTTACCAAGTCTGG + Intronic
1059483128 9:114607647-114607669 GTGTTTTTATTTTTTGAGACAGG - Intergenic
1059598590 9:115750475-115750497 GTTTTCTCATTTTTGAAGAAAGG + Intergenic
1060560772 9:124540793-124540815 GTTTTGTCTTCTTTTAAGACAGG - Intronic
1061097571 9:128468368-128468390 GTATTGTTATTTTTAGAGACAGG + Intronic
1061535306 9:131244413-131244435 GTGTTGTCAATTATTGAGACAGG - Intergenic
1185451398 X:282375-282397 GTTTTGTTTTTTTTAAAGACAGG - Intronic
1185813132 X:3129008-3129030 TTGTTGTTATTGTTTAAGACAGG - Intergenic
1187108315 X:16268466-16268488 CTGGAGTCATGTTTCAAGACTGG + Intergenic
1187386874 X:18857151-18857173 TTGTTGTCATTTTTAAACAAGGG + Intergenic
1187967019 X:24621839-24621861 GTGTTGCCATTTTCCAAGAATGG + Intronic
1187990095 X:24861134-24861156 GTTTTGTCTTTTTTTGAGACAGG + Intronic
1188853445 X:35161407-35161429 TTGTTGTTGTTTTTTAAGACGGG + Intergenic
1190553348 X:51608325-51608347 GTGTGGTCAGTTTTCATCACTGG + Intergenic
1190663891 X:52679742-52679764 GTGGGTTCATTTTCCAAGACAGG + Intronic
1190675531 X:52778680-52778702 GTGGGTTCATTTTCCAAGACAGG - Intronic
1190706252 X:53030552-53030574 TTGTTTTTATTTTTTAAGACAGG - Intergenic
1190761985 X:53444497-53444519 GTTTTGGGATTTTTCGAGACAGG + Intergenic
1190916245 X:54813193-54813215 GTGTTGTCCTTTGGCAAGAGAGG + Intronic
1190928117 X:54926658-54926680 GTGTTGTCCTTTGGCAAGAGAGG + Intronic
1193248105 X:79254522-79254544 GTTTTTTTTTTTTTCAAGACAGG + Intergenic
1194821635 X:98514554-98514576 TTATTGTCATATTTGAAGACAGG - Intergenic
1195331400 X:103805196-103805218 GTGTTTTCTTTTATCAAGAAAGG + Intergenic
1197558301 X:127985427-127985449 GTGTCTTCATTTTTTCAGACAGG + Intergenic
1198038411 X:132824233-132824255 GTGTAGTCATTTTAGAGGACAGG - Intronic
1198054081 X:132976630-132976652 GTTTTGTCATTTTTTAAAATGGG - Intergenic
1199673025 X:150162337-150162359 GTGGTGTCATTTTGTAAGACAGG + Intergenic
1201268472 Y:12231534-12231556 TTGTTGTTATTGTTTAAGACAGG + Intergenic