ID: 926085866

View in Genome Browser
Species Human (GRCh38)
Location 2:10020058-10020080
Sequence CAGCGGCCACCCGTTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926085866_926085871 -5 Left 926085866 2:10020058-10020080 CCCAGGACAACGGGTGGCCGCTG No data
Right 926085871 2:10020076-10020098 CGCTGAGAACCCGGGAGACCTGG No data
926085866_926085873 -3 Left 926085866 2:10020058-10020080 CCCAGGACAACGGGTGGCCGCTG No data
Right 926085873 2:10020078-10020100 CTGAGAACCCGGGAGACCTGGGG No data
926085866_926085872 -4 Left 926085866 2:10020058-10020080 CCCAGGACAACGGGTGGCCGCTG No data
Right 926085872 2:10020077-10020099 GCTGAGAACCCGGGAGACCTGGG No data
926085866_926085876 10 Left 926085866 2:10020058-10020080 CCCAGGACAACGGGTGGCCGCTG No data
Right 926085876 2:10020091-10020113 AGACCTGGGGCAAGCGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926085866 Original CRISPR CAGCGGCCACCCGTTGTCCT GGG (reversed) Intergenic
No off target data available for this crispr