ID: 926087956

View in Genome Browser
Species Human (GRCh38)
Location 2:10032041-10032063
Sequence CACCCGAGGGGGCCTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926087945_926087956 23 Left 926087945 2:10031995-10032017 CCAGCTCCCCCACTCTTGTATTT No data
Right 926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG No data
926087949_926087956 14 Left 926087949 2:10032004-10032026 CCACTCTTGTATTTTAATGAGCA No data
Right 926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG No data
926087946_926087956 17 Left 926087946 2:10032001-10032023 CCCCCACTCTTGTATTTTAATGA No data
Right 926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG No data
926087943_926087956 29 Left 926087943 2:10031989-10032011 CCAAGCCCAGCTCCCCCACTCTT No data
Right 926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG No data
926087948_926087956 15 Left 926087948 2:10032003-10032025 CCCACTCTTGTATTTTAATGAGC No data
Right 926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG No data
926087947_926087956 16 Left 926087947 2:10032002-10032024 CCCCACTCTTGTATTTTAATGAG No data
Right 926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG No data
926087944_926087956 24 Left 926087944 2:10031994-10032016 CCCAGCTCCCCCACTCTTGTATT No data
Right 926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926087956 Original CRISPR CACCCGAGGGGGCCTCACCC AGG Intergenic
No off target data available for this crispr