ID: 926089993

View in Genome Browser
Species Human (GRCh38)
Location 2:10043517-10043539
Sequence CGGGGCGGCCGCGGAGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 1, 1: 3, 2: 7, 3: 104, 4: 833}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926089993_926090014 22 Left 926089993 2:10043517-10043539 CCGCTCCCTCCGCGGCCGCCCCG 0: 1
1: 3
2: 7
3: 104
4: 833
Right 926090014 2:10043562-10043584 GCGCCGGGGCAGAGCCGCGCGGG 0: 1
1: 0
2: 3
3: 34
4: 317
926089993_926090010 8 Left 926089993 2:10043517-10043539 CCGCTCCCTCCGCGGCCGCCCCG 0: 1
1: 3
2: 7
3: 104
4: 833
Right 926090010 2:10043548-10043570 GCGCCGCGAGGGCCGCGCCGGGG 0: 1
1: 0
2: 5
3: 26
4: 266
926089993_926090009 7 Left 926089993 2:10043517-10043539 CCGCTCCCTCCGCGGCCGCCCCG 0: 1
1: 3
2: 7
3: 104
4: 833
Right 926090009 2:10043547-10043569 CGCGCCGCGAGGGCCGCGCCGGG 0: 1
1: 0
2: 0
3: 27
4: 214
926089993_926090016 25 Left 926089993 2:10043517-10043539 CCGCTCCCTCCGCGGCCGCCCCG 0: 1
1: 3
2: 7
3: 104
4: 833
Right 926090016 2:10043565-10043587 CCGGGGCAGAGCCGCGCGGGCGG 0: 1
1: 0
2: 4
3: 32
4: 293
926089993_926090000 -4 Left 926089993 2:10043517-10043539 CCGCTCCCTCCGCGGCCGCCCCG 0: 1
1: 3
2: 7
3: 104
4: 833
Right 926090000 2:10043536-10043558 CCCGCCCCTCCCGCGCCGCGAGG 0: 1
1: 1
2: 5
3: 67
4: 423
926089993_926090013 21 Left 926089993 2:10043517-10043539 CCGCTCCCTCCGCGGCCGCCCCG 0: 1
1: 3
2: 7
3: 104
4: 833
Right 926090013 2:10043561-10043583 CGCGCCGGGGCAGAGCCGCGCGG 0: 1
1: 1
2: 0
3: 27
4: 209
926089993_926090002 -3 Left 926089993 2:10043517-10043539 CCGCTCCCTCCGCGGCCGCCCCG 0: 1
1: 3
2: 7
3: 104
4: 833
Right 926090002 2:10043537-10043559 CCGCCCCTCCCGCGCCGCGAGGG 0: 1
1: 0
2: 2
3: 18
4: 205
926089993_926090017 26 Left 926089993 2:10043517-10043539 CCGCTCCCTCCGCGGCCGCCCCG 0: 1
1: 3
2: 7
3: 104
4: 833
Right 926090017 2:10043566-10043588 CGGGGCAGAGCCGCGCGGGCGGG 0: 1
1: 0
2: 1
3: 42
4: 397
926089993_926090008 6 Left 926089993 2:10043517-10043539 CCGCTCCCTCCGCGGCCGCCCCG 0: 1
1: 3
2: 7
3: 104
4: 833
Right 926090008 2:10043546-10043568 CCGCGCCGCGAGGGCCGCGCCGG 0: 1
1: 0
2: 0
3: 26
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926089993 Original CRISPR CGGGGCGGCCGCGGAGGGAG CGG (reversed) Intronic
900113610 1:1019774-1019796 CCGGGGGGCCGCGGCGGGGGAGG + Intergenic
900113630 1:1019838-1019860 AGGGGCGGCCCGGGAGGGGGCGG - Intergenic
900176724 1:1294434-1294456 CTGGGCGGACGCGGAGGATGAGG - Exonic
900237588 1:1600105-1600127 GCGGGCGGCGGCGGAGGGCGCGG - Intergenic
900255035 1:1693441-1693463 CGGGGCCGCCGCGCGGGGTGAGG + Intronic
900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG + Intergenic
900284090 1:1891009-1891031 GGCGGCGGCGGCGGCGGGAGCGG - Exonic
900349750 1:2228695-2228717 CGGGGCGGCGGCGGGGGCCGGGG + Exonic
900629331 1:3625293-3625315 CGGGGCGGGGGCCGAGGGCGCGG + Intronic
900679969 1:3911364-3911386 CGGGACAGCCTGGGAGGGAGCGG - Intergenic
901045429 1:6393153-6393175 GGGGGCGGCCTCGGCGGGTGGGG + Intronic
901066667 1:6497532-6497554 CCGGGGAGCCGGGGAGGGAGGGG - Intronic
901086112 1:6613457-6613479 CGGCTCGGCCGCGGGGGGAGGGG - Intronic
901242647 1:7704275-7704297 CGGGGCGGCCCCGCGGGAAGGGG + Intronic
901628973 1:10639028-10639050 CGAGGCGGCGGCGGAGGCGGCGG - Exonic
901679365 1:10904247-10904269 TGGGGCTGCGGCAGAGGGAGTGG - Intergenic
902251010 1:15154119-15154141 GGGCGCGGCCGCAGAGGGTGCGG - Intronic
902323651 1:15684508-15684530 CGGGGCGGCGGCGGCGGTGGCGG + Exonic
902584989 1:17433415-17433437 CGGGGCGGCGGGGCAGGGCGGGG + Intronic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903142735 1:21349001-21349023 CGGGGCGGGCAGGGAGTGAGGGG + Intergenic
903233862 1:21937331-21937353 CGGGGCGGGCGGGGAGGAAAGGG - Intergenic
903324743 1:22563452-22563474 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
903750180 1:25616691-25616713 CGGCGCGGCGGCGGCGGGAGGGG + Intergenic
903777062 1:25800146-25800168 CGGGGCGGCCGGGGCGGGGAGGG - Intergenic
903855686 1:26336580-26336602 CGTGCCGGCCGCGGGGGGCGGGG - Intronic
903907412 1:26696514-26696536 CGAGGCGGCGGCGGCGGCAGCGG + Exonic
903996321 1:27307380-27307402 TGGGGCTGCTGGGGAGGGAGGGG - Exonic
904207652 1:28865192-28865214 GGGGACAGCAGCGGAGGGAGAGG - Intergenic
904411863 1:30329474-30329496 CGGGACAGCCTTGGAGGGAGAGG - Intergenic
904642024 1:31938225-31938247 AGCGGCGGCAGCGGAGGCAGCGG - Exonic
904756084 1:32769718-32769740 CAGGGCGGCGTCGGCGGGAGCGG + Exonic
905037965 1:34929725-34929747 CAGGGCAGCCGAGCAGGGAGAGG + Intergenic
905414380 1:37794387-37794409 CGGGGCGGCGGCGGCGGCGGGGG - Exonic
905518320 1:38578419-38578441 GGGGGCGGCGGCGGCGAGAGCGG + Intergenic
905789793 1:40783964-40783986 CGGGGCGGGCGCGGGCGGCGGGG - Intergenic
905912248 1:41662701-41662723 CGGGGCGGGCGCGGAGGGAGGGG - Intronic
906263075 1:44407604-44407626 GGGGCCGGGCGCGGAGCGAGCGG + Intronic
906293093 1:44632401-44632423 CGGGGGTGGGGCGGAGGGAGGGG - Intronic
907069288 1:51519287-51519309 CGGGGAGGAGGCGGAGGGAGCGG + Exonic
908131800 1:61082206-61082228 CGGGGGGGCCGGGGAGCGAGCGG + Intronic
908581918 1:65525547-65525569 AGGGGCGGCTGCGGAGGGCGCGG + Intronic
910288226 1:85577204-85577226 CGGGACCCCTGCGGAGGGAGCGG - Intronic
912376476 1:109213811-109213833 AGGCGGGGCCGCGGAGGGAGGGG - Intergenic
912800181 1:112715314-112715336 CGGGGCCGCGGCCGAGGGCGGGG - Exonic
914242135 1:145859162-145859184 TGGGTCGGCTGTGGAGGGAGGGG - Intronic
914730387 1:150364650-150364672 GGCGGCGGCGGCGGCGGGAGCGG - Intronic
914754014 1:150553066-150553088 CTTGGGGGCCGGGGAGGGAGGGG - Exonic
915322424 1:155063104-155063126 GGTGGCGGCGGCGGAGGGGGAGG - Intergenic
915409385 1:155688706-155688728 CCGTGCGGGCGGGGAGGGAGGGG - Intronic
915559212 1:156676736-156676758 CGCGCCGGCCCCGGAGGTAGAGG - Exonic
915598951 1:156910449-156910471 GGCGGCGGGCGCGGGGGGAGGGG - Intronic
916104952 1:161423464-161423486 CGGGGCGGCCGGCCAGGCAGAGG - Intergenic
916694399 1:167221326-167221348 CGGGGCCGGGGCAGAGGGAGAGG + Intronic
917520362 1:175743237-175743259 GTGGGCGGCCGGGGAGCGAGAGG + Exonic
918628073 1:186680871-186680893 CACGGCGGCGGCGGCGGGAGAGG - Intergenic
919299463 1:195742023-195742045 CGGGGCGGGGGTGGGGGGAGGGG + Intergenic
919463239 1:197902935-197902957 CGGGGCGGCCGCGGCGGGGCGGG - Intronic
920190419 1:204190410-204190432 CGGGGCGGGGGCGGGGGGCGGGG - Exonic
920260523 1:204685217-204685239 CGAGGCGTACGCGGCGGGAGCGG - Intronic
920301420 1:204991372-204991394 CAGGGCGGACAAGGAGGGAGAGG + Intronic
920394208 1:205631944-205631966 GGCGGCGGCCGCGGAGGGCCTGG - Exonic
921944975 1:220880028-220880050 GGGGGCGGCCCCGGAGGGCCTGG + Exonic
922116377 1:222618046-222618068 CGGGGCGGGCGCAGAGGGGCGGG - Intergenic
922250571 1:223845783-223845805 CGAGGCGGCGGCGGCGGCAGCGG + Exonic
922503785 1:226115004-226115026 CGGGGCGGCCGGCCAGGCAGAGG + Intergenic
922664195 1:227454834-227454856 GGGGGTGGCAGTGGAGGGAGGGG + Intergenic
922766241 1:228158091-228158113 CCGGGCGGCGGCGGAGGGCGCGG - Exonic
923506515 1:234609920-234609942 CGGGGAGGCCGGGGGGGCAGGGG + Intergenic
924052293 1:240091774-240091796 GGGGGCGGCGGCGGCGGGCGGGG + Intronic
924289726 1:242524716-242524738 CGGGGCGGCGGCGGCGGCGGGGG + Intergenic
924415172 1:243850305-243850327 GGCGGCGGCGGCGGCGGGAGGGG + Intronic
1062874213 10:931972-931994 CGGGGCGGGCGGGGCGGGCGGGG - Intergenic
1063583861 10:7333695-7333717 CGGGGAGGCCGTGTAGGGAGTGG - Intronic
1064230988 10:13529057-13529079 AGGGGCGCCGGCGGAGGGGGCGG + Intergenic
1064769588 10:18710449-18710471 AGGGGTGGTCGCGGAGGAAGGGG + Intergenic
1065044101 10:21730112-21730134 CGGGGAGGCGGCGGTGGGGGAGG - Intronic
1065069028 10:22003352-22003374 CGCGGCGGCGGCGGCGGGAACGG + Exonic
1065099668 10:22321041-22321063 TGGGGGGGCGGCGGGGGGAGGGG + Intronic
1065099858 10:22321759-22321781 CGGGGCGGCCGCGGGTGGAAGGG + Intronic
1065590382 10:27256809-27256831 CGGGGGGGGCGGGGCGGGAGCGG - Intergenic
1065590387 10:27256820-27256842 CGGGGCGGGAGCGGGGGGGGCGG - Intergenic
1066022573 10:31318833-31318855 CCGGGCAGCCGCGGCGGGTGTGG + Intronic
1066022870 10:31319912-31319934 CGGGGCGGCCGCGGGTTGCGTGG + Intronic
1066180747 10:32958411-32958433 CCGGGCTGACGCGGCGGGAGAGG - Intronic
1066437377 10:35406886-35406908 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
1067346920 10:45443872-45443894 CGGGGCGGGGGAGGAGGCAGCGG - Intronic
1068788372 10:61001516-61001538 GGAGGCGGCCGAGGTGGGAGAGG - Intergenic
1069438545 10:68407327-68407349 CCGGGCGGCCCCAGGGGGAGCGG + Intergenic
1069761802 10:70816233-70816255 CGGGGCGGCTGCGGCCGGGGCGG + Intronic
1069899767 10:71700772-71700794 TGGGGAGGCCGGGGAGAGAGAGG - Intronic
1070328909 10:75404532-75404554 CGGGGAGGCCGCGGCGATAGCGG - Intergenic
1070877387 10:79826381-79826403 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1071086620 10:81874519-81874541 CCGGGCGCCCGCGGCGGGTGCGG - Intergenic
1071618175 10:87094977-87094999 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
1071695296 10:87863518-87863540 CGGCGCGGCGGCGGAGGGGGCGG + Exonic
1072562184 10:96586703-96586725 CGGGGCGGCCGCGCCGGCCGGGG + Intronic
1072731484 10:97849943-97849965 GGGGGCGGCCGGGGGAGGAGGGG - Intergenic
1073057140 10:100710089-100710111 CCGGAGCGCCGCGGAGGGAGGGG - Intergenic
1073099600 10:100999784-100999806 CGGGGGCGCCGCGGAGGCGGAGG + Exonic
1073299312 10:102461338-102461360 CTGGGCGGGGGCGGAGGGAGAGG + Intergenic
1073441434 10:103555126-103555148 CGGGGAGGCGGCGGCCGGAGGGG + Intronic
1074040007 10:109779203-109779225 CGGGGTGGCGGCGGGGGCAGGGG - Intergenic
1074130392 10:110568168-110568190 CGGGGCGGCCGCGGGCGGGAAGG + Intronic
1074792752 10:116907703-116907725 TTGGGAGGCAGCGGAGGGAGGGG + Intronic
1074814505 10:117134311-117134333 CGGGGCGGCGGCGGCGGCTGCGG + Exonic
1074815659 10:117139653-117139675 TGGGGCGGAGGCGGGGGGAGGGG + Intergenic
1074815709 10:117139818-117139840 CGGGGTGGCGGCGGAGGCAGGGG - Intergenic
1074865470 10:117542276-117542298 CCGGGGTGCCCCGGAGGGAGTGG + Intergenic
1076402004 10:130190701-130190723 GGGGGCGGCCGTGCTGGGAGTGG + Intergenic
1076546100 10:131246590-131246612 CGGTGGGGCAGGGGAGGGAGAGG - Intronic
1076554260 10:131311741-131311763 CGGGGCAGGGGCGGAGCGAGCGG - Intergenic
1076554345 10:131311922-131311944 CCGGGCGGCCGCGGAGGACGTGG + Intergenic
1076676389 10:132149627-132149649 TGGGGCGGGGGCGGAGGGGGTGG - Intronic
1076681019 10:132171216-132171238 CGGAGCAGACGCGGTGGGAGAGG - Intronic
1076864498 10:133160289-133160311 CGGGGCGGGCCCGGGGGGCGCGG - Intergenic
1076879146 10:133231397-133231419 CAGCGCGGCCGCCGAGCGAGGGG + Exonic
1076981872 11:208960-208982 GGGGGCGGGCACGGAGGGGGTGG + Intronic
1077093530 11:789983-790005 CGGGGCGGGCGGGGCGGGCGCGG - Intronic
1077100259 11:819404-819426 CCGGGCGGCAGCGGAGGGCGGGG + Intronic
1077299533 11:1840660-1840682 CGGGGTGGCCGGGGAGGGGCTGG - Intronic
1077409169 11:2395519-2395541 CGGTGCGGCCCCGGGGGGCGAGG + Exonic
1077539127 11:3138419-3138441 GGGGTCAGCCGGGGAGGGAGGGG + Intronic
1077889792 11:6410864-6410886 CGGGGAGGCCGAGGAGGAGGAGG - Exonic
1080406871 11:31987500-31987522 CGGGGCGCGGGCGGAGGGACTGG - Intronic
1080657077 11:34266606-34266628 GGGGGTGGCAGGGGAGGGAGAGG - Intronic
1081207566 11:40293210-40293232 GGGGGCGGGGGCGGAGGTAGTGG + Exonic
1081492533 11:43579417-43579439 CGGGGAGGGGCCGGAGGGAGCGG + Intronic
1081699964 11:45146768-45146790 GGCGGCCCCCGCGGAGGGAGCGG - Intronic
1081870659 11:46381360-46381382 GCGGGCGGCGGCGCAGGGAGTGG + Intronic
1081950345 11:47038480-47038502 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
1081969072 11:47186045-47186067 CGGGGCGGGCGCGAGGCGAGCGG + Intronic
1082838346 11:57668075-57668097 CGGGGCGGGCGTGGAGCGTGCGG + Exonic
1083571369 11:63763737-63763759 CGGGGCGGGGGCGGAGGCGGGGG + Exonic
1083679595 11:64345003-64345025 CGGGCCGGGAGCGGAGGCAGTGG + Exonic
1083753729 11:64778163-64778185 GGGGGCGGCGGCGGAGGCGGCGG + Exonic
1083890235 11:65592338-65592360 CGGGGCGGCGGCGGACGCCGGGG - Exonic
1083922130 11:65786816-65786838 CGGGGCGGCCGGGCGGGGCGGGG - Intergenic
1083934886 11:65865019-65865041 AGGGGCGGCTGCGTAGGGTGTGG - Exonic
1084284261 11:68121310-68121332 CGGGGCGGCGGCGGCGGCTGCGG + Intronic
1084516578 11:69641023-69641045 GGGGGCGGGCGCAGGGGGAGGGG - Intergenic
1084745651 11:71167821-71167843 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
1084814478 11:71638276-71638298 TGGGGAGGCCGGGGAGGAAGGGG - Intergenic
1085460329 11:76689506-76689528 TGCGGGGGCCGAGGAGGGAGTGG + Intergenic
1085640197 11:78188593-78188615 CTGGCCGCTCGCGGAGGGAGAGG - Exonic
1086081052 11:82902386-82902408 TGGGGCGGCGGGGGAGGGGGGGG - Intronic
1087297060 11:96389861-96389883 AGGGGCGGAGGCGGAGGCAGAGG - Intronic
1088920632 11:114257854-114257876 CGGCGCGGGCGCTGGGGGAGAGG + Exonic
1088935989 11:114400674-114400696 GGGGGCGGCGGCGGCGGAAGCGG + Exonic
1089457665 11:118634832-118634854 CGGCCCGGCAGCGGCGGGAGGGG - Intronic
1089496078 11:118909350-118909372 GGGGGAGGCGGCGGGGGGAGCGG - Intronic
1089729594 11:120511921-120511943 CGCGGGGGCAGCGCAGGGAGCGG - Intronic
1090990884 11:131815837-131815859 CCGGGTGGCCGCGGTGGGAGCGG + Intronic
1091000924 11:131910524-131910546 CGGTGCCGCCTCGGAGCGAGCGG - Intronic
1091000991 11:131910760-131910782 GGCGGTGGCCGAGGAGGGAGAGG - Intronic
1091108488 11:132943978-132944000 CGGTGCCGCCTCGGAGCGAGCGG + Intronic
1091498366 12:991505-991527 CCGGGCTGCCGAGGAGGGGGAGG - Intronic
1091550288 12:1530983-1531005 CGGGGCGGCGGCGGCGGCGGCGG - Intronic
1091563287 12:1630238-1630260 CGGGGAGGCCGCTGGGGGCGCGG + Intronic
1091740744 12:2959226-2959248 CGGGGCGGGCGGCGGGGGAGGGG - Intergenic
1092784044 12:12011742-12011764 TGGGGCGGCCGGGGCGGGGGAGG + Intergenic
1093039899 12:14365801-14365823 TGGGGCGGAAGCTGAGGGAGGGG - Intronic
1093931127 12:24956085-24956107 CGGGGCGGGGGCGGAGGGGGCGG - Intergenic
1094041027 12:26122282-26122304 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
1094107801 12:26832611-26832633 CCGGGCGGCGGAGGAGGGACAGG + Intronic
1094466106 12:30755003-30755025 CGGGGCGGCCGAGGGCGGAGCGG - Intergenic
1095432022 12:42144671-42144693 CGGGGCGGGCGCGGCGGCGGCGG - Exonic
1095672334 12:44876118-44876140 CGGAGGGGGCCCGGAGGGAGGGG + Intronic
1095687242 12:45050489-45050511 GGGCGCGGCTGGGGAGGGAGGGG + Intronic
1096779715 12:53984897-53984919 CCGGGCGGCAGGGGAGGTAGAGG - Intergenic
1096863835 12:54549605-54549627 CGCGGCGGCGGCGGCGGTAGCGG + Exonic
1097250197 12:57628158-57628180 CGGCGCGGACGCGGCTGGAGAGG - Exonic
1097281050 12:57845813-57845835 GGGGGCGGTCGCGGTGGGGGAGG - Intronic
1098023139 12:66175129-66175151 CGGGGCGGCCGGCCAGGCAGAGG - Intergenic
1098897810 12:76083965-76083987 GGGGGCGGCCGCGCGGGGAGGGG - Intronic
1100611374 12:96194300-96194322 CGGGGTGGCCGCGCAGGAAGCGG + Intergenic
1100869332 12:98894587-98894609 AGCGGGGGCCGCGGAGCGAGGGG + Intronic
1101605874 12:106247567-106247589 CGAGGCGGCGGCGGCGGCAGCGG + Exonic
1101606100 12:106248262-106248284 CGAGGTGGCCGCGAGGGGAGGGG + Intronic
1103348164 12:120265114-120265136 GGGGGCGGCCCTGGAGGGACGGG + Intronic
1103364014 12:120369333-120369355 CCGGGCGCCCGCGGAGGCGGCGG + Intergenic
1103516108 12:121509521-121509543 CTGGGCGGCCGAGGAGGGCCGGG - Intronic
1103722145 12:122980781-122980803 CGGCGAGGCCGCGAAGGGCGCGG + Exonic
1103764598 12:123271463-123271485 CGGGGCGCCCGCGGAGGCCGGGG - Intronic
1103807473 12:123584562-123584584 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1103930062 12:124445315-124445337 CGGGGCAGCCGCAGAGGGGCAGG - Intronic
1103954267 12:124567622-124567644 GGCGGCGGCGGCGGCGGGAGGGG + Intergenic
1104049495 12:125186285-125186307 CGGGGCCGCGGCCGGGGGAGGGG - Intergenic
1104666207 12:130649351-130649373 TTGGGCGGCCACGGAGGGAGGGG - Intronic
1104759172 12:131286939-131286961 AGGGGCGGGAGCGTAGGGAGGGG - Intergenic
1104821439 12:131679557-131679579 AGGGGCGGGAGCGTAGGGAGGGG + Intergenic
1104926505 12:132316716-132316738 CTGGGTGGCTGCAGAGGGAGTGG - Intronic
1104957735 12:132474647-132474669 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104957765 12:132474716-132474738 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957774 12:132474739-132474761 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957804 12:132474809-132474831 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957834 12:132474879-132474901 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957853 12:132474925-132474947 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957872 12:132474968-132474990 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104957882 12:132474991-132475013 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957921 12:132475082-132475104 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957940 12:132475128-132475150 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957960 12:132475173-132475195 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957979 12:132475219-132475241 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104958044 12:132475362-132475384 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104958055 12:132475386-132475408 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104983226 12:132583079-132583101 CGGGGCCCCCGCGGAGCGCGAGG + Exonic
1105058903 12:133130082-133130104 CCGGGAGGCGGCGGTGGGAGAGG - Intronic
1105472072 13:20703738-20703760 CGGGGCGGCGGCGGCGGCGGGGG + Intronic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1105557342 13:21459382-21459404 GGGGACGGACGCGGGGGGAGGGG - Intergenic
1106359645 13:29018763-29018785 GGGGGCGGGGGCGGGGGGAGGGG - Intronic
1106516978 13:30464820-30464842 CGCGGCGGCGGCGGCGGGCGGGG + Intronic
1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG + Intergenic
1107086285 13:36431404-36431426 CGGCCCGGCCGCGTGGGGAGAGG - Intergenic
1107212071 13:37869819-37869841 AGGGGCGGCCCGGGAGGGGGAGG + Exonic
1107438404 13:40402591-40402613 AGGGGCAGCTGCGGAGGGCGTGG - Intergenic
1107770969 13:43787138-43787160 CGGGGCGGCAGCAGAGGAGGAGG + Intergenic
1107851500 13:44576834-44576856 CGCGGCGGCGGCGGTGGCAGCGG + Intronic
1108408424 13:50125822-50125844 CGTGGCGGCGGCGGCGGCAGCGG + Intronic
1108536259 13:51383078-51383100 CGGGGGGGTGGGGGAGGGAGGGG - Intronic
1111199960 13:84922605-84922627 CGGGGGGGCCGGGGCGGGGGCGG - Intergenic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1113371964 13:109732925-109732947 CGGAGCGGCCGGGCAGTGAGGGG - Intergenic
1113784033 13:112993114-112993136 ACGCGCTGCCGCGGAGGGAGAGG + Intronic
1113794795 13:113050756-113050778 GGGGGCGGTGGCGGGGGGAGGGG + Intronic
1114866233 14:26598107-26598129 GGGGGCTGGCGGGGAGGGAGGGG + Intergenic
1114866269 14:26598246-26598268 CGGGGCGGCTGAGGGGTGAGGGG + Intergenic
1115217383 14:31026408-31026430 AGGGGGGGCCTCGGCGGGAGGGG + Intronic
1115235833 14:31207803-31207825 CGGGGTCGCCGCCGGGGGAGTGG - Intronic
1115320812 14:32077334-32077356 GGAGGCGGCGGCGGCGGGAGCGG + Exonic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1115474492 14:33800390-33800412 CAGGGCGGCGGCGGTGGGGGTGG + Exonic
1115651160 14:35403976-35403998 CGCCGGGGCCGCGGGGGGAGGGG - Intronic
1118270533 14:64338686-64338708 CGGGGCGGCCTCGCGGGGGGTGG - Intergenic
1118312643 14:64704834-64704856 CGGGGCGACCGAGGAGGGCCTGG + Intronic
1119602048 14:75982792-75982814 AGCGGCGGTCGGGGAGGGAGAGG - Intronic
1120765455 14:88323595-88323617 CGGGGAAGCCGCGGAGGGGCGGG + Intronic
1120941698 14:89955914-89955936 CGCGGCGGCCGCCGAAGGGGCGG + Intronic
1121422519 14:93825231-93825253 GGGGGCGCCCGCGGGGGGCGAGG + Intergenic
1122130875 14:99604106-99604128 CCGGGCGGCCCCGGCGGGCGCGG - Intergenic
1122140471 14:99660170-99660192 TGGGGCGGCCACGGAGGGAGGGG - Intronic
1122143341 14:99675172-99675194 CGGGGTTGGCGCGGGGGGAGCGG - Exonic
1122558295 14:102592969-102592991 CGAGGCGGCGGCGGAGGCGGCGG - Exonic
1122840913 14:104462128-104462150 CGGGGTGGCCGTGGCGGGAGGGG - Intergenic
1122904456 14:104795455-104795477 CCGGGCGGCCACGGCGGGCGGGG + Intronic
1122937587 14:104967191-104967213 TGGGGAGGCTGCGGAGGGACGGG - Intronic
1122978636 14:105181338-105181360 CGGGGCGGCCGAGGTGGGCGGGG + Intergenic
1122978644 14:105181356-105181378 CGGGGCGGCCGAGGTGGGCGGGG + Intergenic
1122982150 14:105196732-105196754 CGGGGCGCTCGCGCAGGGACAGG + Intergenic
1123025060 14:105420315-105420337 GGGGGCGGCCGCGGGGGTGGCGG + Intronic
1123490514 15:20776082-20776104 TGGGGCGGCGGCGGCGGGACCGG + Intergenic
1123547015 15:21345169-21345191 TGGGGCGGCGGCGGCGGGACCGG + Intergenic
1124420753 15:29519379-29519401 CGGGGTGGCAGAGGAGGAAGAGG - Intronic
1124469321 15:29968966-29968988 CACGGCGGCGGCGGCGGGAGCGG - Intergenic
1124929108 15:34101737-34101759 CGGGGCTGCTGCTGAGGGATCGG - Exonic
1125677645 15:41511410-41511432 CGGGGCGGCAGGTGAGGGCGCGG - Exonic
1126467688 15:48975924-48975946 CGGGGCGGCCGCGGAGCTGGCGG - Intergenic
1127982703 15:64046328-64046350 CGCGGCAGGCGCGGCGGGAGCGG + Intronic
1127982712 15:64046355-64046377 CGCGGCGGGCGCGGCGGGCGCGG + Intronic
1127982715 15:64046364-64046386 CGCGGCGGGCGCGGCGGGCGCGG + Intronic
1127982718 15:64046373-64046395 CGCGGCGGGCGCGGCGGGAACGG + Intronic
1128056474 15:64703237-64703259 CGGGGCGGCGGCGGCGGCGGCGG - Exonic
1128067869 15:64775623-64775645 GGGGGCGGGCGCCGGGGGAGGGG + Intergenic
1128119224 15:65133501-65133523 TGGGGCGGCGGAGGAGGCAGCGG + Exonic
1128124985 15:65185441-65185463 CGGGGAGGGGGCGGAGGGCGTGG + Intergenic
1128199450 15:65792208-65792230 AGTGGCGGCCGCGAGGGGAGGGG - Intronic
1128335271 15:66781534-66781556 AGTGGCGGCCCCGGCGGGAGGGG + Exonic
1129503097 15:76059380-76059402 CGGGGCGCCCGGTGAGGGAGCGG - Intronic
1129644646 15:77419594-77419616 CGGGGAGGCCGGGGCAGGAGGGG - Intronic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1129752782 15:78077571-78077593 GGGGGCGGCCGCGGAGCCCGGGG - Exonic
1129893793 15:79089538-79089560 CAGGGCTGCTGCGGAGGCAGCGG - Intronic
1130564424 15:84981695-84981717 GGCGGCGGCGGCGGCGGGAGCGG + Intronic
1131133070 15:89912562-89912584 CTGGGCGGGCGCGGCGGCAGGGG + Intronic
1131186091 15:90275292-90275314 AGGGGCGGCGGCGGCGGCAGCGG + Exonic
1131694135 15:94856632-94856654 TGGCGCGGCGGCGGAGGCAGCGG + Intergenic
1132040753 15:98523052-98523074 CTGGGGGGCTGAGGAGGGAGGGG - Intergenic
1132044020 15:98548866-98548888 GGGGACGGGCGCGGAGGGGGAGG - Intergenic
1202955347 15_KI270727v1_random:72385-72407 TGGGGCGGCGGCGGCGGGACCGG + Intergenic
1132499896 16:280616-280638 CGGGGCGGCGGCGGGGCGGGCGG + Exonic
1132586043 16:706083-706105 CGCGGCGGGCGGGGAGGGCGCGG + Intronic
1132601613 16:775388-775410 CCGGGTGGCCGGGCAGGGAGGGG + Intronic
1132651043 16:1021575-1021597 TGGGGCTGCCGTGGAGGGTGCGG + Intergenic
1132653158 16:1030680-1030702 CGGGGGGGCGGAGGAGGCAGTGG - Intergenic
1132654796 16:1037304-1037326 TGGAGCGGGCGAGGAGGGAGTGG - Intergenic
1132698438 16:1212209-1212231 CGGGGAGGCCGGGGCGGGAGTGG - Intronic
1132734721 16:1379697-1379719 CGGGGCCAGCGCGGAGGGGGCGG - Intronic
1132851447 16:2026753-2026775 CTGGCCGGGCGCGGAGGTAGGGG + Intronic
1132864683 16:2087502-2087524 CTGGGCGGCTGAGGAGGGTGTGG + Intronic
1132889491 16:2196775-2196797 CGGGGCGGGCGCGGGGAGGGCGG - Intergenic
1132897685 16:2236721-2236743 AGGGGCGGCCGCGGAGGGAAGGG + Exonic
1132902839 16:2267833-2267855 CGGGGCCGCTGCGGACGGAAGGG - Intronic
1133156424 16:3880034-3880056 GCGGGCGGGCGCCGAGGGAGAGG + Exonic
1133156609 16:3880561-3880583 CGGGGCGGGCGCCGAGGGCCGGG + Exonic
1133188394 16:4116167-4116189 AGCTGCGGCCGCGGCGGGAGCGG - Exonic
1133207195 16:4240756-4240778 AGGAGCGGCCACGAAGGGAGAGG + Intronic
1133369701 16:5238627-5238649 TGGGGAGGCCGGGGAGGAAGGGG - Intergenic
1133771486 16:8869115-8869137 GGGGGCGGGCGGGGCGGGAGTGG + Intergenic
1133784353 16:8963359-8963381 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1134066774 16:11233358-11233380 AGACGCGGCCGCGGAGGCAGCGG - Intergenic
1134082788 16:11335985-11336007 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
1134811376 16:17169664-17169686 GGGGGCGGGCGGGGAGGGTGGGG + Intronic
1135158478 16:20073687-20073709 GGTGGCGGCGGCGGAGGCAGCGG + Exonic
1136333197 16:29595119-29595141 GGAGGCGGCGGCGGAGGGCGGGG + Intergenic
1136414670 16:30096011-30096033 GGGGGCGGGCGCCGGGGGAGGGG + Exonic
1136447883 16:30335158-30335180 GGAGGCGGCGGCGGAGGGCGGGG + Intergenic
1136550487 16:30980002-30980024 CGGGGCGGTGGCGGCGGGGGTGG - Exonic
1136570383 16:31093279-31093301 CGGGGCGGGCAGGGAGGGGGCGG + Intronic
1136712688 16:32253233-32253255 GGGCGCGGCCGTGCAGGGAGGGG - Exonic
1136724805 16:32348996-32349018 CGGGGCGCGCGGGGAGGGAGGGG - Intergenic
1136755228 16:32676196-32676218 GGGCGCGGCCGTGCAGGGAGGGG + Exonic
1136812885 16:33194173-33194195 GGGCGCGGCCGTGCAGGGAGGGG - Exonic
1136819361 16:33304253-33304275 GGGCGCGGCCGTGCAGGGAGGGG - Intronic
1136825924 16:33360788-33360810 GGGCGCGGCCGTGCAGGGAGGGG - Exonic
1136830990 16:33459559-33459581 GGGCGCGGCCGTGCAGGGAGGGG - Intergenic
1136843131 16:33555035-33555057 CGGGGCGCGCGGGGAGGGAGGGG - Intergenic
1138273841 16:55716610-55716632 CGGGGCGGGGGCGGGGGGAGGGG + Intergenic
1138360745 16:56425432-56425454 CGCGGCGGCGGCGGCGGCAGCGG - Exonic
1138595127 16:58025732-58025754 CGCGGCGGCCGCGGCGCGCGGGG + Exonic
1140043690 16:71425874-71425896 AGGGGCGACCCCGGAGCGAGGGG - Intergenic
1140209182 16:72957814-72957836 CGGGGCGGCGGCGGCGGCGGTGG - Exonic
1140527831 16:75638371-75638393 CGGGGGGACCGGGGAGGGACAGG - Intronic
1141116692 16:81315334-81315356 CGGGGCGGCCGGGCCGGGCGTGG + Intronic
1141430575 16:83968622-83968644 CCGGGCGGCGGCGGCGGGCGCGG + Exonic
1141538556 16:84700264-84700286 CGCGGCGGGCGCGGAGGCGGCGG - Intronic
1141644644 16:85360627-85360649 CGGGGCGGGTGCAGGGGGAGGGG + Intergenic
1141683379 16:85556644-85556666 CGCCGCGGCGGCGGAGCGAGCGG + Intergenic
1141828121 16:86494993-86495015 CGCCGAGGGCGCGGAGGGAGCGG + Intergenic
1141830106 16:86505690-86505712 GGGGGCGGGCGAGGAGGGCGCGG + Intergenic
1141972359 16:87492479-87492501 CGGGGCGGCCGGGGCGGCCGGGG + Intergenic
1142136332 16:88453512-88453534 CGGGGCGGCCGCGGAGACCGGGG + Exonic
1202991462 16_KI270728v1_random:17143-17165 GGGCGCGGCCGTGCAGGGAGGGG - Intergenic
1203001625 16_KI270728v1_random:168759-168781 CGGGGCGCGCGGGGAGGGAGGGG + Intergenic
1203057370 16_KI270728v1_random:936535-936557 GGGCGCGGCCGTGCAGGGAGGGG + Intergenic
1203133228 16_KI270728v1_random:1705165-1705187 CGGGGCGCGCGGGGAGGGAGGGG + Intergenic
1203153296 16_KI270728v1_random:1855333-1855355 CGGGGCGCGCGGGGAGGGAGGGG - Intergenic
1142764078 17:2056119-2056141 GGCGGCGGCCGCGCGGGGAGCGG - Intronic
1142764330 17:2057108-2057130 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1142836953 17:2594129-2594151 GGAGGCGGCGGCGGAGGCAGGGG - Intronic
1142863387 17:2776731-2776753 GGTGGCGGCTGCGGAGGGCGCGG + Intergenic
1142980559 17:3668751-3668773 CGGCGCAGGCGCGGAGGGCGGGG + Intronic
1143109408 17:4544982-4545004 GGGGGCGGCCGGGGAGGGCTCGG - Intronic
1143282815 17:5767380-5767402 GAGGCCGGCCGCAGAGGGAGTGG + Intergenic
1143411340 17:6711224-6711246 TGGGGCGGCCATGGAGGGTGGGG + Intronic
1143545477 17:7592763-7592785 CAGTGCGGCGGCGGCGGGAGCGG + Exonic
1143628902 17:8126021-8126043 CGGGCCGGGGACGGAGGGAGGGG - Intergenic
1143687551 17:8530524-8530546 CAGGGTGGCCGGGGAGGGCGGGG - Intronic
1143962125 17:10729756-10729778 TCAGGCGGCCGCGGTGGGAGGGG - Intronic
1144109971 17:12021364-12021386 CGGGGCTGCGGCGGAGCGGGAGG + Intronic
1145064625 17:19753727-19753749 CCCGGCCGCCCCGGAGGGAGTGG - Intergenic
1145814171 17:27783578-27783600 CGGAGCTGCCACGGAGGGACTGG - Intronic
1146022634 17:29292888-29292910 GGGGGCGGCCGCGGTGCGGGGGG + Intronic
1146229480 17:31095274-31095296 CCGGGGGGCGGCGGAGGGAAGGG - Exonic
1146256091 17:31392128-31392150 CTGGGCTCCGGCGGAGGGAGGGG - Intronic
1146646879 17:34581766-34581788 CGGGCCGCGCGCGGAGGGAGCGG + Intronic
1146691919 17:34882619-34882641 CGGGGAGGCAGAGGTGGGAGTGG - Intergenic
1147139532 17:38453626-38453648 AGGGGCCGCCCCGGAGGGGGAGG + Intronic
1147158590 17:38558197-38558219 TGGGCCCGCGGCGGAGGGAGGGG - Intronic
1147168702 17:38606046-38606068 CGGGGCGGCGGGGGCGGGGGAGG + Intergenic
1147184352 17:38705503-38705525 AGCGGCGGCGGCGGAGGGAGAGG + Intergenic
1148060094 17:44830223-44830245 GGCGGCGGCAGCGGCGGGAGCGG - Intronic
1148238260 17:45983499-45983521 TGGGGAGGCCTTGGAGGGAGGGG - Exonic
1148551081 17:48551133-48551155 GGCGGCGGCGGCGGAGGCAGTGG - Exonic
1148830202 17:50426186-50426208 CGGGGCGGGCGCGCAGCGGGCGG - Exonic
1148852287 17:50561066-50561088 GGGGGCAGCGGCGGAGGGCGGGG - Intronic
1149625025 17:58074238-58074260 CGGGGCGGCCGGCCAGGCAGAGG + Intergenic
1150108557 17:62479014-62479036 CCGGGCGGCCGCGGGGGGCGCGG - Exonic
1150214093 17:63457018-63457040 CGGGGCGGCCGGCCAGGCAGAGG - Intergenic
1151218373 17:72592867-72592889 CGGGGTGGGCGGGGAGGGGGTGG + Intergenic
1151570503 17:74923269-74923291 GGGGGCGGGGGCGGAGGGGGCGG + Intergenic
1151919144 17:77140862-77140884 CGCGGCCGCGGCCGAGGGAGCGG - Intronic
1152049129 17:77958893-77958915 CGAGCCGGAGGCGGAGGGAGCGG + Intergenic
1152237106 17:79144330-79144352 CAGGACGGCCACGGAGGGTGGGG + Intronic
1152357250 17:79813287-79813309 GGGGGCGGCCGCGGGGCGAGCGG - Intergenic
1152697497 17:81804314-81804336 CGGGGCGGGCGCGGCGGGGCCGG + Intronic
1152699344 17:81811348-81811370 CGGGGCGGCCGCAGAGGACAGGG + Intronic
1152714483 17:81891916-81891938 CGGAGCGTGCGGGGAGGGAGGGG - Intronic
1152716461 17:81902891-81902913 TGAGGCGGCCTCGGAGTGAGGGG + Exonic
1152730688 17:81968134-81968156 AGGGGCGGCGGCGGCGGGGGCGG + Intergenic
1152880555 17:82812312-82812334 CGGGGCGGCGGGCGAGGGGGAGG - Intronic
1153193744 18:2570967-2570989 GGGGGCGGGCGGCGAGGGAGTGG - Intronic
1153805729 18:8706742-8706764 CGGGGCGCCCCCGGAGGGCCTGG + Intronic
1153900605 18:9614495-9614517 CCGGGCGGCCGCGGAGGAGGGGG - Exonic
1154214872 18:12408311-12408333 GGGGGCGGCCGGGGCGGGGGCGG + Intronic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1156275818 18:35581801-35581823 CGGGCCGGCCGCGGCGGTCGCGG - Intronic
1156698826 18:39799349-39799371 GGGGGCGGCGGCGGGGGGCGGGG + Intergenic
1157473773 18:48008570-48008592 CGGGCCGGCGGCGGAGGAGGAGG - Intergenic
1157545085 18:48540973-48540995 CGTCGCGGACGCGGAGGGAGGGG - Intronic
1157706802 18:49813969-49813991 CGCGGCGGCGGCGGCGGGATTGG + Intronic
1157763463 18:50281458-50281480 GGAGGCGGCCGCGGAGGAGGAGG - Exonic
1158454389 18:57593527-57593549 CGGGGCGGCTGCTGGGGGACAGG + Intergenic
1158878758 18:61756020-61756042 CGGGGTGGGCGGGGAGAGAGGGG + Intergenic
1159966185 18:74598084-74598106 AGGGGCGGAGGCGGGGGGAGGGG - Intronic
1160206410 18:76837123-76837145 CGGGGCGGGGGGGGGGGGAGGGG - Intronic
1160499167 18:79394065-79394087 GGAGGCGGCAGCGGAGGAAGGGG + Intergenic
1160500760 18:79400268-79400290 CGGGGCGGGGACGGGGGGAGGGG + Intronic
1160696968 19:489483-489505 CGGGGGGTCCGGGGAGGGAACGG - Intronic
1160710440 19:548842-548864 GGGGGCGGCAGCGGGGGGAGGGG - Intronic
1160905564 19:1450226-1450248 CGGGGTGGCCTCGGAGCGCGCGG - Intronic
1160910346 19:1471077-1471099 CGGCGCAGCCGCGGCGGGCGAGG + Exonic
1160930466 19:1567640-1567662 CGGGGCGGCGGCGGCGGCGGGGG + Exonic
1160967911 19:1754566-1754588 GGCGGCGGCCCCGGCGGGAGCGG + Exonic
1160991765 19:1863123-1863145 CTTGGCGGCGGCGGAGGGCGCGG + Exonic
1160991899 19:1863526-1863548 CGGAGCGGAGGCGGCGGGAGCGG + Exonic
1161089523 19:2353018-2353040 CTGGGCGGCTGCGGGGAGAGTGG - Exonic
1161153389 19:2720917-2720939 GGGAGGGGGCGCGGAGGGAGGGG + Intronic
1161207201 19:3047269-3047291 CGGGGCGGCCGCGGCGGGGAGGG + Intronic
1161251963 19:3285431-3285453 CGGGGCCGCAGCAGAGGGCGGGG - Intronic
1161613713 19:5257944-5257966 CGGTGAGCCCGAGGAGGGAGGGG + Intronic
1161701679 19:5799347-5799369 CGGGGCGGCCGCGGCAGCATCGG - Intergenic
1162033156 19:7925931-7925953 CGGGGCGGGGGCGGTGGGGGAGG - Intronic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162070290 19:8148911-8148933 GGGGGCTGGGGCGGAGGGAGTGG - Intronic
1162752787 19:12838851-12838873 GAGGACGGCCGCGGGGGGAGGGG + Intronic
1162778652 19:12995613-12995635 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
1162780158 19:13002560-13002582 CGGGGCGGGCGGGCAGGGAGGGG + Intronic
1162802309 19:13118332-13118354 CGCGGAGGCCGCGGAGGCGGAGG + Exonic
1162954440 19:14090490-14090512 GCGGGCAGCGGCGGAGGGAGGGG - Exonic
1162979210 19:14227886-14227908 TGGGGCGGACACAGAGGGAGGGG + Intergenic
1163026778 19:14517585-14517607 CGGGGCCGCCTCGGAGGGTAAGG - Intronic
1163320575 19:16572340-16572362 GGCGGCGGCCGCGGTGGGCGCGG - Exonic
1163443787 19:17334738-17334760 CGGTGCAGCCGCGGAGCGCGCGG + Exonic
1163513082 19:17747720-17747742 CGCCGCAGCCGCGGAGGGAGGGG + Exonic
1163547918 19:17950392-17950414 CAGGGAGACCGCGGAGGGATTGG + Intergenic
1163665850 19:18603879-18603901 GGGGGCGGCCGAGGGGGGCGGGG + Intronic
1163666550 19:18606463-18606485 GGGGGCAGCCGCGGGGGGAGGGG - Intronic
1163681283 19:18683932-18683954 CGGGGCGCGCGCGGCGGGGGCGG + Intronic
1163743889 19:19033483-19033505 CGCGGCGGCGGCGGCGGGTGAGG - Intronic
1164120556 19:22261751-22261773 CGGGGCGGGCGGGGCGGGCGGGG + Intergenic
1164648027 19:29873402-29873424 CGGGGAGGGCGCGGAGCGGGCGG - Intergenic
1164693132 19:30225732-30225754 CGGGGGGGCGGCGGCGGGTGGGG + Intergenic
1165093076 19:33396691-33396713 CGGGGAGGCCAGGGAGGGTGGGG + Intronic
1165420594 19:35720206-35720228 CGTGGAGGCCGTGGAGGCAGGGG + Exonic
1165461100 19:35944913-35944935 CGGGGCGGGCGGGGCGGGCGTGG - Exonic
1165772831 19:38388675-38388697 CGGGGCGAGGGGGGAGGGAGGGG - Intronic
1165957170 19:39508190-39508212 CGGGGAGGCAGGGGAGGCAGAGG + Exonic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166117217 19:40663336-40663358 GGGGGCGGCCGCGAGGGGCGGGG + Intergenic
1166375451 19:42324725-42324747 CGGGGCAGGGGCTGAGGGAGGGG - Exonic
1166792408 19:45405834-45405856 CGGGGCGGCCCCAGTGGGAAGGG + Intronic
1166852549 19:45767511-45767533 CGGGGCGTCAGAGAAGGGAGAGG + Intronic
1166853245 19:45770317-45770339 CCTAGCGGCCGGGGAGGGAGGGG - Exonic
1166965928 19:46529302-46529324 CGGGGAGGCCGCAGAAGGCGTGG - Intronic
1167145536 19:47679432-47679454 GGGGGCGGCGGCGGGGGCAGTGG + Exonic
1167269250 19:48498617-48498639 GGGGGCGGCCGAGGAGGAAGGGG - Exonic
1167445291 19:49533890-49533912 CGGGGCCGGCGCGGAGAGGGTGG + Intronic
1167619971 19:50555328-50555350 CGGGGCAGCTGCGGTGGGAGAGG - Intronic
1167649046 19:50719628-50719650 CGCGGCGGCCGCGGCGGAAGGGG - Intergenic
1167952427 19:53037968-53037990 CGGGGCCTCCGCGGAGTGGGGGG + Intergenic
1168064046 19:53909390-53909412 CGGGGCGGGGGCGGGGGGCGCGG + Exonic
1168076349 19:53982601-53982623 GGGGGCGGCGGCGGAGGCGGCGG + Exonic
1168076395 19:53982758-53982780 GGGGGCGGGCGCAGAGGGCGCGG - Exonic
1168100396 19:54138254-54138276 CGGGGAGGCGGCGGCGGGCGGGG - Intronic
1168235951 19:55063190-55063212 CGGGGCGCGGGCGGAGGGGGCGG + Intronic
1168281230 19:55306396-55306418 CGGGACGGCAGCGGAGGTGGTGG + Exonic
1168301587 19:55407830-55407852 CTGAGGGGCCGCGGAGGGCGTGG - Intergenic
1168315263 19:55482227-55482249 GGGGGCGGCGGCGGGAGGAGGGG - Exonic
1168340836 19:55622185-55622207 CGGGGTGGCCCCGGAGAGGGCGG - Exonic
1168710936 19:58499505-58499527 CGAGGCGGTCGCGGAAGTAGAGG + Exonic
1168718989 19:58544648-58544670 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
925020136 2:562591-562613 TGGGGCTGCCGCGTAGGGGGGGG + Intergenic
925377640 2:3399804-3399826 CGGGGCGGTGGCGGGGGGAGCGG - Intronic
925492744 2:4413041-4413063 TGGGGCTGCCGCAGGGGGAGAGG - Intergenic
926035109 2:9630467-9630489 CGGGGCCGGGGCGGAGGGCGAGG + Exonic
926089993 2:10043517-10043539 CGGGGCGGCCGCGGAGGGAGCGG - Intronic
926285311 2:11482979-11483001 CCGGGCGGCAGCGGGCGGAGCGG + Intergenic
927215613 2:20666692-20666714 CCGGGTGGCCGCGCAGAGAGAGG - Exonic
927703441 2:25282531-25282553 CGGGGCCCCAGCAGAGGGAGAGG - Exonic
927714317 2:25342177-25342199 CCGGGGCGCCGCGGCGGGAGCGG + Intronic
927887590 2:26728191-26728213 GCGGGCGGCGGCGGAGGGGGTGG + Exonic
927982120 2:27380693-27380715 AGCGGCGGCGGCGGCGGGAGCGG - Exonic
927997339 2:27495211-27495233 CCGGGCTGCGGCGGAGCGAGCGG - Exonic
928410182 2:31048606-31048628 CGGGGAGGCAGGGGAGGCAGGGG - Intronic
928687186 2:33761471-33761493 CGGGGCGGCTGCGGGCGGAGGGG + Intergenic
928964823 2:36966337-36966359 CGGGGCGGCTGCGGCGGGGGCGG - Exonic
929604258 2:43224862-43224884 CGTGGAGGCCGCGGAGGCCGAGG + Exonic
929604701 2:43226657-43226679 CGGGGCGGGCGCGCCGGGGGAGG + Intergenic
929936411 2:46297325-46297347 CGGGGCGGGCGCGGAGGGCGGGG - Intronic
930156412 2:48111730-48111752 GGCGCCGGCCGGGGAGGGAGGGG - Intergenic
930411094 2:51027601-51027623 CGAGGCGGGCGAGGAGGGCGAGG - Exonic
930821500 2:55651035-55651057 CGGGGCGGCCGGCCAGGCAGAGG - Intronic
932398956 2:71466586-71466608 CGCGGCGGGCGGGGAGGGACAGG - Intronic
932780088 2:74554239-74554261 CGGGGCGGCCCCGGTGGTGGCGG + Exonic
933908278 2:86914897-86914919 CCGGGCGGCGGCGGAGGCGGCGG + Intronic
934067090 2:88350555-88350577 TGGGGCGGCCACCGGGGGAGGGG - Intergenic
934079022 2:88452179-88452201 CGAGGCGGGCGCGGCGGGCGCGG + Exonic
934079115 2:88452455-88452477 CGGGGCGGCGGCGGTGGCGGCGG + Exonic
934261192 2:91478104-91478126 CGGGGCGGCGGCGGCGGCGGCGG - Intergenic
934754609 2:96816508-96816530 CTGGGTGGCCCCGGAGGGGGCGG + Exonic
935746565 2:106194301-106194323 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
936234609 2:110732480-110732502 GGGCGGGGCCGGGGAGGGAGGGG + Intergenic
937044987 2:118846540-118846562 GGCGGCGGCCGCGGCGGCAGTGG - Exonic
937284492 2:120741601-120741623 CGGGGAGGAGGCGGAGGGAACGG - Intronic
938018395 2:127885993-127886015 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
938038140 2:128053520-128053542 TGGGGCGGCGGCGGCGGGGGCGG - Intergenic
938074038 2:128322567-128322589 CTGGGCGGGCGTGGAGGGAGGGG - Intergenic
938100161 2:128493062-128493084 CGGTGCGCCCGCGGAGGGGGCGG - Intergenic
938397906 2:130964165-130964187 TGTGGCGGCCGCGGAGGCAACGG + Intronic
939693234 2:145292150-145292172 GGTGGGGGCGGCGGAGGGAGGGG - Intergenic
940460724 2:153959728-153959750 CAGGGCTGCCTCAGAGGGAGAGG + Intronic
941384920 2:164841337-164841359 CGGGCCGGCCGGGGCTGGAGCGG - Exonic
942151022 2:173076023-173076045 CGCGGAGGGCGGGGAGGGAGGGG + Intronic
942450916 2:176107623-176107645 GGGGGCGGCCCCGGCGGGGGCGG + Exonic
942890495 2:180981012-180981034 CGGGGCGGCGGCGGCGGTGGGGG + Intronic
942994822 2:182248614-182248636 GGAGGCGGCCACGGAAGGAGAGG + Intronic
943060503 2:183037957-183037979 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
944244429 2:197516526-197516548 CGGGGCCGCTGAGGTGGGAGGGG + Intronic
944457641 2:199911660-199911682 GGCGGCGGCCGGGGAGGGACTGG + Exonic
944585165 2:201166404-201166426 CGGGGCAGCTGCGGGCGGAGGGG + Exonic
945188952 2:207166644-207166666 CGGGGAAGCCGCCGAGGGCGCGG + Intronic
945466002 2:210171282-210171304 GGCGGCGGCCGGGGCGGGAGCGG - Exonic
946329553 2:219001704-219001726 CGGGGCGGGAGCGGAGGGCCCGG + Intergenic
946354534 2:219176724-219176746 CCGGGAGGCCGGGGAGGGGGCGG + Intronic
946394087 2:219434750-219434772 CGAGGGAGCCGTGGAGGGAGGGG - Intergenic
947353641 2:229271343-229271365 CCGGGCGGCGGCGGCGGGGGAGG - Intergenic
947418478 2:229921693-229921715 CGGCGGGGCCGCGGAAGGACCGG - Intronic
947549754 2:231037766-231037788 CGGCGCGGCGGCAGAGGGCGCGG + Exonic
947636072 2:231681258-231681280 CGGGGCGCCCGGGAAGGCAGAGG - Intergenic
947860488 2:233354462-233354484 CGGGGCGGGGCCGGCGGGAGGGG - Intergenic
947860565 2:233354707-233354729 CGGGGCTGCCGCGGCGTGAGGGG - Intronic
948202852 2:236142359-236142381 CGGGGCGGGGGCGGGGCGAGGGG - Intergenic
948208230 2:236173890-236173912 CGGGGCCGTCGTGGAGGCAGCGG - Intergenic
948594522 2:239071113-239071135 CTTGGTGGCGGCGGAGGGAGGGG + Intronic
948735870 2:240004557-240004579 AGGGGAGGCCGCGGTGGAAGAGG - Intronic
948953904 2:241272647-241272669 CGTGGAGGCCGCGGAGGGGGAGG - Intronic
949044761 2:241867304-241867326 CGGGGAGGCTGGGCAGGGAGCGG + Intergenic
1168786294 20:543284-543306 GGGGGAGGGTGCGGAGGGAGTGG - Intronic
1168799053 20:632931-632953 CGGGGTGGCTGGGGACGGAGTGG - Intergenic
1168943926 20:1735891-1735913 CAGGGCGGCCGCAGCAGGAGAGG - Intergenic
1169141545 20:3229823-3229845 GGGGGAGGCCCTGGAGGGAGGGG + Intronic
1169204489 20:3732419-3732441 AGAGGGGGCGGCGGAGGGAGGGG - Intergenic
1169214840 20:3786837-3786859 GGGGGTGGGCGCGGAGGGCGGGG - Intronic
1169424205 20:5483796-5483818 CGGGGCGGGCGGGGCGGGGGAGG + Intergenic
1169914689 20:10673608-10673630 CGCGGCGGCCGCAGGGGCAGCGG - Exonic
1170889803 20:20367865-20367887 CGGGGCGGCGGCGCCGGGCGGGG + Intergenic
1170999357 20:21397153-21397175 CGCGGCGGCCGCGGCGGCGGCGG - Exonic
1171439441 20:25148519-25148541 CAGGGCGGCGGCGGAGGCCGGGG - Intergenic
1171473495 20:25390382-25390404 GGGGGCGGCCGCGGATCGGGCGG + Intronic
1172117982 20:32583316-32583338 CCGGGCGGCCGCGGAGGGGGAGG + Intronic
1172133566 20:32672742-32672764 GGGGGAGGCAGGGGAGGGAGTGG - Intergenic
1172295934 20:33811327-33811349 CGGGGCGGAGGCGGAGGCGGAGG + Exonic
1172764942 20:37346266-37346288 CGGGGGGTCCGCGGAGGGGCGGG - Intronic
1172848415 20:37944165-37944187 CGGGGCGGGCGCGGCGGGAGGGG - Exonic
1174172888 20:48628065-48628087 CTGGGAGGCCTCGGAGGGACAGG - Intronic
1174467872 20:50731450-50731472 GGGGGAGGCGGCAGAGGGAGAGG + Intergenic
1175237496 20:57524949-57524971 CTGGGCGTGGGCGGAGGGAGGGG - Intronic
1175831875 20:61969225-61969247 CGGGGCTGCCACTGAGGCAGTGG - Intronic
1175847105 20:62065001-62065023 CGGGGCGGCGGCGGGGGCGGCGG + Exonic
1175847127 20:62065049-62065071 CGCGGCGGGCGCGGGGGGCGCGG + Exonic
1175847482 20:62066136-62066158 CGGGGCGGTGGCGGACGGGGAGG + Intergenic
1175873678 20:62219895-62219917 CGAGGCGGCGGCGGCGGGCGGGG - Exonic
1176005755 20:62861595-62861617 CGAGGCGGCCGTCGAGGGCGCGG - Exonic
1176062644 20:63179010-63179032 CGGGGCGGCCCCCGCGGGACGGG + Intergenic
1176234830 20:64049367-64049389 CGAGGCGGGCGCGGCGGGCGCGG + Exonic
1176239172 20:64067994-64068016 AGGGGAGGCAGAGGAGGGAGGGG - Intronic
1176242084 20:64079889-64079911 CGGGCCGGCGGCGGCGCGAGTGG - Intronic
1176549394 21:8214732-8214754 CGGGGCGGCGGCGGCGGTGGCGG + Intergenic
1176557287 21:8258955-8258977 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1176568322 21:8397766-8397788 CGGGGCGGCGGCGGCGGTGGCGG + Intergenic
1176576229 21:8441990-8442012 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1176870344 21:14078846-14078868 CGGGGTGGGGGCGGGGGGAGCGG + Intergenic
1177389171 21:20444037-20444059 GGGGGAGGTCGCGGAGGGTGGGG + Intergenic
1178673909 21:34614960-34614982 CGGGGCCGCGGCGGAGGCGGCGG - Exonic
1179563968 21:42234926-42234948 CGGAGCGGCGGCGCGGGGAGCGG + Intronic
1179586421 21:42376515-42376537 CGGGGCCGCAGCGGTGGGCGAGG - Intronic
1179605625 21:42513753-42513775 CGCGGCGGCCGGGGAGGGGGAGG + Intronic
1179937090 21:44612835-44612857 CGGGGCGGCAGAGGAAGGACAGG - Exonic
1180005694 21:45019391-45019413 CTGGGGGGCCCTGGAGGGAGCGG + Intergenic
1180037800 21:45258719-45258741 CTGGGCGGCCGCGGGGGGACTGG + Intergenic
1180041507 21:45282692-45282714 CGGGATGGCCGGGGAGGCAGAGG + Intronic
1180069160 21:45427521-45427543 AGGGGTGGCCGCGGAGCAAGAGG - Intronic
1180950601 22:19718927-19718949 CGAGGCCGCTGCGGAGGGAAGGG - Intronic
1181265797 22:21629867-21629889 CGGTGCGGCCACGGAGAGCGCGG - Exonic
1181978758 22:26751520-26751542 CGGGGTGGCTGCTGGGGGAGGGG + Intergenic
1182282252 22:29224444-29224466 CAGGGCGGCTGGGGAGGGTGAGG + Intronic
1182532128 22:30968861-30968883 GCGGGCGGCGGCGGAGGCAGCGG - Intergenic
1183337938 22:37261286-37261308 GGGGGTGGCCGCGGGAGGAGTGG + Intergenic
1183517026 22:38272715-38272737 CGGTGCGGCCGCGGAGGGAGGGG - Intronic
1183524999 22:38317491-38317513 CGGGGCGGCGGCGGCGGGCCGGG - Intronic
1183665143 22:39242561-39242583 GGGGGCGGCCGCGGAAGGGCGGG + Intronic
1184086800 22:42270376-42270398 GGGGGCGGGCGGGGAGGGAGCGG + Intronic
1184230786 22:43157288-43157310 CGGGGCGGGGCAGGAGGGAGGGG + Intronic
1184562055 22:45269137-45269159 CGGTTCGGCCGGGGAGGGGGCGG - Intergenic
1185055293 22:48575942-48575964 GGCGGCGGCGGCGGAGGAAGAGG + Intronic
1185055401 22:48576251-48576273 GGGGGGCGCCGCGGAGGGGGCGG - Intronic
1185278670 22:49960757-49960779 CGAGGCGGCCGGGGCGGGTGAGG + Exonic
1185313581 22:50169733-50169755 CGGGGCTGCAGTGGAGGGTGTGG + Intergenic
1185375570 22:50481445-50481467 GGGGGCTGCGGCGAAGGGAGCGG - Intergenic
1185375697 22:50481819-50481841 CGGGGCTGCAGGGGAGGGGGCGG - Exonic
1203254279 22_KI270733v1_random:131048-131070 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1203262335 22_KI270733v1_random:176127-176149 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
949938599 3:9136396-9136418 CGGGGCGGTCGGGGGGGGGGGGG - Intronic
950433898 3:12967449-12967471 CATGGCGGCCGCAGTGGGAGCGG + Exonic
950729891 3:14947935-14947957 CGGGCCGGCGGCGGAGGGGGCGG + Intronic
950759301 3:15206383-15206405 CGGGAGCGCCGCGGAAGGAGCGG - Exonic
950940328 3:16884928-16884950 CGAGGCGGCGGCGGGAGGAGAGG + Intronic
952883463 3:37999145-37999167 CGGGGCGGGGCCGGAGGGGGCGG + Intronic
953385237 3:42502513-42502535 CGGGGCCGCCGCGCAGGTATGGG - Intronic
953518821 3:43622079-43622101 GGGCGGGGCCGCGGCGGGAGAGG + Intronic
953561189 3:43995155-43995177 CGTAGCGGCCGCGGAGGGTGGGG + Intergenic
953801087 3:46023129-46023151 CGCGGCGGCGGCGCAGGGGGCGG + Intronic
954004232 3:47578916-47578938 CGGGGCCGGCGCGGCGGGCGGGG - Exonic
954632495 3:52055145-52055167 CGGGGCGGGCGGGAGGGGAGGGG - Intronic
954838929 3:53494631-53494653 CGCGGCGGGCGCGGAGCGAGCGG + Intergenic
954839103 3:53495449-53495471 GGGGGCGGCCGTGGAGTGTGTGG + Intronic
955368699 3:58332824-58332846 CGGGGCGGCGGCCGTGGGAAGGG + Intergenic
955996922 3:64687669-64687691 GGTGGGGGCAGCGGAGGGAGGGG - Exonic
956681487 3:71785387-71785409 CTGGGCGACGGCGGAGGGAACGG - Intergenic
956813618 3:72888340-72888362 CGGGGCGGACGCGGGGCGCGCGG - Exonic
959513501 3:107240556-107240578 CGGGGCAGCCGGGGCGGAAGGGG - Intergenic
959539881 3:107525262-107525284 CTGGGGGGCAGCGGAGGCAGAGG + Intronic
960223688 3:115146721-115146743 GGGGGAGGGCGAGGAGGGAGGGG + Intronic
960638935 3:119809491-119809513 CTGGGCGGCCAGGGAGGAAGGGG - Intronic
961013255 3:123449305-123449327 CGGCGCGTCCGCGCAGGGGGCGG + Exonic
961013389 3:123449788-123449810 CGGGGAGGCAGCGGGAGGAGGGG - Intergenic
961408934 3:126704420-126704442 CGGGGCGGGCGTGGAGGCCGCGG + Intronic
961551647 3:127673157-127673179 CTGGGCGGCCGCGGAGAGGCGGG + Intronic
961551767 3:127673579-127673601 TGGGCCGGACGCGGAGGGAAGGG + Intronic
962108447 3:132417407-132417429 CGGGGAGGACGGGGAGGGCGGGG + Intergenic
962272335 3:133987132-133987154 CGGGGCGGGGGCGGGGGGGGGGG - Intronic
962498391 3:135965644-135965666 CGGGCCGGCCGCCGAGGGTGGGG + Intergenic
962753531 3:138451655-138451677 CGCGGAGGCCGAGGTGGGAGAGG - Intronic
964219118 3:154324280-154324302 GGCGGCGGCGGCGGAGGGGGTGG - Exonic
964482778 3:157159571-157159593 AGCGGCGGCGGCGGCGGGAGGGG - Intronic
964786281 3:160399890-160399912 GGGAGCGGCCGAGGGGGGAGGGG - Intronic
965648285 3:170908158-170908180 CGGGGCGGCGGCCGAGGGCTGGG - Intronic
966378770 3:179323114-179323136 TGGGGCGCGCGGGGAGGGAGAGG + Intronic
966868637 3:184276250-184276272 GGGGTCGGCCGCGGAGGGGCAGG + Intronic
966998314 3:185307539-185307561 CGGGGTGGCGGGGGAGGGGGTGG - Intronic
968048177 3:195635500-195635522 GGGGGCGGCCGCGGGGGTCGGGG - Intergenic
968099227 3:195954120-195954142 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968306434 3:197654421-197654443 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968452374 4:681603-681625 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452383 4:681623-681645 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452392 4:681643-681665 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452401 4:681663-681685 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452410 4:681683-681705 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452419 4:681703-681725 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452428 4:681723-681745 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968470882 4:781786-781808 AGGTGCGGCCGCGGGGTGAGCGG + Intergenic
968583699 4:1406338-1406360 CTGGGCAGCGGCGGCGGGAGCGG + Intergenic
968603345 4:1520652-1520674 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603364 4:1520693-1520715 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603403 4:1520775-1520797 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603462 4:1520898-1520920 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603481 4:1520939-1520961 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603519 4:1521021-1521043 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603538 4:1521062-1521084 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603557 4:1521103-1521125 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603576 4:1521144-1521166 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603595 4:1521185-1521207 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968610328 4:1554108-1554130 CCTGGCAGCCGGGGAGGGAGTGG - Intergenic
968674964 4:1872009-1872031 CGGGGCGGCCGCGGTGGGAGGGG + Intronic
968699306 4:2047153-2047175 CGGGGCGTTCGCGGCGGGATAGG + Intergenic
968701147 4:2058919-2058941 CCGGGCGGCCGCGGAGGAGGAGG + Intergenic
968701224 4:2059131-2059153 CGGGGCGGCCGGGCAGCGCGAGG - Intergenic
968775392 4:2536854-2536876 GCGGGCGGCGGCGGAGGGCGGGG - Intronic
968965123 4:3765848-3765870 CGGGGCGGGCGCGCGGGGCGGGG - Intergenic
968965277 4:3766333-3766355 CGACGCGGCTGCGGGGGGAGGGG - Intronic
969016822 4:4108748-4108770 TGGGGAGGCCGGGGAGGAAGGGG + Intergenic
969115007 4:4865967-4865989 CCGGGCTGCGGCGCAGGGAGGGG - Intergenic
969796332 4:9531155-9531177 CGGGGAGGCCAGGGAGGAAGGGG - Intergenic
969912116 4:10456936-10456958 CGGGGCGACCGAGGCGGGGGTGG - Intronic
970004730 4:11399747-11399769 CGTGGCGGCCGCGGAGAACGAGG - Exonic
971351938 4:25862990-25863012 GGGGGCGGCGACGGCGGGAGCGG - Intronic
972396915 4:38664979-38665001 GGGGGCGCGGGCGGAGGGAGGGG - Intronic
972437072 4:39044855-39044877 CCGGGTGGCCCCGGAGGGGGCGG - Intergenic
972503401 4:39698182-39698204 CGCGGCGGCCGGGGTGGTAGTGG + Exonic
972529123 4:39945958-39945980 TTGGGAGGCCGTGGAGGGAGGGG + Intronic
972632881 4:40857194-40857216 ATGGGCGGCCGCGGCGGGCGGGG - Intronic
975329585 4:73099210-73099232 AGGGGCGGGGGCGGTGGGAGCGG - Intronic
975870691 4:78776094-78776116 CGGGGCGGCGGCGGCGCGACGGG + Intergenic
976654004 4:87467810-87467832 AGGGGCGGTTGCGGAGGTAGGGG + Intergenic
978072583 4:104491450-104491472 GGGGGCGGCGGCGGGGGGGGTGG - Exonic
978072625 4:104491557-104491579 CGCGGCGGCCGCGGCGGCGGCGG + Exonic
980130380 4:128811663-128811685 CGGGGCGGGCGCGGCGGGCCGGG - Intronic
981429813 4:144645943-144645965 CGCGACGGCGGCGGACGGAGGGG - Intergenic
981550575 4:145937669-145937691 GGGGGCGGGCGAGGCGGGAGCGG - Intronic
981782834 4:148445378-148445400 GGGGGGCGCCGAGGAGGGAGCGG + Intergenic
982053538 4:151526511-151526533 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
982172844 4:152678520-152678542 CGGGGCGGCGGTGGGGGGAGGGG + Intronic
983238683 4:165207625-165207647 CGGGGCGGCGGCGACGGGACCGG - Intronic
984734816 4:183099207-183099229 CGGGGCGGAGGAGGAGGAAGAGG + Intergenic
984778541 4:183504733-183504755 AGAGGCGGCCGCGGGCGGAGGGG + Intergenic
984999657 4:185471207-185471229 CGGGGAGGGCGGGGAGGGCGGGG + Intronic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985550109 5:528573-528595 CGGGGCGGGCGGGGCGGGCGGGG - Intergenic
985550136 5:528653-528675 CGGGGCGGCGGCCGGGAGAGGGG - Intergenic
985628790 5:1004454-1004476 AGAGGCGTCCGCGGAGTGAGGGG - Intergenic
985652182 5:1112328-1112350 CGGGGAGGGCGGGGAGGGCGGGG - Intergenic
985714242 5:1446537-1446559 CGGGGCGGGCGCAGGGGGTGGGG - Intergenic
985778378 5:1857118-1857140 CAGGCCGGCCGCAGAGGGATCGG - Intergenic
986330521 5:6713658-6713680 CGGGGCGGGCGCGGGGGCCGCGG - Intergenic
986330677 5:6714130-6714152 CACGGCGGCCGCGGCGGGGGCGG + Intergenic
986330847 5:6714709-6714731 CGGGGAGGCCGCGGGGGCGGGGG + Intronic
986449490 5:7850759-7850781 GCGGGCGGCCGCGGAGGGGCGGG - Intronic
987844908 5:23270743-23270765 CCGGGAGGCAGCGGAGGGGGAGG + Intergenic
989102302 5:37834670-37834692 CGCGGCGGCGGCCGAGGGAGCGG + Exonic
989379364 5:40798232-40798254 GGGGGCGGGCGGGGAGGGGGTGG + Exonic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
993496672 5:88616153-88616175 CGGGGCGGCCGGCCAGGCAGAGG - Intergenic
993901109 5:93584803-93584825 CGGGGCGGCCGAGGCAGTAGCGG + Exonic
993901118 5:93584833-93584855 GGCGGCGGCGGCGGAGGCAGCGG + Exonic
996678959 5:126209082-126209104 CGGGGAGGCGGGGGAGGGAGGGG + Intergenic
997513138 5:134466601-134466623 CGGGGCAGCCGGGCAGGGCGGGG - Intergenic
997530987 5:134581174-134581196 CCGGGTGGACTCGGAGGGAGTGG + Exonic
997584095 5:135034450-135034472 CGGCGAGGCCGCGGGGGGCGGGG - Intronic
997899642 5:137753471-137753493 CGGGGCGGCCGAGGCGGCCGGGG - Exonic
998239420 5:140427672-140427694 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
998583294 5:143402997-143403019 GGGGACGCCTGCGGAGGGAGAGG + Intronic
998583505 5:143403832-143403854 CGGGGCCCGCGCGGAGGGCGTGG - Intronic
999768416 5:154756950-154756972 TGTGGCGGCGGGGGAGGGAGTGG + Intronic
1000302952 5:159972312-159972334 CGTGGCGGCCGCGGCGGCCGGGG - Exonic
1001065055 5:168529538-168529560 GGGGGCGGCCGCGGGGGCGGCGG + Exonic
1001070330 5:168579648-168579670 CCGGGCGGAAGCGGAGCGAGGGG - Intergenic
1001375389 5:171251754-171251776 GGGGGCGGGCGCGGGAGGAGGGG - Intronic
1001604164 5:172948156-172948178 CGGAGCGGCCCCCCAGGGAGTGG - Intronic
1002044966 5:176536681-176536703 AGTGGCGGCCGCAGGGGGAGGGG + Intronic
1002054249 5:176589623-176589645 CTGGGGAGCCCCGGAGGGAGGGG + Intronic
1002158902 5:177303528-177303550 CGGGGCGGCCTGGGAGCGCGCGG + Exonic
1002180065 5:177426703-177426725 CGGGGAGGCCGGGGAGGCCGCGG + Intronic
1002195187 5:177497386-177497408 GGGGGCGGGGGCGGAGGCAGGGG + Intronic
1002523990 5:179805869-179805891 CTGGGCGCACGCGGAGGGCGGGG + Intronic
1002524165 5:179806427-179806449 CTGGGCGTCGGCGGCGGGAGCGG - Intronic
1002524455 5:179807329-179807351 CTGGGCGGCAGCGAAGGCAGCGG - Intronic
1002771341 6:292669-292691 GGGGACGGGCGCGGAGGGAGGGG + Intronic
1002897799 6:1389532-1389554 GAGGGCGGCCGGGGAGGGCGAGG + Intergenic
1002897959 6:1390051-1390073 CGGGGCGGCGGCGGCGGCGGCGG - Exonic
1002927001 6:1610526-1610548 CGCGGCGGCCGCGGCGGCCGGGG + Exonic
1002927253 6:1611585-1611607 CGCGGGGGCCGCGGGGGGCGCGG + Exonic
1003290853 6:4776851-4776873 CGGCGCGGCCGGGCCGGGAGGGG - Intronic
1003868727 6:10385133-10385155 CGTGGCGGCCGGGGAGCGCGAGG - Intergenic
1004140639 6:13014158-13014180 CGGGGCGGCGGCGGCGAGCGCGG + Intronic
1004216762 6:13711212-13711234 GGGGGCAGCCGCTGAGGCAGGGG + Exonic
1004395800 6:15245639-15245661 TGGGGCGGCCGTGGGGTGAGCGG + Intergenic
1004864119 6:19837241-19837263 GGGCGGGGGCGCGGAGGGAGAGG - Intergenic
1006472905 6:34238070-34238092 CGGGGAGGGGACGGAGGGAGGGG + Intronic
1006558570 6:34889523-34889545 GGGGGCGGCGGCGGCGGCAGCGG + Exonic
1006860667 6:37170027-37170049 CGGGCCGGCCGAGGGAGGAGAGG - Intergenic
1006860693 6:37170096-37170118 CGGGGAGGGCGCGGCGGGCGGGG - Intergenic
1007462066 6:42026269-42026291 CAGGGGGGCGGCGGGGGGAGAGG - Intronic
1007665358 6:43510154-43510176 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
1007781403 6:44256975-44256997 CGGAGCTGCAGCGGAGGGGGCGG - Intronic
1007790091 6:44303837-44303859 CAGGGTGGCAGCAGAGGGAGAGG + Intronic
1008160398 6:48068899-48068921 CGGGGAGACCGGGGAGGGGGTGG - Intergenic
1008378671 6:50819827-50819849 CGAGGCGGCCGAGGCGGGCGAGG + Intronic
1008378675 6:50819836-50819858 CGAGGCGGGCGAGGTGGGAGAGG + Intronic
1008932432 6:56954848-56954870 GGGGGCGCCTGGGGAGGGAGGGG - Intergenic
1012475915 6:99614307-99614329 GGCGGCGGCAGCGGAGGCAGCGG + Exonic
1013155804 6:107490256-107490278 GGCGGCGGCGGCGGCGGGAGCGG + Exonic
1015625937 6:135181192-135181214 CAGGGCGACCGCGGAGGCGGCGG + Intergenic
1015935739 6:138404522-138404544 CGGGGCGGCCGAGGACGCGGCGG + Exonic
1016010743 6:139135489-139135511 AGCGGCGGGCGCGGCGGGAGCGG + Exonic
1016714152 6:147204297-147204319 AGCGGCGGCCTCGGAGGAAGAGG + Intergenic
1018302592 6:162419066-162419088 AGGGGCGGCAGGGGTGGGAGGGG + Intronic
1018400321 6:163414593-163414615 AGCGGCGGCGGCGGGGGGAGGGG - Intronic
1018612714 6:165660962-165660984 CGTCGCGGTCGCGGATGGAGGGG - Intronic
1018613057 6:165662159-165662181 CGGGGCGGCGGCGGCGGCCGGGG + Intronic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1018911269 6:168101823-168101845 CGGTGCGTCCGCGCAGGGAGCGG - Intergenic
1019295624 7:272533-272555 CGGTGGGGGCGTGGAGGGAGGGG - Intergenic
1019434941 7:1017735-1017757 AGGGGCAGCCGCGGACGGCGGGG + Intronic
1019472707 7:1229850-1229872 CGAGGCGGGCGCGGAGGATGAGG + Intergenic
1019475278 7:1241380-1241402 GGGGGCGGCCGGGGTGGGCGTGG + Intergenic
1019514382 7:1433303-1433325 CGGGGCCCCCGTGGAGGGAAAGG - Intronic
1019547767 7:1586734-1586756 GGGGGCGGATCCGGAGGGAGTGG - Intergenic
1019676260 7:2314358-2314380 CGGGGCGGCAGCTGAGGCGGAGG - Exonic
1019689668 7:2403616-2403638 CGGGGCGGCGGCGGCGGCTGCGG + Exonic
1020137322 7:5594397-5594419 CGGGGCAGACGCGGGAGGAGGGG - Intronic
1021998347 7:26201663-26201685 CCGGGCGGCCACGAAGGGCGGGG - Intronic
1022005393 7:26262056-26262078 CGGGGCGGCTGTGGGCGGAGGGG - Intergenic
1022107977 7:27210393-27210415 CGGGGAGGCCAGGGAGAGAGAGG + Intergenic
1022113734 7:27246073-27246095 CGAGGCGGCGGCGGAGGCGGCGG - Exonic
1022629408 7:32071058-32071080 CACCGCGGGCGCGGAGGGAGGGG + Intronic
1023382664 7:39623842-39623864 CGGGCCGCCCGGGGAGGGACTGG + Intronic
1023638806 7:42237968-42237990 GGCGGCGGCGGCGGAGGGCGGGG - Intergenic
1023881936 7:44325665-44325687 CGGGGCGGGCGCGGCGGCGGCGG - Intronic
1024471700 7:49773565-49773587 GGGGGCAGCAGAGGAGGGAGCGG + Intergenic
1025020572 7:55476482-55476504 CCGGCAGGCCGCAGAGGGAGGGG + Intronic
1025829598 7:65038146-65038168 GCGGGCGGGCGCGGAGGGTGGGG - Intergenic
1025829832 7:65038832-65038854 CGGGGCGGACGCGGAGCGGTCGG + Intergenic
1025916839 7:65873120-65873142 GCGCGCGGGCGCGGAGGGAGGGG - Intergenic
1025917087 7:65873832-65873854 CGGGGCGGACGCGGAGCGGTCGG + Intronic
1026360545 7:69598409-69598431 TGGGCTGGCCGCGGAGGGGGAGG + Intergenic
1026867155 7:73830934-73830956 AGGGGCGGGGGCAGAGGGAGGGG - Exonic
1027025877 7:74851387-74851409 CGGGCCGGCCGCGGAGTCCGAGG + Exonic
1027061882 7:75092723-75092745 CGGGCCGGCCGCGGAGTCCGAGG - Exonic
1027189241 7:75988224-75988246 CAGGGCGGGCCCTGAGGGAGGGG - Intronic
1027237688 7:76307644-76307666 CGGGTTGGCAGGGGAGGGAGAGG + Intergenic
1029105016 7:98167853-98167875 TGGGGGGGCCGAGGAAGGAGCGG + Intronic
1029683402 7:102128369-102128391 CGGTGCTGCGGCCGAGGGAGGGG - Intronic
1029701379 7:102248783-102248805 CGCGGCGGCGGCTGAGGTAGCGG - Exonic
1030176504 7:106660427-106660449 GGGGGCGGCGGCGGTGGGGGTGG + Exonic
1030216011 7:107044642-107044664 AGGCGCGGCCGCGGCTGGAGCGG + Exonic
1031043448 7:116862570-116862592 CGCGGCGGCGGCGGCGGCAGCGG - Exonic
1031919082 7:127588426-127588448 CTGGCCGGCCGCGGGGGGATGGG - Exonic
1032021570 7:128409696-128409718 GCGGGCGGCCGAGGAGGGCGCGG - Intronic
1032159857 7:129502251-129502273 GGGGGCGGGCGCGGGGCGAGGGG - Intergenic
1032159866 7:129502270-129502292 GGGGGCGGGCGCGGGGCGAGGGG - Intergenic
1032263154 7:130352349-130352371 CGCGGGGGCCGGGGATGGAGGGG + Intronic
1032298830 7:130668472-130668494 CCGGGCAGCCGCGAGGGGAGGGG + Intronic
1033085358 7:138336325-138336347 CGGGGTGGCAGAGGAGGAAGAGG - Intergenic
1033300114 7:140177492-140177514 CTGGGCGGCTGCGGAGGGCTGGG - Intergenic
1033654153 7:143362149-143362171 CGGGGCTGGCGCGGAGGCCGAGG + Intronic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1033656894 7:143381011-143381033 CGGGTCGGGCGGGGAGGGGGAGG + Intergenic
1033683773 7:143620900-143620922 CGGGGCGGTCTCGGAGGTAGGGG - Intergenic
1033700839 7:143836738-143836760 CGGGGCGGTCTCGGAGGTAGGGG + Intergenic
1034470512 7:151252033-151252055 CGCGGCGGCCGGGGAGGCGGCGG + Intronic
1034967082 7:155398255-155398277 CGGGGGGGGCGGGGAGGCAGGGG + Intergenic
1035573207 8:687793-687815 CGGGGCAGCCACGGAGGAATCGG + Intronic
1035670914 8:1416558-1416580 AGGGGCGGCCGTGGAGGCAGAGG - Intergenic
1035717196 8:1763640-1763662 CGGGGCGGCGGGCGCGGGAGGGG - Intronic
1036391042 8:8324523-8324545 AGGGGCGGTGGGGGAGGGAGTGG + Intronic
1036708208 8:11060404-11060426 CGGGGCTGCGGAGGAGGCAGGGG - Intronic
1037811489 8:22089442-22089464 GGGCGCGGCCGGGGAGGCAGAGG - Intronic
1037826963 8:22165378-22165400 CGGGGCGGCGGCGAGGGAAGCGG - Exonic
1037828875 8:22176856-22176878 CGGGGCGGCAGGGGAGCGAAGGG - Intronic
1037876555 8:22551634-22551656 CGGGGAGGCGGCGCCGGGAGGGG - Intronic
1038540321 8:28385770-28385792 GGGGGCGCCGGCGGAGGGCGAGG + Intronic
1038808014 8:30812516-30812538 GGCGACGGCGGCGGAGGGAGAGG - Exonic
1039064931 8:33599575-33599597 AGGGGCGACGGGGGAGGGAGGGG - Intronic
1039936722 8:42052021-42052043 CGGAACAGCCGCGGGGGGAGGGG + Intergenic
1040039147 8:42897920-42897942 CGGCGCGGCCGGGGAGGGGGAGG + Intronic
1040052806 8:43033049-43033071 CGGGGCGGCTGGGGGGGGTGGGG + Intronic
1040110966 8:43567070-43567092 CGAGGCTGACGAGGAGGGAGGGG - Intergenic
1040355734 8:46616991-46617013 CGGGGTGGCAGAGGAGTGAGAGG + Intergenic
1041552865 8:59119851-59119873 GGGGACGGCCGCGGAGAGGGCGG - Intergenic
1042039971 8:64580496-64580518 GAGGGTGGGCGCGGAGGGAGTGG - Exonic
1042040036 8:64580733-64580755 CGAGGCGGCGGCGGCGGCAGCGG + Exonic
1042695193 8:71547759-71547781 CGGGGCGGCCGAGCGGGGCGGGG + Intronic
1043015437 8:74934371-74934393 AGGGGTGGGCGCGGAGGGATGGG - Intergenic
1043388147 8:79768004-79768026 AGGGGCGGGCGCGGAGGGCGGGG - Intergenic
1043401769 8:79891628-79891650 GGGGGCGGCCTTCGAGGGAGCGG - Intergenic
1043527450 8:81112083-81112105 CGGAGCAGCCGCGCGGGGAGCGG + Intergenic
1044719820 8:95134215-95134237 CGGGCCGGCCCCGGCGCGAGGGG - Intronic
1044729682 8:95219927-95219949 CAGGTCGGCCACGGAGGGAAGGG + Intergenic
1045098846 8:98825721-98825743 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098858 8:98825741-98825763 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098870 8:98825761-98825783 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098882 8:98825781-98825803 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098894 8:98825801-98825823 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098906 8:98825821-98825843 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098918 8:98825841-98825863 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045222512 8:100213014-100213036 CGCGGAGGCCGCGGAGGCCGCGG - Intronic
1045459335 8:102412533-102412555 AGGGGCGGCCGGGGGAGGAGAGG + Exonic
1045510821 8:102810756-102810778 CGGGGAGGGCGGGGAGGGCGCGG + Intergenic
1046094363 8:109539892-109539914 CCGGGCGGGCGGGGAGGGGGAGG + Intronic
1046819807 8:118622165-118622187 CGGGGCGGGGGGGGAGGGGGGGG + Intergenic
1048214268 8:132480872-132480894 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1048981177 8:139703929-139703951 CGCGGCGGCGGCGGCGGGAGGGG + Intergenic
1049292564 8:141812396-141812418 CGGGGAGGGCGGGGAGGGCGGGG + Intergenic
1049405310 8:142449684-142449706 GGCGGCGGCCGGAGAGGGAGCGG + Exonic
1049452594 8:142670097-142670119 CTGGGTGGCCGCGGAGGGCGTGG + Intronic
1049570570 8:143368595-143368617 CGCGGCGGCCGCTGAGCGTGCGG - Intergenic
1049641736 8:143719052-143719074 CGGGGAGGTCGCCCAGGGAGCGG - Exonic
1049788572 8:144462765-144462787 TGAGGCGGCGGCGCAGGGAGCGG - Intronic
1049789542 8:144466485-144466507 CGCGGCGGCCGCGGAGCCCGGGG + Exonic
1050287459 9:4118114-4118136 GGCGGCGGCAGAGGAGGGAGCGG + Exonic
1050438001 9:5629481-5629503 CCGGGAGGCCGGGGAGGCAGCGG - Intronic
1050537724 9:6645209-6645231 AGGGGAGGCCGCGGAGGGCCGGG + Intronic
1051079690 9:13279657-13279679 CGGGGCTGCCGCGGAGGCGGTGG + Intergenic
1051876757 9:21802168-21802190 CGGGGCGGCCGCCGCGGCGGGGG - Intergenic
1053240027 9:36487694-36487716 GGCGGCGGCGGCGGAGGGGGCGG + Intergenic
1054449916 9:65398218-65398240 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054449926 9:65398236-65398258 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054449936 9:65398254-65398276 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054449946 9:65398272-65398294 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054449956 9:65398290-65398312 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054449966 9:65398308-65398330 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054449976 9:65398326-65398348 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054449986 9:65398344-65398366 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054449996 9:65398362-65398384 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054450006 9:65398380-65398402 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054450016 9:65398398-65398420 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054450026 9:65398416-65398438 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1054450036 9:65398434-65398456 AGGGGAGGCGGGGGAGGGAGGGG + Intergenic
1055514231 9:77020415-77020437 CGCCGCGGCCGCGGCGGCAGCGG - Exonic
1055757368 9:79571233-79571255 TGGCGCGGCTGCGGAGCGAGGGG + Intergenic
1055945714 9:81689501-81689523 GGCGGCGGCGGCGGTGGGAGCGG - Intergenic
1056475428 9:86947337-86947359 CGGGGTTGCCGCGGGCGGAGGGG - Intergenic
1056488839 9:87085345-87085367 CGGGGCGCCAGGGGAGGGGGAGG - Intergenic
1057083596 9:92189751-92189773 CGAGCCGGCCTCGGAGGCAGAGG - Intergenic
1057186152 9:93058622-93058644 CTGGGCGGGCGTGGAGGGCGGGG + Intergenic
1057437673 9:95057379-95057401 CGGGGCGGGCACAGGGGGAGTGG - Intronic
1057596125 9:96417664-96417686 CGAGGCGGCGGCGGAGGCCGAGG + Exonic
1057869778 9:98708895-98708917 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
1060106731 9:120877257-120877279 GGGGGAGGCGGCGGAGGGAGGGG + Exonic
1060268639 9:122126585-122126607 CGGGGAGTCGGAGGAGGGAGCGG + Intergenic
1060682423 9:125577526-125577548 CGGGGCGGCCGGCCAGGCAGAGG - Intronic
1060803122 9:126557148-126557170 TGGGGCGGCCTCGGAGGCAAAGG - Intergenic
1060916905 9:127397328-127397350 CGGAGCGGACGCGGAGGGGCGGG - Intronic
1061264372 9:129496862-129496884 CGGGGAGGCGGCGAGGGGAGGGG + Intergenic
1061307030 9:129738059-129738081 CGGGGCAGCCCCGCAGGGAGGGG + Intergenic
1061489821 9:130938736-130938758 CGGGGCGGCCCGGGAGCGGGCGG + Exonic
1061517122 9:131096462-131096484 GGGGCCGGCAGCGGAGGGAGGGG + Exonic
1061540780 9:131277100-131277122 CGGGGCGGGCGCGGGGGGCGGGG - Intergenic
1061608945 9:131733354-131733376 CGGGGCGGGGGCGGGGGGGGGGG + Intronic
1061610027 9:131739988-131740010 GGCGGCGGGCGCGGCGGGAGCGG - Intronic
1061610030 9:131739997-131740019 CGGAGCGGCGGCGGCGGGCGCGG - Intronic
1062022523 9:134326237-134326259 CGGGGCGGCGGCGGCGGAGGGGG + Intronic
1062344792 9:136109704-136109726 GGGAGCGGCCCCGCAGGGAGGGG + Intergenic
1062389197 9:136327399-136327421 CGGGGCGGACGCGGGGGGAGGGG - Intergenic
1062414309 9:136439946-136439968 CGGGGCTGCCGGGTTGGGAGGGG - Intergenic
1062434901 9:136542660-136542682 GGTGGGGGCCGGGGAGGGAGGGG + Intronic
1062435809 9:136546120-136546142 GGAGGTGGCCGCGGAGGGGGCGG - Intergenic
1062569953 9:137180416-137180438 CGGGGCGGCCGGGCAGCGGGCGG + Intronic
1062605679 9:137347909-137347931 CGGGGTGGCCAAGGATGGAGCGG - Intronic
1062659174 9:137619279-137619301 CCGGGCGGCGGCTGGGGGAGCGG + Intronic
1203770961 EBV:49934-49956 CGGGGCGGCGGTGGATAGAGAGG + Intergenic
1203778978 EBV:90296-90318 AGGGGCGGCAGCGGATGGTGGGG - Intergenic
1203778988 EBV:90326-90348 AGGGGCGGCAGCGGACGGTGGGG - Intergenic
1203470680 Un_GL000220v1:114192-114214 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1203478501 Un_GL000220v1:158164-158186 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1185468868 X:370861-370883 CGGGGCTGCCGCGTAGGGGACGG + Intronic
1186466227 X:9786336-9786358 CGGGGCTGGCGGGGAGGGGGCGG - Intergenic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1186726040 X:12359795-12359817 CAGGGCATCCGGGGAGGGAGCGG + Intronic
1187332653 X:18354728-18354750 CGGGCCGGCCGCGCGGGGGGCGG - Intergenic
1187363689 X:18649972-18649994 CGGGGCGGCGGCGGCGGGTGGGG - Intronic
1187367120 X:18675032-18675054 CGGGGCTCCGGCGGAGGGACCGG - Intergenic
1187448326 X:19376365-19376387 CGGGGAGGCAGAGGAGAGAGGGG - Intronic
1187826117 X:23334552-23334574 CGGGGAGGCCGCGGGGGGTGGGG + Exonic
1189056847 X:37707370-37707392 CGGGGTGGCTGCGGGTGGAGGGG + Intronic
1189197639 X:39165691-39165713 GGGGGCGGGCGCGGAGTGGGAGG - Intergenic
1189331361 X:40146683-40146705 GGGGGCGGGCGCGGCGGGCGGGG - Intronic
1190844924 X:54182867-54182889 GGGGGCGGCGGCGGCGGCAGCGG + Exonic
1191835424 X:65457405-65457427 CGGGGCGGCCGGCCAGGCAGAGG - Intronic
1192034296 X:67546269-67546291 TGGGGAGGCGGCGGAGGGGGCGG - Exonic
1192146483 X:68686310-68686332 CGGGGAGCCCGGGGAGGGAGGGG - Intronic
1192214666 X:69150174-69150196 CTGGTCGGCCGCGGAGGGGCGGG + Intergenic
1192224915 X:69221589-69221611 CGGGTCGGCCGCGGAGGGGCGGG - Intergenic
1192260951 X:69505574-69505596 CCGGGCGGCGGCGGCGGCAGCGG - Exonic
1192609607 X:72554501-72554523 CGGGGAGGGCGGGGAGGGCGGGG + Intronic
1192630055 X:72770239-72770261 AGGGGCGGCTGAGGAGTGAGTGG - Intergenic
1192651655 X:72950565-72950587 AGGGGCGGCTGAGGAGTGAGTGG + Intergenic
1194666823 X:96685070-96685092 CGGGGCGGCGGCGTCGGGAGCGG + Exonic
1196645846 X:118116810-118116832 TGGGGGGGCTGCTGAGGGAGGGG + Intronic
1199500368 X:148500672-148500694 CGGGGCGGCAGCGGCGGCGGCGG - Exonic
1199772382 X:150983393-150983415 GGCGGCGGCGGCGGCGGGAGCGG - Intronic
1200002599 X:153069707-153069729 GGGGGCGGCCGAGGCGGGGGGGG + Intergenic
1200005125 X:153080303-153080325 GGGGGCGGCCGAGGCGGGGGGGG - Intergenic
1200073226 X:153539059-153539081 TGGGGCTTCTGCGGAGGGAGAGG - Intronic
1200098184 X:153673853-153673875 GGGGGCGTGCGCGGAGGGGGCGG - Intronic
1200101076 X:153689278-153689300 CGGGAGGGCCGCGAGGGGAGGGG - Intronic
1200212007 X:154350879-154350901 CAGGGCGGCCGGGCAGGGACAGG + Intronic