ID: 926092119

View in Genome Browser
Species Human (GRCh38)
Location 2:10057966-10057988
Sequence CAGCCTGGCCAGTGCCTGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926092119_926092127 12 Left 926092119 2:10057966-10057988 CCCCGCAGGCACTGGCCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 277
Right 926092127 2:10058001-10058023 AGAACTGGAAAGCCAGTATCAGG 0: 1
1: 0
2: 3
3: 10
4: 160
926092119_926092125 -3 Left 926092119 2:10057966-10057988 CCCCGCAGGCACTGGCCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 277
Right 926092125 2:10057986-10058008 CTGCCTGTGAGAGGGAGAACTGG 0: 1
1: 0
2: 4
3: 35
4: 378
926092119_926092129 27 Left 926092119 2:10057966-10057988 CCCCGCAGGCACTGGCCAGGCTG 0: 1
1: 0
2: 4
3: 31
4: 277
Right 926092129 2:10058016-10058038 GTATCAGGCAGACCCTCTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926092119 Original CRISPR CAGCCTGGCCAGTGCCTGCG GGG (reversed) Exonic