ID: 926092538

View in Genome Browser
Species Human (GRCh38)
Location 2:10060097-10060119
Sequence CCTTCCGAGGCAGCATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926092538_926092546 4 Left 926092538 2:10060097-10060119 CCTGGAGATGCTGCCTCGGAAGG 0: 1
1: 0
2: 2
3: 18
4: 164
Right 926092546 2:10060124-10060146 GTGCAGGTCTGCAGCTGACAGGG 0: 1
1: 0
2: 1
3: 18
4: 223
926092538_926092547 10 Left 926092538 2:10060097-10060119 CCTGGAGATGCTGCCTCGGAAGG 0: 1
1: 0
2: 2
3: 18
4: 164
Right 926092547 2:10060130-10060152 GTCTGCAGCTGACAGGGTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 216
926092538_926092545 3 Left 926092538 2:10060097-10060119 CCTGGAGATGCTGCCTCGGAAGG 0: 1
1: 0
2: 2
3: 18
4: 164
Right 926092545 2:10060123-10060145 TGTGCAGGTCTGCAGCTGACAGG 0: 1
1: 0
2: 1
3: 18
4: 228
926092538_926092548 15 Left 926092538 2:10060097-10060119 CCTGGAGATGCTGCCTCGGAAGG 0: 1
1: 0
2: 2
3: 18
4: 164
Right 926092548 2:10060135-10060157 CAGCTGACAGGGTCCAGGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 325
926092538_926092549 19 Left 926092538 2:10060097-10060119 CCTGGAGATGCTGCCTCGGAAGG 0: 1
1: 0
2: 2
3: 18
4: 164
Right 926092549 2:10060139-10060161 TGACAGGGTCCAGGAGAGGCAGG 0: 1
1: 0
2: 5
3: 36
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926092538 Original CRISPR CCTTCCGAGGCAGCATCTCC AGG (reversed) Intronic