ID: 926095705

View in Genome Browser
Species Human (GRCh38)
Location 2:10079870-10079892
Sequence CGCCGTCCCCCGAGGCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926095700_926095705 -6 Left 926095700 2:10079853-10079875 CCGGTGAGTGGGGTCCCCGCCGT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 926095705 2:10079870-10079892 CGCCGTCCCCCGAGGCCCTGCGG 0: 1
1: 0
2: 1
3: 17
4: 161
926095690_926095705 26 Left 926095690 2:10079821-10079843 CCGGCGCCCAGGGCTGGGGCGGG 0: 1
1: 0
2: 5
3: 85
4: 659
Right 926095705 2:10079870-10079892 CGCCGTCCCCCGAGGCCCTGCGG 0: 1
1: 0
2: 1
3: 17
4: 161
926095693_926095705 20 Left 926095693 2:10079827-10079849 CCCAGGGCTGGGGCGGGGACGCG 0: 1
1: 0
2: 5
3: 43
4: 438
Right 926095705 2:10079870-10079892 CGCCGTCCCCCGAGGCCCTGCGG 0: 1
1: 0
2: 1
3: 17
4: 161
926095694_926095705 19 Left 926095694 2:10079828-10079850 CCAGGGCTGGGGCGGGGACGCGC 0: 1
1: 0
2: 4
3: 73
4: 601
Right 926095705 2:10079870-10079892 CGCCGTCCCCCGAGGCCCTGCGG 0: 1
1: 0
2: 1
3: 17
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926095705 Original CRISPR CGCCGTCCCCCGAGGCCCTG CGG Intronic
900309849 1:2028434-2028456 CTGCATCCCCAGAGGCCCTGGGG - Intronic
900376071 1:2355472-2355494 CACAGACCCCCGAGGCTCTGAGG + Intronic
901238676 1:7680634-7680656 CGCCGCCCACCGAAGGCCTGTGG - Intronic
901851701 1:12019951-12019973 CTCCGTGCCCCCCGGCCCTGCGG + Intronic
903190320 1:21652319-21652341 CGCCGGCCTCCTAGGACCTGGGG + Intronic
903259077 1:22121560-22121582 GGCCGCCTCCCGAGTCCCTGTGG + Exonic
905166017 1:36083976-36083998 CGGCGTCCCCGGAGGCCTTTAGG - Intergenic
911188414 1:94926323-94926345 CGCCGACCCCAGGGGCCCCGAGG - Intronic
912305179 1:108560042-108560064 CCCCGACCCCCGAGGCGCTGAGG + Intergenic
1063158693 10:3403385-3403407 CCCAGTCCCCAGAGGCCCAGAGG - Intergenic
1064017535 10:11784123-11784145 CGACCTCCCCTCAGGCCCTGAGG + Intergenic
1070823523 10:79376849-79376871 CTCCTTCCCCACAGGCCCTGAGG - Intergenic
1070923747 10:80205065-80205087 CGCCGTCCCCCCGGGCTCAGGGG - Intronic
1073509560 10:104034700-104034722 CGGGGGCCCTCGAGGCCCTGGGG + Exonic
1074065173 10:110007569-110007591 CGGCGTCCCCGGAGGGCCAGAGG - Intronic
1075788317 10:125065461-125065483 CGCCTTCCCCAAAGCCCCTGCGG - Intronic
1076064602 10:127439452-127439474 CGGCCTCGCCCCAGGCCCTGCGG - Intronic
1076685682 10:132197532-132197554 CGCCGACCCCCCAGGCCCTTGGG + Intronic
1077377979 11:2214553-2214575 GGCCGTCCCGCAAGGACCTGGGG - Intergenic
1077886313 11:6390511-6390533 CGGCGCCGCCCGGGGCCCTGAGG + Exonic
1082001387 11:47395316-47395338 CGCCATCCCCCGAGACCCCCGGG + Intergenic
1083595709 11:63917481-63917503 CGCCTGCCCCGGGGGCCCTGGGG + Intergenic
1083635293 11:64117551-64117573 CGCCATCACCCGTGGCCATGGGG - Exonic
1089452607 11:118608297-118608319 CCCCGGCCCCCGAGGACGTGGGG - Intronic
1092246644 12:6867744-6867766 CGCCCTCTCCCGAGGCCCCGAGG + Intronic
1092249492 12:6884760-6884782 CTCCCTCCCCCGCGTCCCTGTGG + Intronic
1093715512 12:22377013-22377035 CGCCGGCCCCCTAGGCAGTGAGG + Intronic
1094564881 12:31590652-31590674 CAGCGTCCCCCGCGCCCCTGAGG + Intronic
1095983334 12:47984798-47984820 CGCAATGCCCCGAGGCTCTGTGG + Intronic
1096672577 12:53209072-53209094 CTCCTTCCCCACAGGCCCTGTGG + Intergenic
1102745006 12:115242659-115242681 CTCCGCTCCCCGAAGCCCTGTGG + Intergenic
1103091883 12:118103728-118103750 CCCCGGGCCCCGGGGCCCTGGGG - Exonic
1104963264 12:132498084-132498106 CACCCTCCCCAGAGGCCCTGTGG - Intronic
1108029235 13:46211795-46211817 CGCCTTCCTCCGACGCACTGTGG - Intronic
1112563312 13:100532522-100532544 CGCCGTCCCGCAGGACCCTGTGG + Exonic
1113378510 13:109784364-109784386 CCGCGTCCCCCGAGACCCGGCGG + Exonic
1113876631 13:113598635-113598657 GGCTGTCCCCTGAGGACCTGGGG + Intronic
1114613615 14:24057096-24057118 CGCCACCCCCAGAGGCCATGGGG - Intronic
1120865333 14:89291498-89291520 CGCCATCCCCAGGGGGCCTGTGG + Intronic
1122226939 14:100285715-100285737 CGCCCTGCCCCGTGTCCCTGTGG - Intergenic
1122374925 14:101251264-101251286 CACCCTCCCCCTGGGCCCTGAGG - Intergenic
1124035302 15:26048867-26048889 CATGGCCCCCCGAGGCCCTGGGG - Intergenic
1124119470 15:26876473-26876495 AGCCGTGCCCTGAGGCCCAGTGG + Intronic
1124377426 15:29137033-29137055 CACCGTCCACTGAGGCCCAGAGG - Exonic
1124625837 15:31307024-31307046 GGCCATCCCCCCAGGCCCTTTGG - Intergenic
1130599079 15:85264093-85264115 CTGGGTCCCCGGAGGCCCTGGGG - Intergenic
1131119291 15:89813128-89813150 AGCCGCACACCGAGGCCCTGGGG - Intronic
1132389296 15:101426969-101426991 CGCAGTCCCTGGAGGCCCTCTGG + Intronic
1132478108 16:152706-152728 CCCAGTCCCACCAGGCCCTGAGG + Exonic
1132581770 16:688077-688099 CGCCCACTCCCGTGGCCCTGTGG + Intronic
1132604794 16:789143-789165 CGCCCACTCCGGAGGCCCTGGGG - Intronic
1132684299 16:1155884-1155906 CGCTGTCCCCCGGTGTCCTGAGG + Intronic
1132861011 16:2071834-2071856 CGCCGGGCCAGGAGGCCCTGTGG - Exonic
1133324820 16:4936354-4936376 AGCCGCGCCCGGAGGCCCTGGGG - Intronic
1133340671 16:5033712-5033734 CGTCGTCGCGGGAGGCCCTGCGG + Exonic
1135323476 16:21511977-21511999 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1136334964 16:29605242-29605264 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1136588544 16:31202895-31202917 TGGCGTCCCCCGACGGCCTGGGG - Exonic
1139490894 16:67285396-67285418 CGCTGACCGCGGAGGCCCTGGGG - Exonic
1139806195 16:69566610-69566632 CGTCGGCCCCCGGGGCTCTGCGG + Intronic
1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG + Intergenic
1142035678 16:87861061-87861083 CACGCTCCCCAGAGGCCCTGTGG - Intronic
1142688885 17:1593001-1593023 TCCCGTCCCCTGAGGCCCCGCGG + Intronic
1142723463 17:1793724-1793746 AGCCTTCCCCAGAGGCTCTGAGG + Intronic
1143166414 17:4899325-4899347 CGCCGCCGCCCGAGGCCCCCCGG - Exonic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147156710 17:38547795-38547817 TGCTGTCCCCCCAGGACCTGGGG - Intronic
1148842429 17:50507873-50507895 CGCCTTCCCCTGGAGCCCTGAGG - Intergenic
1148860397 17:50601521-50601543 TGCATGCCCCCGAGGCCCTGAGG - Intronic
1152380657 17:79940913-79940935 TGCCTTCCCCCAAGTCCCTGAGG - Exonic
1152690704 17:81716526-81716548 CGCCAGCCCCCGGGGTCCTGGGG - Intronic
1152725218 17:81941766-81941788 CACAGTCCCCCAAGGCCCTGGGG + Exonic
1152817848 17:82418709-82418731 CGCGGTCCCGCGAGGTCCGGGGG - Exonic
1153575306 18:6513651-6513673 CCAGGTCCCCTGAGGCCCTGAGG + Exonic
1157599466 18:48885283-48885305 CGGTGGCCCCCAAGGCCCTGTGG - Intergenic
1157815963 18:50729662-50729684 CGCCGTCCACCGGGGCCGGGCGG - Exonic
1160405780 18:78645400-78645422 CGCCCGCCCCCGAGGCGCTGAGG - Intergenic
1160405794 18:78645453-78645475 CGCCTGCCCCCGAGGCGCTGAGG - Intergenic
1160836749 19:1128182-1128204 CGCCGTCCTGCGTGGCCCTGAGG - Intronic
1160875395 19:1294301-1294323 CGCCATCGCCCGAGGCAGTGAGG + Intronic
1160930443 19:1567585-1567607 CGCCCCACCCCGCGGCCCTGGGG - Exonic
1160944978 19:1637387-1637409 CCCGCTCCCCCAAGGCCCTGGGG + Intronic
1161077853 19:2294944-2294966 CGGCATCCCCCCAGGCCCCGTGG + Intronic
1161126462 19:2560633-2560655 CAGGGTCCCCCCAGGCCCTGTGG - Intronic
1161215794 19:3094547-3094569 CGCCGCCCGCCGCGGCCCTCCGG - Exonic
1161407997 19:4101187-4101209 TGCCGGCCCCCGGGGCTCTGGGG + Intronic
1161408001 19:4101193-4101215 CGCCCTCCCCAGAGCCCCGGGGG - Intronic
1162340063 19:10086737-10086759 CGCCTTCCCCCAACGCCCTGTGG + Intronic
1166539536 19:43596050-43596072 CTCCGTCCGCCGCGGCCCAGGGG - Exonic
1166677576 19:44748922-44748944 CGCCGCTCCCCGCGGCGCTGCGG + Exonic
1167474346 19:49691353-49691375 CGCCGGAGCCCGAGCCCCTGGGG - Intronic
1167610656 19:50506395-50506417 TGCGGGCGCCCGAGGCCCTGGGG - Exonic
1167648185 19:50716927-50716949 TGCCGTCCCCCGTCGCCCCGTGG - Exonic
1167741450 19:51326931-51326953 GGCGGACCCCCGAGTCCCTGGGG + Intronic
1167753308 19:51394232-51394254 TCCCGTCCCCCGTGCCCCTGCGG + Intergenic
1167796593 19:51713525-51713547 CGCCGGCCCCCGCGGCCAAGTGG + Exonic
1168311823 19:55464524-55464546 CGGGGTCCCCGAAGGCCCTGGGG - Intergenic
925928076 2:8685020-8685042 CCCCGTCTCCGGAGGCCCGGAGG - Intergenic
926095705 2:10079870-10079892 CGCCGTCCCCCGAGGCCCTGCGG + Intronic
932776177 2:74529685-74529707 CGCCTTCCCAAGAGCCCCTGCGG - Exonic
933792445 2:85893866-85893888 CTCCAGCCCCCGAGGGCCTGCGG - Intergenic
934026254 2:88003587-88003609 CTCCGGCCCCCGAGGCTCAGTGG + Intergenic
934321494 2:91975235-91975257 CCCCCTCCCCCCAGTCCCTGTGG + Intergenic
935645315 2:105329638-105329660 CGCCGTCCCGCGCCGCCCCGCGG + Exonic
936089678 2:109492955-109492977 CCCAGTCCCCCAAGGGCCTGGGG - Intronic
946398140 2:219453722-219453744 TGCCTGCCCCCCAGGCCCTGGGG - Intronic
947712052 2:232321907-232321929 CTCCCTGCCCCTAGGCCCTGAGG - Intronic
947731292 2:232433026-232433048 CTCCCTGCCCCTAGGCCCTGAGG - Intergenic
948015469 2:234686698-234686720 CACCGTCTCCAGAGGCTCTGGGG - Intergenic
948808544 2:240463304-240463326 AGCCAGGCCCCGAGGCCCTGGGG - Intronic
949026942 2:241770717-241770739 CCCAGTCCCCAGAGGCCCAGCGG - Intergenic
1169120479 20:3092955-3092977 CGCCGACCCGCGGGGCCCTGGGG - Intergenic
1174533545 20:51233501-51233523 CTCAGTTCCCGGAGGCCCTGGGG + Intergenic
1175189628 20:57202568-57202590 AGCCCTCCTCCGAGGCCCAGAGG + Exonic
1175519109 20:59588400-59588422 CCCCGTCCCCCTGGTCCCTGGGG + Intronic
1175972722 20:62694974-62694996 CCCCGTCCCTCCCGGCCCTGAGG - Intergenic
1177389164 21:20444025-20444047 CGACCTCCCCCGCGGCCCCGTGG - Intergenic
1178992133 21:37365979-37366001 CGCCGGGCCCGGCGGCCCTGAGG - Intronic
1179829274 21:43985995-43986017 CCCCATCCCCCGAGGCCCGAGGG - Exonic
1180079030 21:45477916-45477938 GTCCCTCCCCGGAGGCCCTGGGG - Exonic
1181168877 22:20997336-20997358 CGCCGACATCTGAGGCCCTGTGG + Exonic
1183483559 22:38077650-38077672 CTCCGTCCCCTGGGGTCCTGGGG - Intergenic
1183720192 22:39557903-39557925 CGCCGCCCCCCGCGCCCCGGGGG + Intergenic
1184895241 22:47402874-47402896 GTGCCTCCCCCGAGGCCCTGTGG - Intergenic
1185233914 22:49700092-49700114 CCCTGTCCCCTGAGGCCTTGAGG - Intergenic
950643013 3:14360511-14360533 TGCCCACCCCCCAGGCCCTGGGG + Intergenic
954361407 3:50124643-50124665 CTCCTTCCCCTGAGGCTCTGAGG - Intergenic
956979053 3:74614877-74614899 CGCCGCCGCCCAGGGCCCTGCGG - Intergenic
961330401 3:126134901-126134923 CTCCTTCCCGCCAGGCCCTGTGG + Intronic
962309035 3:134312964-134312986 CGCCTTGCCCAGAGGCTCTGCGG - Intergenic
963852342 3:150221394-150221416 CGCCGGCCGCCGAGACCCCGGGG - Intergenic
964801650 3:160565097-160565119 CGCCATTCCCCGAGGCCTGGAGG + Intronic
966160313 3:176960723-176960745 AGCTGTCCCACGATGCCCTGGGG + Intergenic
966381351 3:179347915-179347937 CGCCGCCCGCCGCGGTCCTGTGG + Intronic
966866185 3:184260252-184260274 CGCCGCCCCCCGAGGCCGCGCGG - Intronic
968568988 4:1329547-1329569 CGCCTGCCCCCGAGACACTGGGG - Intronic
968624072 4:1618683-1618705 CGCCGGCCTCCCAGGCCATGGGG + Intronic
969564646 4:7970773-7970795 CTCCATCACCAGAGGCCCTGGGG + Intronic
983216502 4:165007396-165007418 CCCCGTCCACCGAGGACTTGCGG - Intergenic
983940099 4:173529003-173529025 CGCGGCCCCCCCAGGCCCGGGGG + Exonic
984734692 4:183098688-183098710 CGCCGCGCCCCGAGCCCCTCCGG - Intergenic
985777266 5:1851365-1851387 CGCCCTCTCACGAGGCGCTGGGG + Intergenic
986717061 5:10532506-10532528 CGCCTTTCCCCAAGCCCCTGGGG - Intergenic
987050408 5:14143574-14143596 CGCCGCCCCCCGCCGCCCCGGGG + Intergenic
989147052 5:38259010-38259032 CGCCCTCCCCCGAGCCCGGGCGG + Intronic
992487544 5:77210743-77210765 CGCGGTCCCCGGAGGCTCGGCGG + Intronic
998339394 5:141403585-141403607 CGCCGCCATCCGAGGCCGTGAGG - Exonic
999311341 5:150553967-150553989 GGCAGTGCCCCAAGGCCCTGCGG - Exonic
1001961844 5:175884326-175884348 CCCCTTCCCCCGAGCCCCTCTGG + Intergenic
1002098414 5:176845448-176845470 GCCCGTTCCCCGAGGCCCTGAGG + Intronic
1002176127 5:177402506-177402528 CGCCCTTCCCCGAGGCCGTCAGG - Intronic
1002925718 6:1604816-1604838 CGGCCTCCCCCGAGGACCTGAGG - Intergenic
1007181899 6:39934549-39934571 CGCAGTCCCGCGTGGCCTTGTGG + Intronic
1018992404 6:168684292-168684314 TTCTGTCCCCCGAGGCTCTGAGG + Intergenic
1019523463 7:1470604-1470626 CGCAGATCTCCGAGGCCCTGAGG - Exonic
1022518281 7:30989195-30989217 GGCCCTCCCCCGAGGCCCTGCGG + Intronic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1031401378 7:121329226-121329248 CCCCCTCCCCAGAGGCCCTTCGG - Exonic
1032011535 7:128351034-128351056 CTCAGTCCCCCGCGGCCCTCAGG - Exonic
1036646238 8:10612660-10612682 CCCCGTCCTCCGGGGTCCTGGGG + Exonic
1037776000 8:21835993-21836015 CGATGTCCCCTGAGGCCTTGTGG - Intergenic
1040471425 8:47738243-47738265 CCCCTTCCCCCGCGGCCCCGGGG - Exonic
1042591782 8:70403670-70403692 CGCCTTCCCCCGGGGCCGCGAGG - Intronic
1048469517 8:134695057-134695079 CTCCCTCCCCTGAAGCCCTGAGG - Intronic
1049084178 8:140464865-140464887 CGCGCGGCCCCGAGGCCCTGAGG + Intergenic
1049599311 8:143499726-143499748 CACCCTCCACGGAGGCCCTGGGG + Intronic
1049718332 8:144104102-144104124 CTACGTCCGCCGAGCCCCTGGGG - Exonic
1049781114 8:144429359-144429381 CGCCGGCCCCCGCAGCGCTGAGG - Intronic
1049988549 9:972752-972774 CGCGGTTCCTGGAGGCCCTGGGG - Intergenic
1052861874 9:33442437-33442459 CCCCGTCCCCCGAGGCCTGGAGG - Exonic
1061678585 9:132231665-132231687 CCCCGACCCCAAAGGCCCTGTGG + Intronic
1061918460 9:133769383-133769405 CCCGGTCCCCCCACGCCCTGGGG + Intronic
1062310250 9:135931562-135931584 TTCAGTCCCCAGAGGCCCTGAGG - Intergenic
1062326166 9:136013532-136013554 AGACGTCCCCGGAGTCCCTGAGG - Intronic
1190114775 X:47619506-47619528 CACCGCCCCCCGAGGACCCGGGG + Exonic
1190730929 X:53225008-53225030 CGCCGCCCGCCGAGGGCCTAAGG + Exonic
1192344432 X:70289691-70289713 TGCCTTGCCCCGAGTCCCTGCGG - Intronic
1199715233 X:150503341-150503363 CCCCGTCCTGCCAGGCCCTGGGG + Intronic
1199849307 X:151714122-151714144 CTCCATAGCCCGAGGCCCTGTGG + Intergenic
1200086994 X:153611807-153611829 CGCAGTCCCCGGAGGCTGTGGGG - Intergenic