ID: 926095794

View in Genome Browser
Species Human (GRCh38)
Location 2:10080116-10080138
Sequence CCGGCGGGTCCCGCCCTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 141}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926095775_926095794 20 Left 926095775 2:10080073-10080095 CCGCGGCTGCCCCCGGGACCTCG 0: 1
1: 1
2: 2
3: 29
4: 266
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095772_926095794 26 Left 926095772 2:10080067-10080089 CCTCCTCCGCGGCTGCCCCCGGG 0: 1
1: 0
2: 7
3: 56
4: 570
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095777_926095794 11 Left 926095777 2:10080082-10080104 CCCCCGGGACCTCGGCCGCCGCC 0: 1
1: 1
2: 7
3: 63
4: 530
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095782_926095794 2 Left 926095782 2:10080091-10080113 CCTCGGCCGCCGCCACCGGCACC 0: 1
1: 1
2: 26
3: 339
4: 2739
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095774_926095794 23 Left 926095774 2:10080070-10080092 CCTCCGCGGCTGCCCCCGGGACC 0: 1
1: 0
2: 4
3: 42
4: 489
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095780_926095794 8 Left 926095780 2:10080085-10080107 CCGGGACCTCGGCCGCCGCCACC 0: 1
1: 0
2: 3
3: 38
4: 536
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095783_926095794 -4 Left 926095783 2:10080097-10080119 CCGCCGCCACCGGCACCCGCCGG 0: 1
1: 0
2: 0
3: 39
4: 436
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095788_926095794 -10 Left 926095788 2:10080103-10080125 CCACCGGCACCCGCCGGCGGGTC 0: 1
1: 0
2: 1
3: 8
4: 117
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095785_926095794 -7 Left 926095785 2:10080100-10080122 CCGCCACCGGCACCCGCCGGCGG 0: 1
1: 0
2: 1
3: 16
4: 204
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095779_926095794 9 Left 926095779 2:10080084-10080106 CCCGGGACCTCGGCCGCCGCCAC 0: 1
1: 0
2: 1
3: 17
4: 302
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
926095778_926095794 10 Left 926095778 2:10080083-10080105 CCCCGGGACCTCGGCCGCCGCCA 0: 1
1: 0
2: 3
3: 21
4: 176
Right 926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926095794 Original CRISPR CCGGCGGGTCCCGCCCTCCA GGG Exonic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
900142099 1:1143002-1143024 GAGGCAGGTGCCGCCCTCCATGG - Intergenic
900146612 1:1161460-1161482 CAGGCAGGTCCCGCCGTGCAGGG + Intergenic
900178711 1:1302153-1302175 GGGGCGGGTCCCACCCTGCAGGG + Intronic
900314425 1:2050028-2050050 CCCGAGGGCCCCGCCGTCCAGGG - Intergenic
902998107 1:20243183-20243205 CCCGCGAGTCCCGCCGTCCGAGG - Intergenic
903233765 1:21937011-21937033 CCGGCGGGCGCCGCCGTCCCGGG + Intronic
906640427 1:47437926-47437948 CCGGCGGGTCGTGCCCTGGAAGG + Exonic
910803185 1:91165241-91165263 CCAGCGGGCCCCCTCCTCCAGGG - Intergenic
914386264 1:147172612-147172634 CCGGCGGGTCCCGGGCGCCGAGG - Intergenic
915359577 1:155277936-155277958 CCGGCCCGCCCCACCCTCCACGG + Intronic
916068952 1:161159090-161159112 CCAGCACTTCCCGCCCTCCAGGG + Intergenic
917252524 1:173077544-173077566 CAGGCTGGTCTCGACCTCCAGGG - Intergenic
918064369 1:181089439-181089461 CCGGCGGGTCCTCCCCGCCTAGG - Exonic
920171500 1:204074785-204074807 GCGGCGGCTCCCGCCCTGGAGGG + Intronic
920666077 1:207963779-207963801 GCGGCGGGTCCGGCCAGCCAGGG + Intergenic
922359577 1:224809300-224809322 CTGTCTGGTCCAGCCCTCCAAGG + Intergenic
922460254 1:225810184-225810206 CCGGCCGGGCCCGCACTCCCCGG + Intronic
923497010 1:234534560-234534582 CTGGCGACTCCCGCCCTTCAGGG + Intergenic
924362372 1:243255046-243255068 CCGTCCGGTCCCTCTCTCCACGG - Exonic
1062790956 10:306264-306286 CAGGCAGGTCCCACCCACCATGG + Intronic
1065293694 10:24255408-24255430 CGGGCGGGTCCCGCCACCCGTGG + Intronic
1070312400 10:75283307-75283329 CTGCCTGGCCCCGCCCTCCAAGG + Intergenic
1073432264 10:103494187-103494209 TTGGCGGGTTCCGCCCGCCACGG - Exonic
1074138024 10:110644436-110644458 CGGGCGGGTCTCGCCCCGCATGG + Exonic
1079404370 11:20131903-20131925 ACGGTGCGTCACGCCCTCCATGG - Intergenic
1081773739 11:45664653-45664675 CCGGCGGCTCCGGCCCCACAGGG + Intronic
1081812773 11:45922766-45922788 CCGTCGGGCCCCGCCGCCCAGGG + Intronic
1083776137 11:64895114-64895136 CTGGCGGATCACGCCCCCCACGG + Exonic
1083925547 11:65803950-65803972 CCGGCTGGACTGGCCCTCCAAGG - Intergenic
1084621153 11:70270959-70270981 CCGGCGCGTCCCGGTCTCCGCGG + Intronic
1084733738 11:71091344-71091366 CCAGCAGGCCCCGCCCTCCCTGG - Intronic
1091643734 12:2257285-2257307 CAGCCTGGTCCCGTCCTCCAGGG - Intronic
1096981415 12:55729734-55729756 GCGTCGGGTCCCGCCCTCTGGGG + Intergenic
1097212933 12:57386410-57386432 CCAGCCGGCCCCGCCCACCAGGG + Intronic
1101433468 12:104645613-104645635 CCTGCTGGTCCTGGCCTCCAAGG + Intronic
1105302150 13:19145219-19145241 CAGGCTGGTCCCGAACTCCAGGG + Intergenic
1105388689 13:19957539-19957561 CCTGTGGGGCCCGCCCTCCTCGG + Intergenic
1108229032 13:48318571-48318593 CGGGCAGGTCCCGCCCCTCATGG + Intronic
1108643639 13:52406176-52406198 CCCGCGGGGCCCGCCCCCGACGG + Intronic
1121781310 14:96624166-96624188 CCTGAGGTCCCCGCCCTCCATGG + Intergenic
1122768212 14:104085646-104085668 CCCGCCGGCCCCGCCCTCCCAGG + Intergenic
1124464667 15:29926008-29926030 CTGGCGGCTCCCTCCCTCCAAGG - Intronic
1128067583 15:64774734-64774756 CCGGCCGGCCCAGGCCTCCAAGG + Intronic
1128111349 15:65078059-65078081 CCGCCAGGTGCCGCCCTCGATGG - Exonic
1132612673 16:825057-825079 CCGGGGGACTCCGCCCTCCAGGG - Intergenic
1132626897 16:895478-895500 CCGGCGGCTCCCGTCCTGCCTGG - Intronic
1134134346 16:11669172-11669194 CCGGCGTCTCCCCCACTCCACGG - Intronic
1135691407 16:24540190-24540212 CCGGCGGGTCTCTCTCTCCGTGG - Exonic
1136505551 16:30700673-30700695 CCACCGGGACCCGCCTTCCAGGG - Exonic
1137598660 16:49741621-49741643 CAGGCTGGACCAGCCCTCCAAGG - Intronic
1140478643 16:75251179-75251201 CTGGCGGGGCCCGCGCTCCCCGG - Intronic
1142627750 17:1203321-1203343 CCCGCGGACCCCGCCCCCCATGG - Intronic
1143528318 17:7484892-7484914 CCGTCCGGCCCCGCCCGCCAGGG - Intronic
1145390804 17:22454208-22454230 CGGGCGGGTCCTCGCCTCCAGGG + Intergenic
1146156519 17:30528900-30528922 CAGGCTGGTCCCGCCCACCTCGG + Intergenic
1150284595 17:63947793-63947815 CGGGCAGGTCCTGCCCTTCAGGG + Intronic
1150792233 17:68207955-68207977 CCGGCAGGCCCCGCCGGCCATGG + Intergenic
1151348563 17:73518135-73518157 CCAGCGGGTCCCTCCCTTCTTGG + Intronic
1151685783 17:75645927-75645949 GAGGCGGGCCCTGCCCTCCAAGG - Intronic
1151729774 17:75904481-75904503 CCGGCGGGTCCCGAGTTCCCCGG + Intronic
1160256490 18:77251746-77251768 CCCGCGAGTCCCCCCCGCCACGG - Intronic
1160708161 19:539478-539500 CCGCTGGGTCCCGCCACCCAGGG + Intronic
1161108699 19:2456610-2456632 CCGGCAGGCCCCGCCCACCGCGG - Intronic
1161374609 19:3933135-3933157 CCGCAGGGTCCCGGCCTCTAGGG + Exonic
1161424966 19:4198339-4198361 CCGCCCGGTCCCGCCCTCCCTGG - Intronic
1162384722 19:10354024-10354046 TCGCCGGGTCCCGCCCACCTTGG + Exonic
1165523302 19:36331352-36331374 CCTGCGGGTCACTCCCTCCCAGG + Intergenic
1166862197 19:45816980-45817002 CCGACGGCTCCCTCCCTCCCTGG - Intronic
925367978 2:3324237-3324259 CGGGTGGGTCCTGCGCTCCAGGG - Intronic
926095794 2:10080116-10080138 CCGGCGGGTCCCGCCCTCCAGGG + Exonic
927988266 2:27428803-27428825 CTGGCGGGTCCCACCGTCCCGGG - Intronic
929133598 2:38602498-38602520 CCGGCGGTTCTCGCCTTCCTCGG + Exonic
932702278 2:74000146-74000168 CTGGCAGGTCCTGCCCTCCCAGG + Intronic
936508635 2:113128125-113128147 TCGGAGGGTCCCACTCTCCAGGG + Intronic
936526798 2:113246896-113246918 CCAGCTGGTTCAGCCCTCCATGG + Exonic
937083801 2:119157972-119157994 CAGGCGGGCCCGGCTCTCCAGGG + Exonic
937093897 2:119223769-119223791 CCTGCAGGTCCGGCCCTCCCGGG + Intergenic
938086887 2:128407593-128407615 CTGGAGGGTCCCGGCCTCCATGG + Intergenic
943752721 2:191526306-191526328 CAGGAGGCTCCCTCCCTCCAGGG + Intergenic
946149818 2:217756723-217756745 CCGAGGGCTCCCGCCCACCAGGG - Intergenic
948208211 2:236173836-236173858 CCGGGGGGTTCCAGCCTCCAGGG - Intergenic
948542265 2:238699293-238699315 CCAGCAGGTCCTGCCCTCCCTGG + Intergenic
1169116861 20:3071806-3071828 GCTGCGGGTCCCTCCCTCCCCGG - Intronic
1169558135 20:6770125-6770147 ACAGCGGGTCCCGGCCACCATGG - Exonic
1171946992 20:31387680-31387702 CCAGTGGGCCCCACCCTCCAGGG + Intronic
1173865088 20:46308158-46308180 CCGGCCGCTCCCGCCGGCCAGGG + Intronic
1173916104 20:46709718-46709740 CCGCCGAGTCCCGCTCGCCATGG + Exonic
1176342221 21:5709569-5709591 CCGCCCTGTCCCTCCCTCCAGGG + Intergenic
1176474475 21:7141721-7141743 CCGCCCTGTCCCTCCCTCCAGGG + Intergenic
1176502606 21:7614887-7614909 CCGCCCTGTCCCTCCCTCCAGGG - Intergenic
1176536542 21:8107638-8107660 CCGCCCTGTCCCTCCCTCCAGGG + Intergenic
1182254807 22:29030758-29030780 CCGTCGTGTACCGCCCTGCAGGG - Intronic
1182904133 22:33921328-33921350 CCGGCGGCTCCCGGCCGCCTCGG + Intronic
1183393824 22:37560634-37560656 CCGGCGGGTCCCGGCGCCCGCGG + Intronic
1183509999 22:38229143-38229165 GCAGCAGGCCCCGCCCTCCAGGG + Intronic
1184131608 22:42519794-42519816 CCGGCGGCCCCCGCGCTCCCGGG - Exonic
1184754242 22:46507462-46507484 CCAGCGGCTCCCTCCCTCCCCGG + Intronic
1185013824 22:48332026-48332048 CAGCTGGGTCCTGCCCTCCATGG - Intergenic
1185313608 22:50169841-50169863 CCGGAGGTTCCCGCGCTCCTGGG - Intergenic
1185317381 22:50185034-50185056 CCGCCGGGTCCCGGCCGCCCCGG + Intergenic
1185370047 22:50456732-50456754 CTGGCTGGGCCCGGCCTCCAGGG + Intronic
1185375490 22:50481195-50481217 CCGGGCGGTCCCACCCTCCAGGG - Intergenic
1203241487 22_KI270733v1_random:24049-24071 CCGCCCTGTCCCTCCCTCCAGGG + Intergenic
953975823 3:47381078-47381100 CCGGCGGGTGCCAGCCGCCATGG + Exonic
954450567 3:50569267-50569289 CCGGCAGGTCCGGGCCCCCAAGG + Exonic
956986961 3:74712162-74712184 CCGGCCGGCCCCGCCAACCAAGG + Intergenic
961830144 3:129619130-129619152 CCGGCCTGTCCCACCATCCAGGG + Intergenic
968533976 4:1112714-1112736 CCGGCGGCCCCTCCCCTCCACGG + Intronic
973820476 4:54658135-54658157 CTGGCGGGTACCACCCTCCCAGG - Intronic
978777136 4:112515683-112515705 CAGCCGGGTCCTGCCCTCCGCGG + Intronic
979998725 4:127464090-127464112 TCAGCGGGTCCCACCCCCCATGG - Intergenic
982198240 4:152936674-152936696 CCGGCGCGTCCTCGCCTCCAGGG - Intronic
985714581 5:1448216-1448238 CCCACGGGTCCCCCCCTCCTTGG + Intergenic
990557580 5:56951693-56951715 CCGGCGGAGCCCCCCCTCCGCGG - Intronic
992088792 5:73299963-73299985 CCTGCGCGTCCCGCTCTCCCCGG - Intergenic
994669741 5:102752165-102752187 CCGGCCGGCCTCGCCCGCCAGGG + Intergenic
1004561997 6:16760647-16760669 CCGGCGAGGCCGGCCCTCCGAGG + Intronic
1006116603 6:31779169-31779191 CTGGGGGCTCCCGCCCCCCAGGG - Exonic
1013189689 6:107791741-107791763 CAGGCTGGTCCCGAACTCCAGGG - Intronic
1017532958 6:155314727-155314749 CCGCCTCGTCCCGCCCTCCTGGG - Intergenic
1019305605 7:332982-333004 CCGGCGGGCCCCGCGCTCCACGG - Intergenic
1019313593 7:374579-374601 CCCGCAGGTCCAGCTCTCCATGG - Intergenic
1020251244 7:6470241-6470263 CCGGCTGGGGCCGCCATCCATGG + Intronic
1034299074 7:149999374-149999396 CAGACGGGTCCTGCCCTCAAAGG + Intergenic
1034806944 7:154097399-154097421 CAGACGGGTCCTGCCCTCAAAGG - Intronic
1041124474 8:54621406-54621428 CCGGCATGCCCCGCCCCCCACGG + Exonic
1048307820 8:133296213-133296235 CTGGCCGCTCCTGCCCTCCACGG - Intronic
1049375326 8:142286727-142286749 CAGGTGGGTCCCCACCTCCACGG + Intronic
1049425992 8:142538129-142538151 CCCGTGGGTCCCCTCCTCCAGGG + Intronic
1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG + Intergenic
1049707381 8:144049185-144049207 CCGGCGCTGCACGCCCTCCACGG + Intergenic
1052971013 9:34377136-34377158 CCGGCGGGCCCGCCCCTCCTGGG + Intergenic
1053114606 9:35490100-35490122 GCGGCGTGTCTCGCCCTCCAGGG - Intergenic
1054924885 9:70579297-70579319 CCTGCTGGTCCCTCCCTCCCAGG + Intronic
1058058633 9:100473513-100473535 CCTGCGCTTCCCGCCGTCCAGGG + Exonic
1059891457 9:118809477-118809499 CCGGCGGGCCCCGCCGACCCGGG - Intergenic
1060054232 9:120400099-120400121 CCTGCAGGTCCCTTCCTCCAGGG + Intronic
1060838135 9:126773254-126773276 CCAGCAGGTCCCGCGCTCCCAGG - Intergenic
1061238661 9:129356851-129356873 CCGGCGGCTCCCACCTTCCCAGG + Intergenic
1061777130 9:132973097-132973119 CCGGTGGTCCCTGCCCTCCAGGG - Intronic
1062104028 9:134742932-134742954 CCAGTGAGTCCCGCCTTCCATGG + Intronic
1062446282 9:136596713-136596735 CCGGCTGGTCCCACCCAGCAAGG - Intergenic
1062582961 9:137236473-137236495 CCGCGGGGACCCCCCCTCCAGGG - Exonic
1203457809 Un_GL000220v1:7124-7146 CCGCCCTGTCCCTCCCTCCAGGG + Intergenic
1193906764 X:87253857-87253879 TCGGCGGGTCCCACCCCCCATGG - Intergenic
1198530769 X:137548426-137548448 CCGGCAGGGCCTGCTCTCCACGG + Intergenic
1199609563 X:149601079-149601101 CTGCCGGGTCCCCGCCTCCACGG + Intronic
1199629553 X:149768275-149768297 CTGCCGGGTCCCCGCCTCCACGG - Intergenic