ID: 926096781

View in Genome Browser
Species Human (GRCh38)
Location 2:10086428-10086450
Sequence ACATCCTACATGGCTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 1, 1: 3, 2: 68, 3: 267, 4: 718}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926096781_926096784 6 Left 926096781 2:10086428-10086450 CCTGCTTTAGCCATGTAGGATGT 0: 1
1: 3
2: 68
3: 267
4: 718
Right 926096784 2:10086457-10086479 TTCTGCTTCGCCTTCTGCCATGG 0: 1
1: 2
2: 24
3: 127
4: 410
926096781_926096786 19 Left 926096781 2:10086428-10086450 CCTGCTTTAGCCATGTAGGATGT 0: 1
1: 3
2: 68
3: 267
4: 718
Right 926096786 2:10086470-10086492 TCTGCCATGGTTGTTTCCTGAGG 0: 1
1: 10
2: 17
3: 51
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926096781 Original CRISPR ACATCCTACATGGCTAAAGC AGG (reversed) Intergenic
900949756 1:5851842-5851864 ACGTCTTACATGGCTGCAGCAGG - Intergenic
901135686 1:6992665-6992687 ACGTCTTACATGGCCAGAGCAGG + Intronic
901193988 1:7429854-7429876 ACATCTTACATGGCTGGAGCAGG + Intronic
901264401 1:7899052-7899074 ACATCTTACATGGCCAAAACAGG + Intergenic
902540846 1:17153408-17153430 ACATCTTACATGGCCAAAGCAGG - Intergenic
902707853 1:18218206-18218228 ACATCTTACATGGCTGGAGCAGG + Intronic
903691493 1:25177126-25177148 ACATCTTACATGGCCAGAGAAGG + Intergenic
904224554 1:29005212-29005234 ACATCTTACATGGCCAGAGCAGG + Intronic
904292102 1:29493451-29493473 ACATTCTACATGGCTGGAGCAGG - Intergenic
904315095 1:29654754-29654776 ATATCTTACATGGCCAGAGCAGG - Intergenic
904353359 1:29923090-29923112 GCATCTTACATGGCCAGAGCTGG - Intergenic
904728281 1:32567178-32567200 CCATCCTACATGTCTGGAGCAGG + Intronic
904802626 1:33105525-33105547 ACATCTTACATGGCTGCAGGAGG + Intronic
905002106 1:34680650-34680672 ACATCTTACATGACCAGAGCAGG + Intergenic
906017973 1:42599950-42599972 ACATCTTACATGGCTGGAGAAGG + Intronic
906353872 1:45086129-45086151 ACATTTTACATGGCTGGAGCCGG + Intronic
906368165 1:45228619-45228641 ACATCTTACATGGCCAGAGCAGG - Intronic
906498443 1:46322285-46322307 TCATCTTACATGGCTGGAGCAGG + Intergenic
907784187 1:57595823-57595845 ACATCCTACATGGCCGGAGGAGG - Intronic
907898533 1:58716458-58716480 ACATCTTACATGGCTGCAGTAGG + Intergenic
907938023 1:59060119-59060141 ACGTCCTACATGGCCAGAGAAGG + Intergenic
908007445 1:59741387-59741409 ACGTCTTACATGGCTGGAGCGGG - Intronic
908497494 1:64709233-64709255 ACAACTTACATGGCTGGAGCAGG - Intergenic
908592680 1:65650850-65650872 ACGTCTTACATGGCTAGAGCAGG - Intergenic
908809426 1:67964669-67964691 ACATCTTACATGGCCAGAACAGG - Intergenic
908879169 1:68711082-68711104 ACATCTTACGTGGCTAGAGCAGG - Intergenic
909131405 1:71741823-71741845 ACACTTTACATGGCTAGAGCGGG + Intronic
909369875 1:74871100-74871122 ACATCTTACATGGCAGGAGCAGG - Intergenic
909702558 1:78543582-78543604 ATGTCCTACATGGCTGGAGCAGG + Intergenic
909900529 1:81129077-81129099 ACGTCTTACATGGCCCAAGCAGG - Intergenic
910203712 1:84726062-84726084 ACATCCTACATGGCTGGAGAAGG - Intergenic
910619889 1:89241975-89241997 ACATCTTACAAGGCCAGAGCAGG - Intergenic
910673067 1:89792665-89792687 ACATCTTATATGGCTGGAGCAGG + Intronic
910863762 1:91768666-91768688 ACATCTTACATGGATGGAGCAGG - Intronic
911166888 1:94732249-94732271 AGATCTTACCTGGCTGAAGCAGG + Intergenic
911735381 1:101331215-101331237 ACGTCTTACATGGCTGCAGCAGG + Intergenic
912138016 1:106684848-106684870 ACATCCTACATGTCTAGAGTAGG - Intergenic
912616999 1:111112318-111112340 ACATGTTACATGGCTGGAGCAGG - Intergenic
912810104 1:112787627-112787649 ACATCTTACATGGCCAGAGTAGG + Intergenic
913344320 1:117792997-117793019 ACATCTTACATGGATGGAGCAGG + Intergenic
913366424 1:118044793-118044815 ACATCCTCCATGACTAGAGCGGG - Intronic
915660913 1:157404162-157404184 ACTTCTTACATGGCCAAAGATGG + Intergenic
916152631 1:161810301-161810323 ACATCTTACATGGCTAGAGCAGG + Intronic
916962547 1:169903975-169903997 ACATCTTACATGTCAGAAGCAGG + Intergenic
917051842 1:170933066-170933088 TCATCTTACATGGCCAAAGCAGG + Intergenic
917100077 1:171436260-171436282 CCATCCTATATACCTAAAGCTGG + Intergenic
917577949 1:176344139-176344161 ACATCTTACATGGCTCAAGCAGG + Intergenic
917696681 1:177532924-177532946 ACATCTTACATGGCTGAAGCAGG + Intergenic
917700245 1:177573431-177573453 ACATCTTACATGGCCAAAGCAGG + Intergenic
918207944 1:182325953-182325975 ATGTCTTACATGGCTAGAGCAGG - Intergenic
918263732 1:182820653-182820675 ACATCTTACATGGCCAGAGCAGG + Intronic
918322924 1:183382163-183382185 TCATCTTACATGGCTGGAGCAGG + Intronic
918823530 1:189291459-189291481 ACTTCTTACATGGCCAGAGCAGG + Intergenic
918880569 1:190114189-190114211 GCATGCCACATGGCGAAAGCAGG - Intronic
918908226 1:190528408-190528430 ACGTCTTACATGGCTGAAGCAGG + Intergenic
919605549 1:199678294-199678316 ACATCTTACATGGCTGAAGCAGG - Intergenic
920272292 1:204774902-204774924 ACATCTTACATGGCCGGAGCAGG - Intergenic
921216682 1:212943727-212943749 ACATCCTACTTGTCTGGAGCAGG - Intergenic
921464947 1:215476687-215476709 TCATCTTACATGGCCAGAGCAGG + Intergenic
921693737 1:218183214-218183236 ACATCTCACATGGCTGGAGCAGG + Intergenic
921745954 1:218741011-218741033 ACATCCTACATGGCCAGAGCAGG - Intergenic
922069074 1:222173581-222173603 ACATCTTGCATGGCAGAAGCAGG + Intergenic
922189183 1:223302138-223302160 ACATCTTACGTGGCTGGAGCAGG - Intronic
922859079 1:228800114-228800136 ACGTCTTACATGGCTGAAGTGGG - Intergenic
923785634 1:237065865-237065887 ACGTCTTACATGGCTGGAGCAGG + Intronic
924167808 1:241303313-241303335 ACATCTTACATGGCTGGAGAAGG - Intronic
924181460 1:241442689-241442711 GCATGCCACATGGCAAAAGCAGG + Intergenic
924496183 1:244592050-244592072 AAATTCTACATGACTGAAGCCGG + Intronic
924779249 1:247131594-247131616 ACAGCCTCCCTGGCTAAAGCAGG - Intronic
924792289 1:247263010-247263032 ACATCTTACACGGCTGGAGCAGG - Intergenic
1062794182 10:330731-330753 ACATCTTACATGGCCACAGCAGG - Intronic
1063217389 10:3936966-3936988 ACATCTTACATGGTTGGAGCAGG - Intergenic
1063253356 10:4298869-4298891 ACATCCTACATGGCTGGAGCAGG - Intergenic
1063470119 10:6277637-6277659 ACATCTTACATGGCCAGAGCAGG - Intergenic
1065160124 10:22911148-22911170 ACATCTTACATGGCTGGAGCAGG + Intergenic
1065178388 10:23100597-23100619 ACATCTTACATGGTCAGAGCAGG + Intronic
1065347250 10:24760296-24760318 ACATCTTACATGGCCAGAGCAGG - Intergenic
1065430394 10:25648823-25648845 ACATCTTACATGGCCAGAGCAGG - Intergenic
1065624848 10:27619816-27619838 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1065628005 10:27650982-27651004 ACGTCTTACATGGCTGGAGCAGG - Intergenic
1065738533 10:28775711-28775733 ACATCTTACAAGGCTGGAGCAGG + Intergenic
1065835423 10:29653322-29653344 ACAGCCTGCATGGCTGAAGCAGG - Intronic
1066507464 10:36060313-36060335 ACGTCTTACATGGCTGGAGCAGG + Intergenic
1066510986 10:36095648-36095670 ACATCTTACATGGCTGGAGCAGG - Intergenic
1066674255 10:37872025-37872047 ACATCTTGCATGGCCAGAGCAGG + Intergenic
1067016931 10:42764223-42764245 ACGTCTTACATGGCTGGAGCAGG + Intergenic
1068405279 10:56580721-56580743 ATATACTGCATGGCTAAGGCTGG + Intergenic
1068521893 10:58085945-58085967 ACATCCTACATGGCTGGAGCAGG - Intergenic
1068567022 10:58587649-58587671 ACAACATAGAGGGCTAAAGCTGG - Intronic
1068889311 10:62132319-62132341 ACATCTTACATGGCCAGAGAAGG - Intergenic
1069045678 10:63740947-63740969 ACATCTTATATGGCTGGAGCAGG + Intergenic
1069117714 10:64528502-64528524 ACATCTTACATGGCTGGAGCAGG - Intergenic
1069422949 10:68262875-68262897 ACGTCTTACATGGCTGGAGCAGG - Intergenic
1069435428 10:68377711-68377733 AAATCCTAGATGGCCAAAGAAGG - Intronic
1069505875 10:68997456-68997478 ACATTCTACATGGCTGGAGTAGG - Intronic
1070324304 10:75377963-75377985 ACATCTTACATGGCCAGAACAGG + Intergenic
1070694794 10:78554095-78554117 ACGTCTTACATGGCCCAAGCAGG - Intergenic
1070852149 10:79573757-79573779 ACATCCTCCTAGACTAAAGCAGG + Intergenic
1071725981 10:88198695-88198717 GCATGCTACATGGCTGGAGCAGG - Intergenic
1071789202 10:88936588-88936610 ACACCTCACATGGCAAAAGCAGG - Intronic
1071947417 10:90661528-90661550 ACATCTTACCTGGATGAAGCAGG + Intergenic
1072276894 10:93832690-93832712 ACCTCTTACATGGCCAGAGCAGG + Intergenic
1072417101 10:95258048-95258070 ACATCTTACATGGATGGAGCAGG + Intronic
1072883395 10:99250193-99250215 ACATCTTACATGGCTGGAGCAGG - Intergenic
1073567047 10:104543903-104543925 ACATCTTACATGGCCAGAGCAGG + Intergenic
1073952576 10:108828417-108828439 ACATCTTACATGGCCAAAGCAGG + Intergenic
1073980454 10:109147872-109147894 ATGTCCTACATGGCTGGAGCAGG + Intergenic
1074258866 10:111831996-111832018 ACATCTTACATGGCCAGAGAAGG + Intergenic
1074728567 10:116342834-116342856 ACATCTTACATGGCCAGAGCAGG - Intronic
1075006920 10:118837724-118837746 ACAACCTACATGGCTGGAGCAGG + Intergenic
1075043684 10:119128764-119128786 ACGTCTTACATGGCTGGAGCAGG + Intronic
1075595103 10:123723615-123723637 ACATCATGCATGGCTGAATCTGG - Intronic
1075685327 10:124360962-124360984 ACATCTTACATGGCCAGAGCAGG - Intergenic
1076176356 10:128371085-128371107 ACATCTTACATGGCTGGAACAGG + Intergenic
1078697459 11:13648749-13648771 ACATCTTACATGGCCAGAGCAGG - Intergenic
1078750339 11:14155431-14155453 ATGTCCTACATGGCTGGAGCAGG + Intronic
1078892874 11:15573163-15573185 ACATCTTACATGGCCAGAGCAGG - Intergenic
1078936314 11:15953957-15953979 ACACCACACATGGCAAAAGCAGG + Intergenic
1079120141 11:17677097-17677119 ACATCTTACATGGCCAGAGAAGG + Intergenic
1079538227 11:21540624-21540646 ATGTCCTACATGGCTGGAGCTGG + Intronic
1079709219 11:23660692-23660714 ACACCCTACATGGCTGGAGTAGG - Intergenic
1079771044 11:24460378-24460400 ACATCTTACATGGCCAGAACAGG + Intergenic
1079783384 11:24638546-24638568 ATTTACTACATGGCTAAAGCAGG + Intronic
1079992026 11:27256251-27256273 ACATATTACATGGCTGGAGCAGG + Intergenic
1079992349 11:27259528-27259550 ACATCTTACATGGCCAGAACAGG + Intergenic
1080061095 11:27957653-27957675 ACGTCTTACATGGCTAGAACAGG + Intergenic
1080236842 11:30079757-30079779 ACATCCTATATGGCCAGAGCAGG - Intergenic
1080714176 11:34782469-34782491 TCATACTACATGGACAAAGCTGG - Intergenic
1080929086 11:36788548-36788570 ACATCTTACGTGGCTGAAGCAGG - Intergenic
1080946547 11:36980731-36980753 ACATCTTACATGGCTAGAGCAGG + Intergenic
1081441338 11:43084933-43084955 ACATCCTACATGGCTGGACCAGG + Intergenic
1081441615 11:43086941-43086963 ACATCCTATATGGCTGGAGCAGG + Intergenic
1081780741 11:45710155-45710177 ACATCCAAAATGGCTACAGTAGG - Intergenic
1082570208 11:54729069-54729091 ACATCTTACATGGCAGGAGCAGG + Intergenic
1083385894 11:62310140-62310162 GCATCTTACATGGCAAGAGCAGG + Intergenic
1084776266 11:71378707-71378729 ACATCTTACATGGCTGGAGCAGG - Intergenic
1085418531 11:76336063-76336085 ACATCTTACATGGCTGTAGCAGG - Intergenic
1085665174 11:78408811-78408833 ACATCTTACATGGCTGGAGCAGG - Intronic
1086365787 11:86109274-86109296 ACATCTTACATGGCCAGAGCAGG + Intergenic
1086794755 11:91085600-91085622 ACGTCTTACATGGCCAGAGCAGG - Intergenic
1087433222 11:98080035-98080057 ACATCTTACATGGCCAGAGCAGG - Intergenic
1087595007 11:100242553-100242575 ACATCTTACATGGCCAGAGCAGG + Intronic
1087646552 11:100814641-100814663 ACATCTTACATGGCACAAACTGG + Intronic
1087699611 11:101420880-101420902 ACATTTTACATGGCTGGAGCAGG + Intergenic
1087889309 11:103518592-103518614 ACATCTTACATGGCCAGAGCAGG + Intergenic
1088180601 11:107104644-107104666 ACATCTTACATGGCTGGAGCAGG + Intergenic
1088460185 11:110074772-110074794 ATATCTTACATGGCAAGAGCAGG + Intergenic
1088644442 11:111905725-111905747 ACATCTTACATGGCTGGAGCAGG - Intergenic
1089747777 11:120629088-120629110 ACACCCTCCATGGCTACACCAGG - Intronic
1090098505 11:123768638-123768660 ACATCTTACATGACCAGAGCAGG - Intergenic
1091420677 12:337145-337167 ACGTCTTACATGGCCAGAGCAGG - Intronic
1091842711 12:3632169-3632191 ACATCTTACATGGCCAGAGCAGG - Intronic
1092876093 12:12849199-12849221 GCATCTTACATGGCAGAAGCAGG - Intergenic
1093425031 12:19019144-19019166 ACATCTTACATGGCTGAAGCAGG + Intergenic
1093718874 12:22414768-22414790 ACATCCTACATGGGTAGAACAGG + Intronic
1094043318 12:26140680-26140702 ACGTCCTACATGGCCGTAGCAGG - Intronic
1094322887 12:29204745-29204767 ACATCTTACATGGCCAGAGCAGG + Intronic
1094393023 12:29973635-29973657 ATGTCCTACATGGCTAGAGCAGG - Intergenic
1097139156 12:56885348-56885370 ACATCTTACATGGCTGGAGAAGG - Intergenic
1097139422 12:56887376-56887398 ACATCTTACATGGCCAGAGAAGG - Intergenic
1097331887 12:58340160-58340182 ATGTCCTACATGGCTGGAGCAGG + Intergenic
1097622726 12:61961116-61961138 ACATCTTACATGGCCAGAGAAGG + Intronic
1097699596 12:62806659-62806681 ACATCTTACATGGCCAGAGAAGG - Intronic
1098130801 12:67347971-67347993 ACATCTTACATGGCTGGAGGAGG + Intergenic
1098391107 12:69970931-69970953 GCATCTTACATGGCCAGAGCAGG - Intergenic
1099283980 12:80692126-80692148 ATATCCCACAGGGCTGAAGCAGG + Intergenic
1099816773 12:87658909-87658931 ATATCTTACATGGCTGAAGCTGG - Intergenic
1099972451 12:89514244-89514266 ACATCTTACATGGCCAGAGCTGG - Intronic
1100026618 12:90136709-90136731 ACATCTTACATGGCAGGAGCAGG + Intergenic
1100123267 12:91393886-91393908 GCATCTTACATGGCAGAAGCAGG - Intergenic
1100153772 12:91773088-91773110 ACATCTTACATGGCTGGAACAGG + Intergenic
1100222036 12:92515820-92515842 GCATCTTACATGGCAGAAGCAGG + Intergenic
1100334654 12:93618125-93618147 ACATCTTACATGGCCAGAGCAGG - Intergenic
1100675424 12:96861369-96861391 ACATCCTACAAGGCACAAGACGG + Intronic
1100692715 12:97056094-97056116 ACATCTTACATGGCTAGAGCAGG + Intergenic
1100910098 12:99350186-99350208 ACATCTTACAGGGCCAGAGCAGG - Intronic
1101076920 12:101139896-101139918 ACATCTTACATGGCTGGAGCAGG + Intergenic
1101429313 12:104613590-104613612 ACATCTTACATGGCCAGAGCAGG - Intronic
1101629824 12:106482477-106482499 ACATCTTACACGGCCAGAGCAGG + Intronic
1101817986 12:108160493-108160515 TCATCTTACATGGCCAAAGCAGG + Intronic
1102567605 12:113807190-113807212 ACATCTTACGTGGCCAGAGCAGG + Intergenic
1102757953 12:115358611-115358633 ACATCTTACATGCCCAGAGCAGG - Intergenic
1103470565 12:121176950-121176972 ACACCCTGCACGGCTGAAGCAGG + Intronic
1104099122 12:125589660-125589682 ACATCTTACATGGCAGGAGCAGG + Intronic
1104127061 12:125857931-125857953 ACATCTTACATGGCTGGAGCAGG - Intergenic
1104263130 12:127203706-127203728 ACATCTTACATGGCTGGAGCAGG + Intergenic
1104311565 12:127657913-127657935 ACATCAGACATGGCAAGAGCAGG - Intergenic
1104318331 12:127724937-127724959 ACATCTCACATGGCCAGAGCAGG - Intergenic
1104370717 12:128221681-128221703 ACGTCGTACATGGCTGGAGCAGG - Intergenic
1105219769 13:18314623-18314645 ACGCCTTACATGGCCAAAGCAGG - Intergenic
1105647536 13:22337685-22337707 ACATCCTACATGGCCAGAGCAGG - Intergenic
1105647854 13:22340008-22340030 ACATCCTACATGGCTGGATCAGG - Intergenic
1106220692 13:27744124-27744146 ACATCTTACATGGCTGGAGAAGG - Intergenic
1106229678 13:27812201-27812223 ACACCCTACCTGGCTAGTGCAGG - Intergenic
1107226225 13:38050786-38050808 ACATCTTACATGACAGAAGCAGG - Intergenic
1107499396 13:40957573-40957595 ACATCCTACATGGCTGGAGCAGG - Intronic
1107509827 13:41072449-41072471 ACATCTTACATGGCCAGACCAGG + Intronic
1107511885 13:41093493-41093515 ACATCTTACATGGTTAGAGCAGG - Intergenic
1107533632 13:41307661-41307683 ACATCCTACATGGCTGGAGCAGG - Intergenic
1107907386 13:45073920-45073942 ACATCTTACATGGCTGGAGCAGG + Intergenic
1107956722 13:45521235-45521257 ACATGCTACATGCGTATAGCAGG + Intronic
1108271024 13:48759791-48759813 ACTTCTTACAAGGCTAGAGCAGG + Intergenic
1108513548 13:51175939-51175961 ACGTTTTACATGGCTAGAGCAGG - Intergenic
1108730310 13:53228517-53228539 ACATCCAAAATGGCTAAACAGGG - Intergenic
1108754649 13:53485220-53485242 ATATCTTACATGGCTGGAGCAGG - Intergenic
1108924052 13:55715981-55716003 ACAGCCCACATAGCCAAAGCAGG - Intergenic
1108956539 13:56165865-56165887 TCCTCTTACATGGCCAAAGCAGG + Intergenic
1108981923 13:56524661-56524683 ACATTCTATATGGCTGCAGCAGG + Intergenic
1109139707 13:58699312-58699334 ACATCTTACATGGCCAGAGCAGG + Intergenic
1109238509 13:59853519-59853541 ACATCTTACATGGCTGGAGAAGG - Intronic
1109245925 13:59954761-59954783 ACATCCTATATGACTGAAGCAGG + Intronic
1109992877 13:70082080-70082102 ACATCCTCCATGACTGGAGCAGG - Intronic
1109995044 13:70112094-70112116 ACGTCCTACGTGGCTGGAGCAGG + Intergenic
1110379913 13:74838906-74838928 ACATCCTACATGGCTGGAGCAGG + Intergenic
1110666973 13:78128274-78128296 ACATCTTACATGGCCGGAGCAGG + Intergenic
1110868277 13:80422025-80422047 ACATTCTACATGGCCAGAGCAGG + Intergenic
1110868706 13:80425145-80425167 ACATCTTACATGGCCAGAGCAGG + Intergenic
1110895452 13:80745456-80745478 ATGTCCTACATGGCTGGAGCAGG - Intergenic
1110909227 13:80934328-80934350 ACATCTTACATGGCTGGAGCAGG + Intergenic
1110917699 13:81044060-81044082 ACGTCTTACATGACCAAAGCAGG + Intergenic
1111175912 13:84596098-84596120 ACATCCTACTTGGCTGGAGCAGG - Intergenic
1111243388 13:85504760-85504782 ACATCTTACATGTCCACAGCAGG + Intergenic
1111509681 13:89244308-89244330 ACATCTTACATGTCCAGAGCAGG - Intergenic
1111668860 13:91303228-91303250 ACATTTTACATGGCCAGAGCAGG + Intergenic
1111753186 13:92359698-92359720 ACATCTTACATGGCTGAAGCAGG + Intronic
1112238413 13:97657246-97657268 ACATCTCACATGGCCAGAGCAGG - Intergenic
1112827934 13:103413641-103413663 ACATCTTACATGGCTGGAGCAGG - Intergenic
1113343194 13:109447001-109447023 ATATCTTACATGGCAAGAGCAGG + Intergenic
1113346815 13:109486209-109486231 ATGTCCTACATGGCTGGAGCAGG - Intergenic
1113360721 13:109628979-109629001 ACCTCCTACATGACTGGAGCAGG - Intergenic
1113606340 13:111610263-111610285 GCATCTTACATGGCCAGAGCAGG - Intronic
1113987284 13:114328249-114328271 ATATCCAACATGGCTGGAGCAGG - Intergenic
1114068311 14:19085867-19085889 ACGCCTTACATGGCTGAAGCAGG - Intergenic
1114093953 14:19314158-19314180 ACGCCTTACATGGCTGAAGCAGG + Intergenic
1114576684 14:23720987-23721009 ACATCTTACATGGCCAGAGCAGG + Intergenic
1115035865 14:28855600-28855622 ACATCTTACATGCCTGGAGCGGG - Intergenic
1116072505 14:40066770-40066792 ACATCTTACATGGCTGAAGCAGG + Intergenic
1116681510 14:47976303-47976325 ACATCTCACATGGCAAGAGCTGG + Intergenic
1116739494 14:48736125-48736147 ACATCTTACATGGACAGAGCAGG + Intergenic
1118188669 14:63560436-63560458 ACGTCTTACATGGCCAGAGCAGG - Intergenic
1118201668 14:63679851-63679873 ACATCTTACATAGCTGGAGCAGG + Intergenic
1118517145 14:66543007-66543029 ACATTTTACATGGCCAGAGCTGG + Intronic
1118851026 14:69583661-69583683 ACGTCTTACATGGCTGGAGCAGG - Intergenic
1119025566 14:71149552-71149574 ACGTCTTACATGGATGAAGCAGG - Intergenic
1119037939 14:71246374-71246396 ACATCTTACAGGGCTGGAGCAGG - Intergenic
1119929107 14:78527330-78527352 ACATCTTACATGGCTGGAGCAGG + Intronic
1120203073 14:81559604-81559626 ACATCTTACATGGCTGGAGGAGG + Intergenic
1120211711 14:81640222-81640244 ACATCTTACATGGCCAGAGTAGG + Intergenic
1120268322 14:82278384-82278406 ACATCTTACATGGCCAAAGCAGG - Intergenic
1120290960 14:82570049-82570071 CCGTCCTACATGGCTGGAGCAGG - Intergenic
1120375084 14:83694818-83694840 ACATCTTACATGGCTGAAGCGGG + Intergenic
1120691539 14:87598632-87598654 ACATCTTACATGGCCAGAGAAGG + Intergenic
1120719416 14:87874314-87874336 ACAGCCTACATGGCTGAGACAGG + Intronic
1120767079 14:88338068-88338090 ACATCCTACATGGCCAGAGAAGG - Intergenic
1120825831 14:88954331-88954353 ACTTCTCACATGGCCAAAGCAGG + Intergenic
1120840870 14:89083808-89083830 ACGTCCTACATGGCCAGAGCAGG - Intergenic
1120915087 14:89703463-89703485 ACATCCTACATGGCCAGGGCAGG + Intergenic
1121208663 14:92190096-92190118 ACGTCTTACATGGCTGGAGCAGG + Intergenic
1121383336 14:93493825-93493847 ACGTCTTACATGGCTGGAGCAGG + Intronic
1121894973 14:97638320-97638342 ATATTTTACATGGCTGAAGCAGG - Intergenic
1122039878 14:98979575-98979597 ATATCTTACATGGCCGAAGCAGG - Intergenic
1122045510 14:99020460-99020482 ATGTCCTACATGGCTGGAGCAGG + Intergenic
1122257197 14:100487269-100487291 ATCTCCTACATGTCTAATGCAGG - Intronic
1123411196 15:20061234-20061256 ACCTCTTCCATGGCTGAAGCAGG - Intergenic
1123520542 15:21068345-21068367 ACCTCTTCCATGGCTGAAGCAGG - Intergenic
1123826869 15:24091473-24091495 ACATCTTACATGGCTAGAGAAGG + Intergenic
1124389208 15:29238760-29238782 ACGTCTTACATGGCCAGAGCAGG + Intronic
1124608300 15:31188682-31188704 ACATCTTACATGGCTGGAACAGG - Intergenic
1125281579 15:38047530-38047552 TCATCCTACATGGCTGAAGCAGG + Intergenic
1125290008 15:38136000-38136022 ACATTTTACATGGCCAGAGCAGG + Intergenic
1125407521 15:39369237-39369259 ACGTCTTACATGGCTGGAGCAGG + Intergenic
1125407938 15:39372372-39372394 ACATCTTTCATGGCCAAAGCAGG + Intergenic
1125447691 15:39775722-39775744 ACATCCTACATGGTTGGAGCAGG - Intronic
1125856365 15:42953636-42953658 ACATCCTACAGAGGAAAAGCTGG + Intronic
1126120279 15:45245536-45245558 TCATCTTACATGGCCAGAGCAGG + Intergenic
1126488642 15:49211703-49211725 ACGCCGTACATGGCTAGAGCAGG + Intronic
1126522804 15:49615551-49615573 GCGTCCTACATGGCTGGAGCAGG - Intronic
1126562990 15:50064824-50064846 ACATCTTACACGGTTGAAGCAGG + Intronic
1127196481 15:56591449-56591471 ACATCTTACATGGCTGCAGCAGG + Intergenic
1127197531 15:56605669-56605691 ACATCCTACATGCCTGGAACAGG + Intergenic
1127756697 15:62099408-62099430 ACATCCTTCATGGCTTAAAATGG - Intergenic
1128474217 15:67983284-67983306 ACATCTTACATGGCTGGAGCAGG - Intergenic
1128826258 15:70720131-70720153 ATATCTTACATGGCTGGAGCAGG - Intronic
1129173645 15:73823578-73823600 CCATCTTACATGGCAAAAGTGGG + Intergenic
1129529697 15:76254313-76254335 ACCTCATACATGCCTAATGCGGG - Intronic
1129636559 15:77324687-77324709 GCATCACACATGGCAAAAGCAGG + Intronic
1129715522 15:77846361-77846383 ACATCTTACGTGGCTGGAGCAGG - Intergenic
1130068782 15:80629034-80629056 ATGTCCTACATGGCTGGAGCAGG + Intergenic
1130359269 15:83166756-83166778 ACATCTTACATGTCCAGAGCAGG + Intronic
1130923893 15:88370990-88371012 ACATTTTACATGGCTGGAGCAGG - Intergenic
1131546022 15:93316139-93316161 ACATCTTACATGGCTGGAGCAGG - Intergenic
1131665206 15:94564247-94564269 ACATCTTACATGGCCAGAGCAGG + Intergenic
1131678123 15:94692410-94692432 ACATCTTACATGGCAGGAGCAGG - Intergenic
1131749749 15:95493752-95493774 ACATCCCACATGGCCAGACCAGG + Intergenic
1132034915 15:98474421-98474443 ACATCTTACATGGCCAGAGCAGG + Intronic
1132210515 15:100018554-100018576 ACTTCCTACCTGGCTGGAGCAGG - Intronic
1132260863 15:100423781-100423803 ACATCTTACATGGCTGGAGTAGG - Intronic
1132773795 16:1580480-1580502 ACATCCTACATAGCCGGAGCAGG - Intronic
1133436479 16:5784453-5784475 ACATCTTACATGGCCAGAGCAGG + Intergenic
1133496638 16:6324504-6324526 ACATCTTACATGGCCAGAGCAGG + Intronic
1133676579 16:8079037-8079059 ACATCTTACATGGCTGGAGCAGG - Intergenic
1133748031 16:8702211-8702233 GCATCTTACATGGCCAGAGCAGG + Intronic
1134527904 16:14958373-14958395 ACATCTTACATAGCTGGAGCAGG - Intergenic
1134570712 16:15288572-15288594 ACATACTACGTGGCTTAAACAGG - Intergenic
1134731670 16:16467502-16467524 ACATACTACGTGGCTTAAACAGG + Intergenic
1134935780 16:18244501-18244523 ACATACTACGTGGCTTAAACAGG - Intergenic
1136695213 16:32073889-32073911 ATGTCCTACATGGCTGGAGCAGG - Intergenic
1136795712 16:33017147-33017169 ATGTCCTACATGGCTGGAGCAGG - Intergenic
1136874209 16:33837233-33837255 ATGTCCTACATGGCTGGAGCAGG + Intergenic
1138958184 16:61996774-61996796 ACTTGCTACATTGCCAAAGCTGG + Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140856045 16:78978671-78978693 ACATCTTACATCGCCAGAGCAGG + Intronic
1141906743 16:87031699-87031721 ATATCTTACATGGCTGGAGCAGG - Intergenic
1142280900 16:89147104-89147126 ACATCCTACATGGCCGGAGCAGG + Intronic
1203097970 16_KI270728v1_random:1278806-1278828 ATGTCCTACATGGCTGGAGCAGG - Intergenic
1143455781 17:7066779-7066801 GCATCTTACATGGCTGAAGCAGG + Intergenic
1143456116 17:7069110-7069132 ACATCTTACATGGCCGAAGCAGG + Intergenic
1143805398 17:9421947-9421969 ACGTCCTACATGGCCGGAGCAGG - Intronic
1143916114 17:10294685-10294707 ATGTCTTACATGGCTGAAGCAGG + Intergenic
1144009259 17:11130496-11130518 ACGTCTTACATGGCTGAAACAGG + Intergenic
1144358405 17:14468148-14468170 ACGTCTTACATGGTTAGAGCAGG + Intergenic
1144401496 17:14907376-14907398 ACATCTTACGTGGCCAGAGCAGG + Intergenic
1144550906 17:16240186-16240208 GCATCCTACATGGCAGAGGCAGG - Intronic
1145930978 17:28685286-28685308 ACACCCTGAAAGGCTAAAGCAGG - Intronic
1146681128 17:34809132-34809154 GCATCCAACATGGCTGGAGCAGG - Intergenic
1146734893 17:35230337-35230359 ACATCCTACATGGCTGGAGCAGG + Intergenic
1148897612 17:50848867-50848889 ACGTCTTACATGGCTAGAGCAGG + Intergenic
1148976814 17:51536919-51536941 ACGTCCTACATGACTGGAGCAGG - Intergenic
1149140736 17:53429443-53429465 ATGTCTTACATGGCTAGAGCAGG - Intergenic
1149342526 17:55701340-55701362 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1150004253 17:61460065-61460087 GCTTCCTAGATGGCTAGAGCTGG + Intronic
1150526401 17:65927183-65927205 GCACCTTACATGGCAAAAGCAGG - Intronic
1150862142 17:68811659-68811681 ACATCTTACATGGCTGGAGCAGG - Intergenic
1151018128 17:70580658-70580680 ACATCTTACATGGCTGGAGCAGG - Intergenic
1151040899 17:70860262-70860284 ACATCTTACATGGCTGCAGGAGG + Intergenic
1151126576 17:71851867-71851889 ACGTCTTACATGGCTGAAGCAGG - Intergenic
1151432726 17:74075139-74075161 ACGTCTTACATGGCTGGAGCAGG + Intergenic
1151905257 17:77043898-77043920 ACATCTTACATGGCAGGAGCAGG + Intergenic
1152674509 17:81631603-81631625 TCATCCTCCTTGTCTAAAGCAGG - Intronic
1153170223 18:2307888-2307910 ACACATCACATGGCTAAAGCAGG - Intergenic
1153439332 18:5099627-5099649 ACATCTTACATGGCTGGAGCAGG - Intergenic
1153461485 18:5338691-5338713 ACATATTACATGGCCAGAGCAGG - Intergenic
1153780243 18:8488658-8488680 ACATCTTACATGGCCAGAGCAGG - Intergenic
1154253539 18:12764319-12764341 ACGTCCTACATGGCTGGAGCTGG - Intergenic
1154946488 18:21166709-21166731 GCACCTTACATGGCGAAAGCAGG - Intergenic
1155466971 18:26146965-26146987 ACATCTCACATGGCCAGAGCAGG + Intronic
1155707694 18:28837278-28837300 ACATTTTACATGGCTGGAGCAGG + Intergenic
1155812739 18:30258937-30258959 ACATCCTACATGGCTGGAGCAGG - Intergenic
1156046667 18:32885197-32885219 ACATCTTACATGGTCAGAGCAGG - Intergenic
1156131756 18:33984609-33984631 ACGTCTTACATGGCCAGAGCAGG - Intronic
1156151722 18:34251051-34251073 ATATCTTACATGGCCAAAGCAGG + Intergenic
1156224620 18:35091997-35092019 ACATCTTACGTGGCTGGAGCAGG + Intronic
1156250868 18:35351561-35351583 ACATCTTACATGGCTGGAGCAGG - Intergenic
1156251166 18:35353575-35353597 ACCTCTTACATGGCTGGAGCAGG - Intergenic
1156406861 18:36791121-36791143 ACATCTTACATGGCTGGAGGAGG - Intronic
1156426103 18:37014633-37014655 ACATCTTAAATGGCCAGAGCAGG + Intronic
1156643537 18:39131588-39131610 ACATCCTACATGGCTGGAGCAGG + Intergenic
1156807075 18:41197526-41197548 ACATCTTACATGGCTGGAGCAGG - Intergenic
1156814952 18:41298497-41298519 ACGTCTTACATGGCAAGAGCAGG - Intergenic
1156959018 18:43000724-43000746 ACATCTTACATGGCTGCAGGGGG - Intronic
1157817709 18:50742117-50742139 ACATCTCACATGGCAAGAGCAGG + Intergenic
1157822787 18:50786025-50786047 ACATCTTACAAGGCTAGGGCAGG - Intergenic
1158497404 18:57968903-57968925 ACATCCTACACAGCTGGAGCAGG - Intergenic
1158769261 18:60494966-60494988 ACATTCTACATGGCTGGAGCAGG + Intergenic
1159071239 18:63625968-63625990 ATGTCCTACATGACTAAAGCAGG + Intergenic
1159149812 18:64506056-64506078 ACATCTTACATGGCTGGAGCAGG - Intergenic
1159866168 18:73707881-73707903 TCATCTTACATGGCCAGAGCAGG + Intergenic
1159873464 18:73784970-73784992 ACATCTTACACGGCCATAGCAGG + Intergenic
1159898601 18:74021034-74021056 ACATCTTACATGGCCAGAGCAGG + Intergenic
1160375392 18:78407587-78407609 ACATCCAGGATGGCAAAAGCAGG + Intergenic
1160396124 18:78573370-78573392 ACATCTTACATGGCCTGAGCAGG - Intergenic
1160626012 18:80205620-80205642 GCATCCTACATGGCAGGAGCAGG - Intronic
1163054637 19:14709114-14709136 ACGTGCTACATGGCTGGAGCAGG - Intronic
1166239113 19:41477726-41477748 TCATCCTCCATGGCCAGAGCTGG - Intergenic
1167985012 19:53307266-53307288 ACATTTCACATGGCAAAAGCAGG - Intergenic
925101856 2:1253826-1253848 ACATCTTACATGGCCAGAGAAGG + Intronic
925248025 2:2402168-2402190 ACATCTTACCTGGCTGGAGCAGG + Intergenic
925285381 2:2712311-2712333 ACTTCCGACCTGGCTGAAGCAGG - Intergenic
925482473 2:4291612-4291634 GCATCTTACATGGCAAGAGCAGG - Intergenic
925644386 2:6021005-6021027 ACATCTTACATGGCCAAGGCAGG - Intergenic
925653434 2:6117498-6117520 ACATCTTACATGGCCAGAGAAGG - Intergenic
925929861 2:8698306-8698328 ACATCCTATATGGCTGGAGCAGG - Intergenic
926096781 2:10086428-10086450 ACATCCTACATGGCTAAAGCAGG - Intergenic
926099423 2:10104812-10104834 ACATCCTGCCTGGCTGGAGCAGG + Intergenic
926208267 2:10849391-10849413 ACATCCTACAAGGCTGGAGCAGG + Intronic
926221592 2:10939442-10939464 ACATCTTACATGGCCAGAGCAGG + Intergenic
926373658 2:12205308-12205330 ACGTCCTACATGGCTGGAGGAGG - Intergenic
926545849 2:14238816-14238838 ACATCCTACATGGTCAGAGCAGG - Intergenic
927068845 2:19504082-19504104 ACGTCTTACATGGCCAGAGCAGG + Intergenic
927131951 2:20067845-20067867 ACATCTTACATGGCTGGAGCAGG - Intergenic
927218284 2:20682580-20682602 ACATCCTCCCTGGCAAAAGGTGG + Intergenic
927251462 2:20998238-20998260 ACAACCTACATGGCTGGAACAGG - Intergenic
927700972 2:25268715-25268737 ACAGCCTCCATGGGTAAAGGGGG - Intronic
927773372 2:25882975-25882997 AAATCCTAGATGGCTTAGGCTGG - Intergenic
928218193 2:29380051-29380073 ACATCCTACACGGCTAAAGCAGG + Intronic
929092334 2:38231556-38231578 ACATCCTCCATGGTTCCAGCTGG - Intergenic
929113319 2:38423478-38423500 ACATCTTACCTGGCCAGAGCAGG - Intergenic
929226919 2:39520887-39520909 ACATCTTACATGGCTGGAGAAGG + Intergenic
929227180 2:39522745-39522767 ACATCTTACATGGCTGGAGAAGG + Intergenic
930093398 2:47548060-47548082 ACGTCCTTCATGGCTGGAGCAGG - Intronic
930516337 2:52412137-52412159 ACATCTTATATGGCAAGAGCAGG - Intergenic
930568596 2:53055507-53055529 ACATCTTACATGACCACAGCAGG - Intergenic
930841649 2:55853979-55854001 ACGTCCTACATGGCTGGAGCAGG + Intergenic
931283574 2:60814419-60814441 AAATCCTTTATGGCTAAAGCAGG - Intergenic
931378368 2:61728925-61728947 ACATCTTACATGGCTGGAGCAGG + Intergenic
931534059 2:63252325-63252347 TCATACTAAATGGCAAAAGCTGG + Intronic
932065141 2:68549115-68549137 AAATTCTACATGGCAAAAGATGG + Intronic
932224248 2:70026948-70026970 ACATACTACAAAGCTATAGCAGG + Intergenic
932879644 2:75489258-75489280 ACATCCTACATGGCGGGAGCAGG + Intronic
933046302 2:77540941-77540963 ACATCTTACATGGCCAGAGCAGG - Intronic
933283614 2:80359577-80359599 ACATCTTACATGGCCAGAGCAGG - Intronic
933428274 2:82141201-82141223 ACATCCTACATGGCCAGAGCAGG - Intergenic
933464174 2:82629856-82629878 ATATCTTACATGGCTAGAGCAGG - Intergenic
933850714 2:86364535-86364557 ACATATTACATGGCCAGAGCAGG + Intergenic
934546798 2:95224508-95224530 TCATCTTACATGGCCAGAGCAGG + Intronic
935140620 2:100350012-100350034 ACATCTTACATGGCCAGAGAAGG - Intergenic
935265798 2:101392847-101392869 ACATCTTACATGGCTGGAGCAGG - Intergenic
935491372 2:103724519-103724541 AAATCTTTCATGGCTAGAGCAGG - Intergenic
935798602 2:106670155-106670177 ATATCCTACATGGCCAGAGCAGG - Intergenic
935798868 2:106672174-106672196 ATTTCTTACATGGCCAAAGCAGG - Intergenic
936696758 2:114959373-114959395 ACATGCTACATGGATGAACCTGG - Intronic
937075717 2:119104859-119104881 ACATCTTACATGGCCACAGAAGG - Intergenic
937328564 2:121007288-121007310 ACATAATACATGGCTGGAGCAGG + Intergenic
937447030 2:121967110-121967132 ACATCTTACATGGCTGGAGCAGG + Intergenic
937740594 2:125347903-125347925 ACGTCTCACATGGCTCAAGCAGG - Intergenic
938300512 2:130208005-130208027 ACATCTTACATGGCCAGAGCAGG + Intergenic
938456215 2:131466466-131466488 ACATCTTACATGGCCAGAGCAGG - Intronic
938600051 2:132828454-132828476 ATGTCCTACATGGCTGGAGCAGG - Intronic
938624229 2:133091080-133091102 ACATCTTACATGGCCAGAGCAGG - Intronic
939195280 2:138963576-138963598 ACATCTTACATGGCCAGAGTAGG - Intergenic
939367926 2:141258791-141258813 ACGTCTTACATGGCCAGAGCAGG - Intronic
939475887 2:142686134-142686156 ACATCTTACGTGGCTGGAGCAGG - Intergenic
939501261 2:142987925-142987947 ACATCTTTCATGGCCAGAGCAGG - Intronic
939588621 2:144035190-144035212 ACATCCTACATGACTGAAGCAGG - Intronic
940086128 2:149861179-149861201 ATGTCCTACATGGCTGGAGCAGG + Intergenic
940121791 2:150275919-150275941 ACATCTTACATGGCCAGAGTAGG + Intergenic
940449965 2:153824847-153824869 ACATCTTACACGGCTGGAGCAGG - Intergenic
940826134 2:158415242-158415264 ACATTCTACATGGCTGGAGCAGG + Intronic
940826371 2:158416984-158417006 ACATTCTACATGGCTGGAGCAGG + Intronic
941245687 2:163093270-163093292 ACAAGCTACTTGGTTAAAGCAGG + Intergenic
941597989 2:167502573-167502595 ACATCTTAAATGGCTGGAGCAGG + Intergenic
941701017 2:168604711-168604733 ACATCTTACGTGGCCAAAGCAGG - Intronic
941701331 2:168606897-168606919 ACATCTTACATGGCCAGAGCAGG - Intronic
942117309 2:172740745-172740767 ACATCCTCCAGGGCTCAGGCTGG + Intronic
942952712 2:181738999-181739021 ACATCTCACAAGGCTAGAGCAGG - Intergenic
943016994 2:182525561-182525583 ACATCTTACATGACCACAGCAGG - Intergenic
943104624 2:183529112-183529134 GCATCTTACATGGCAGAAGCTGG - Intergenic
943290467 2:186064711-186064733 ACATCCTACATGGCTGGAGCAGG - Intergenic
943304022 2:186237011-186237033 ACATCTTACCTGGCTGGAGCAGG - Intergenic
943375679 2:187073518-187073540 ACATCTTACATGACCAGAGCAGG - Intergenic
943486955 2:188496908-188496930 ACATCTTACATGGCCAGAGCAGG - Intronic
943558020 2:189428662-189428684 ACATCTTACATGGCAAAAGCAGG - Intergenic
943749779 2:191499417-191499439 ACATCTTACATGGAGACAGCAGG - Intergenic
943849151 2:192693810-192693832 ACTTACTACATGTCTAAACCAGG - Intergenic
945530065 2:210942190-210942212 ACATCCCACATGGCTGGAACAGG + Intergenic
945605283 2:211922108-211922130 ACATTCTACAAGGTTAATGCTGG - Intronic
945919195 2:215738058-215738080 ACGTCCTACATGCCTGGAGCAGG - Intergenic
946126322 2:217566210-217566232 ACATCTTGCATGGCTGGAGCAGG + Intronic
946714443 2:222538730-222538752 GCATCTTACATGGCCAGAGCAGG + Intronic
947274350 2:228373417-228373439 ACATCCTACATACCCAGAGCAGG + Intergenic
947965553 2:234278518-234278540 CCATCTTACATGGCCAGAGCAGG + Intergenic
948029964 2:234809446-234809468 ACATTTAACATGGCCAAAGCAGG + Intergenic
948097642 2:235349210-235349232 ACATCTTACGTGGCTGTAGCGGG - Intergenic
948221151 2:236270717-236270739 ACATCTTACATGGCAGGAGCAGG - Intergenic
948221442 2:236272864-236272886 ACATCTTACATGGCAGGAGCAGG - Intergenic
1168816585 20:741808-741830 ACGTTCTACATGGCTGGAGCGGG - Intergenic
1169164894 20:3414789-3414811 ACATCTTACATGGCTGGAGGAGG + Intergenic
1169165229 20:3417056-3417078 ACATCTTACATGGCTAGAGCAGG + Intergenic
1169212581 20:3775679-3775701 GCCTCCTACATGGCAAAGGCTGG + Intergenic
1169736768 20:8846167-8846189 ACTTCTTACATGGCTGGAGCAGG + Intronic
1169890148 20:10443871-10443893 ACATCCTACATGACTGGAGCAGG - Intronic
1170331023 20:15210781-15210803 ACATCTTACATGGCTGGAGCAGG - Intronic
1170941978 20:20855640-20855662 ACATCATACATGGCTGGAGCAGG + Intergenic
1171403709 20:24895542-24895564 ATGTCCTACATGGCTGGAGCAGG + Intergenic
1173386982 20:42597600-42597622 AAATCTTACATGGCCAGAGCAGG - Intronic
1174073932 20:47918749-47918771 ACATGCCACATGGCAAAAGCAGG - Intergenic
1174095107 20:48082609-48082631 ACATCTTACATGGCAGGAGCAGG + Intergenic
1174715640 20:52755065-52755087 ACATCTTACATGGCTGGAGCAGG + Intergenic
1174965437 20:55208696-55208718 ATATCCTACATGGATGGAGCAGG - Intergenic
1174981585 20:55401498-55401520 ACATCTTACATGGCTGGAGCAGG - Intergenic
1177067666 21:16461180-16461202 ACATCCTACGTGACTGAAGCAGG - Intergenic
1177214704 21:18113543-18113565 ACATCCCGCATGGCTGGAGCAGG + Intronic
1177298673 21:19211322-19211344 GCATCTCACATGGCTAGAGCAGG - Intergenic
1177397004 21:20549346-20549368 ACGTCTTACATGGCCAGAGCAGG - Intergenic
1177517556 21:22175418-22175440 ACATCCTACATGGCTGAAGTAGG - Intergenic
1177625800 21:23657636-23657658 ACATCTTACATGGCCAGAGTAGG + Intergenic
1177855936 21:26400074-26400096 ACATCTTACACGGCTGGAGCAGG - Intergenic
1177970587 21:27784711-27784733 ACATCCTACAGAGCTGGAGCAGG + Intergenic
1177997297 21:28117042-28117064 ACGTCTTACATGGCCAGAGCAGG + Intergenic
1178081933 21:29074968-29074990 ACATCCTACAAGGCTGGAGGAGG - Intergenic
1178234273 21:30823248-30823270 ACATCCTACATGGCTTGAGCAGG - Intergenic
1178638774 21:34329295-34329317 ACATCTTACATGGCTGGCGCAGG + Intergenic
1178683656 21:34694577-34694599 ACATCCTACATGGCTGGAGAAGG - Intronic
1178988869 21:37334804-37334826 AAGTCCTACATGGCTGGAGCAGG + Intergenic
1179096528 21:38321007-38321029 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1179237441 21:39560102-39560124 ACTTCTTACATGGCCAGAGCAGG - Intronic
1179945686 21:44672864-44672886 ATGTCCTACATGGCTGGAGCAGG - Intronic
1180204946 21:46254011-46254033 ATGTCTTACATGGCCAAAGCAGG - Intronic
1180486783 22:15808429-15808451 ACGCCTTACATGGCTGAAGCAGG - Intergenic
1180515385 22:16136806-16136828 ACATCCTTGATGGCGAAAACAGG + Intergenic
1180817377 22:18799514-18799536 ACGCCTTACATGGCCAAAGCAGG - Intergenic
1181203567 22:21233835-21233857 ACGCCTTACATGGCCAAAGCAGG - Intergenic
1181868619 22:25879845-25879867 ACATCCTACATGGCTGGAGCAGG + Intronic
1181896545 22:26113181-26113203 ATATCCTACATGGCTGGAGTGGG + Intergenic
1181905907 22:26196214-26196236 ACATCTTACATGGCCACAGCAGG - Intronic
1182402247 22:30087685-30087707 ACATCTTACATGGCCAAAGCAGG + Intronic
1182996291 22:34815946-34815968 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1184637709 22:45848227-45848249 ACGTCTTACATGGCTGGAGCAGG + Intergenic
1203223354 22_KI270731v1_random:61579-61601 ACGCCTTACATGGCCAAAGCAGG + Intergenic
1203267475 22_KI270734v1_random:25241-25263 ACGCCTTACATGGCCAAAGCAGG - Intergenic
949128287 3:471926-471948 ACCTCTTACATGGCTGGAGCAGG - Intergenic
949242108 3:1885810-1885832 ACATCCTACATGGCTGGAGTAGG + Intergenic
949404900 3:3703799-3703821 ACATCTTACATGGCTGGAGCAGG + Intronic
950827906 3:15844996-15845018 ATATCTTACATGGCTGGAGCAGG + Intronic
950955888 3:17053283-17053305 CCATCTTACATGGCTGGAGCAGG + Intronic
951271194 3:20626548-20626570 ACATCCTACATGGCTGGAGCAGG + Intergenic
951810016 3:26688580-26688602 ATATCTTACATGGCCAGAGCAGG + Intronic
952186833 3:30978647-30978669 ACATCCTACATGGCTGGAGTAGG - Intergenic
952255342 3:31690278-31690300 ACATCTTACATGGCCAGAGCAGG - Intronic
952346056 3:32486889-32486911 ACATCTTACATGGCCAGAGCAGG - Intronic
952637732 3:35552229-35552251 ACATCTTACATGGCCAGAGCAGG + Intergenic
953400925 3:42616062-42616084 ACATCGTTAATGGGTAAAGCAGG - Intronic
953525768 3:43689002-43689024 GCATCTTACATGACTAGAGCAGG + Intronic
954452688 3:50580242-50580264 GCATGCTACAGGGCTAAAGGGGG - Intronic
955811856 3:62799308-62799330 ACAGGCTACATGGCTAACACTGG - Intronic
956732883 3:72213218-72213240 ACGTCTTACATGGCTGTAGCAGG + Intergenic
957018807 3:75100940-75100962 ATGTCCTACATGGCTAGAGAAGG - Intergenic
957019450 3:75108555-75108577 ACATCTTACATGGCCACAGCAGG + Intergenic
957207597 3:77217493-77217515 AAATGTTACATGGCTAAATCAGG - Intronic
957293547 3:78307550-78307572 ACGTCTTACATGGCCAGAGCAGG - Intergenic
957698177 3:83671573-83671595 ATATCTTACATGGCAAGAGCAGG - Intergenic
957931368 3:86882362-86882384 TCATCTCACATGGCCAAAGCAGG + Intergenic
958114723 3:89201154-89201176 ATATCCTACATGGCTGGAGCAGG + Intronic
958163563 3:89849757-89849779 ACGTCTTACCTGGCCAAAGCAGG - Intergenic
958560634 3:95743990-95744012 ACAGCCTACATGGCTGGAGCAGG + Intergenic
958567778 3:95836693-95836715 ACCTCCTACATGTCTGGAGCAGG + Intergenic
959064475 3:101642674-101642696 ACATCTTACATGGCCGGAGCAGG - Intergenic
959149344 3:102590191-102590213 ATGTCTTTCATGGCTAAAGCAGG - Intergenic
959237226 3:103740338-103740360 ACTTCCTACATGGCTGGAGCAGG + Intergenic
959369521 3:105505330-105505352 ACATCTTACATGGCCAGAGAAGG + Intronic
959696501 3:109254237-109254259 ACGTCTTACATGGCCAGAGCAGG - Intergenic
960027299 3:113023740-113023762 ACATCTTACATGGCCAGAGAAGG - Intergenic
960462340 3:117951830-117951852 ACATCCTACATGCCTGGATCAGG - Intergenic
960507791 3:118514341-118514363 ACATCCTCCATGGCTAGGGGAGG + Intergenic
960563704 3:119112962-119112984 ATGTCCTACATGGCTAGAGAAGG + Intronic
960563994 3:119114951-119114973 ATGTCCTACATGGCTGGAGCAGG + Intronic
961242795 3:125426768-125426790 ACATCTTACATGGCCAGAGCAGG + Intergenic
961338929 3:126204307-126204329 ACATCTTACATGGCCAGAGAAGG + Intergenic
961586735 3:127934844-127934866 ACATCCCAGATGACTAAAGATGG + Intronic
961954606 3:130788556-130788578 ACATCTTACATGGCCAGAGCAGG + Intergenic
962871051 3:139493502-139493524 ACATCTTACATGGCCAGAGAAGG - Intergenic
963795507 3:149627321-149627343 ACACCCTACATGGCTGAAAATGG - Intronic
964154273 3:153565250-153565272 ACATCTTACATGGCCAGAGAAGG - Intergenic
964173065 3:153793761-153793783 ACATCTTACATGGCAGGAGCAGG - Intergenic
964394311 3:156229287-156229309 ACAGCTTACATGGCCAGAGCAGG + Intronic
964718891 3:159752076-159752098 ACATTTTACATGGCCAAAGCAGG - Intronic
964817523 3:160732419-160732441 GCATCTTACATGACCAAAGCAGG - Intergenic
964919907 3:161884131-161884153 ACACCATATATGGCTAAAGCAGG - Intergenic
965193868 3:165568480-165568502 TCAGGCTACATGGCGAAAGCTGG - Intergenic
965209811 3:165770389-165770411 ACGTCCTACATGGATGGAGCAGG - Intergenic
965394908 3:168151732-168151754 ACATCTTACATAGCTGAAGCAGG - Intergenic
965756698 3:172034871-172034893 GCGTCCTACACGGCTGAAGCAGG + Intergenic
965891546 3:173520088-173520110 ACATTTTACATGGCCAAAGCAGG - Intronic
965979552 3:174671003-174671025 ACATTTTACACGGCTAAAGCAGG - Intronic
966097767 3:176227155-176227177 TCATCCTACATGGCAGGAGCAGG - Intergenic
966241192 3:177757018-177757040 ACATCTTACATGGCCAGAGCAGG + Intergenic
966241466 3:177759052-177759074 AGATCTTACATGGCCAAAGCAGG + Intergenic
966304255 3:178513142-178513164 ACATCTTACATGGCAGGAGCAGG - Intronic
966782150 3:183593112-183593134 ACATCTTACATGGCCAGAGCAGG - Intergenic
967592795 3:191298456-191298478 ACATCTTACATGGCCAGAGCAGG - Intronic
967866196 3:194192040-194192062 ACATCCTACATGGCTGGAGCAGG - Intergenic
967925288 3:194640917-194640939 ACATCTTATATGGCCAGAGCAGG + Exonic
968022492 3:195405838-195405860 GCATCTTACATGGCCAGAGCAGG + Intronic
969140591 4:5067843-5067865 ACATCTTACATGGCTGGAGCAGG + Intronic
969302248 4:6303967-6303989 ACATCCTGCATGGCAACACCAGG - Intergenic
969383095 4:6820281-6820303 ACATCTTACTTGGGTAGAGCAGG + Intronic
969929668 4:10618711-10618733 ACATCTTCCATGGCAGAAGCAGG + Intronic
969997203 4:11325058-11325080 GCATCTTACATGGCAGAAGCAGG - Intergenic
970027321 4:11637190-11637212 ACATCTTACATGGCTAGAACAGG + Intergenic
970047293 4:11869373-11869395 ACATTTAACATGGTTAAAGCAGG + Intergenic
970151957 4:13099274-13099296 ACATCCTACACGGCTGAAGCAGG + Intergenic
970225018 4:13848916-13848938 ATATCCTACATGGCTGGAGCAGG - Intergenic
970344288 4:15138083-15138105 ACATCCTACATGGCTGGAGCAGG - Intergenic
970566209 4:17334743-17334765 ACATCCTACATGGCTGGAGCGGG - Intergenic
970567788 4:17349490-17349512 ACATCTTACATGGCCAGAGAAGG + Intergenic
970747119 4:19312466-19312488 ACATCCTACTTGGCTACAGCAGG - Intergenic
970759415 4:19466401-19466423 ACATCTTATATGGCCAGAGCAGG + Intergenic
970809838 4:20079343-20079365 ATGTCCTACATGGCCAGAGCAGG + Intergenic
971224277 4:24736797-24736819 ATGTCCTACATGGCTGGAGCAGG - Intergenic
971454781 4:26834107-26834129 ACATCCTACATGGCTGGAGCAGG - Intergenic
971712225 4:30129197-30129219 ACATCTTACATGGCGGGAGCAGG - Intergenic
971716061 4:30178830-30178852 ACATCTTACATGGCCGGAGCAGG + Intergenic
971755093 4:30697283-30697305 ACATCTTACATGGCCAGAACGGG + Intergenic
971896547 4:32604626-32604648 ACATTTTACATGGCCAGAGCAGG + Intergenic
971896790 4:32606472-32606494 ACATCTTACATGGCTGGAGCAGG + Intergenic
971921670 4:32948326-32948348 AAAGCCTACATAGGTAAAGCAGG + Intergenic
971942444 4:33233242-33233264 ATGTCCTACATGGCTGGAGCAGG - Intergenic
972011516 4:34189263-34189285 TCATCTTACATGGCCAGAGCAGG - Intergenic
972244055 4:37225923-37225945 ACATCCTCCATGGCTAGTGTAGG + Intergenic
972829754 4:42801801-42801823 ACATATTACATGGCTGGAGCAGG + Intergenic
972830029 4:42803778-42803800 ACATATTACATGGCTGGAGCAGG + Intergenic
972858546 4:43138042-43138064 ACATCCTACACAGCTGGAGCAGG + Intergenic
972878428 4:43394869-43394891 ACGTCTTACATGGCCAGAGCAGG - Intergenic
972878718 4:43396847-43396869 ACATCTTACGTGGCTGGAGCAGG - Intergenic
972897651 4:43643723-43643745 ACATATTACATGGCCAGAGCAGG + Intergenic
973015059 4:45127694-45127716 ACGTCCTACATGCCTGGAGCAGG - Intergenic
973543170 4:51954328-51954350 ACGTCCTACATGGTTGGAGCAGG - Intergenic
973749079 4:53994513-53994535 ACTTCCTACATGGCGAGAGCAGG - Intronic
973854436 4:54996702-54996724 ACATCTTACATGGCTGGAGTAGG + Intergenic
974339026 4:60589654-60589676 ACATCTTACATGGCCAGAGCAGG - Intergenic
974510560 4:62834829-62834851 GCATGCCACATGGCAAAAGCAGG - Intergenic
975053189 4:69892472-69892494 GCATCCTACATGGCTAGAGCAGG - Intergenic
975093159 4:70426498-70426520 ATATCCTACATGGCTGGAGCAGG - Intergenic
975195037 4:71514339-71514361 ATGTCCTACATGGCTGCAGCAGG - Intronic
975466571 4:74715955-74715977 TCAGCTTACATGGCTACAGCTGG - Intergenic
975517943 4:75267618-75267640 ACGTCTTACATGGCCAGAGCAGG - Intergenic
975835633 4:78419813-78419835 ACATCTTACATGGCCAGAGCAGG + Intronic
976086375 4:81410925-81410947 ATATCTTACATGGCTAGAGCAGG - Intergenic
976141857 4:82001298-82001320 ACATCTTACATAGCTGGAGCAGG - Intronic
977000167 4:91488634-91488656 ACATACTGCATGGCTGGAGCAGG - Intronic
977183851 4:93911633-93911655 ACATCTTACATGTCCAGAGCAGG - Intergenic
977349764 4:95867607-95867629 ACATCATACATGGCTGGAGCAGG - Intergenic
977362872 4:96028890-96028912 ATGTCCTACATGGCTGGAGCAGG + Intergenic
977504905 4:97888952-97888974 TCATCTTACATGGCTGAAGAAGG - Intronic
977983834 4:103359234-103359256 ACATGTTACATGGCTAGAGCAGG - Intergenic
978205802 4:106079868-106079890 GCATCGTACATGGCTGCAGCAGG + Intronic
978294366 4:107186447-107186469 ACATCTTACATGGCTGGAGCAGG - Intronic
978344739 4:107755435-107755457 ATATCTTACATGGCCAGAGCAGG - Intergenic
978591436 4:110328832-110328854 ATATCTTACATGGCTGGAGCAGG - Intergenic
978690037 4:111497084-111497106 ACGTCCTACATGGGTGGAGCAGG - Intergenic
979087354 4:116429288-116429310 ACATCTTGCATGGCTCAAGCAGG - Intergenic
979122418 4:116920395-116920417 CCATCCTGCATGGCTTGAGCAGG + Intergenic
979209550 4:118082898-118082920 ACATCTTACATGGCCAGAGAAGG + Intronic
979225065 4:118275482-118275504 ACATCCTACATGGGCAGAGAAGG - Intergenic
979420892 4:120503617-120503639 ACATCTTACATGGCCAGAGAAGG + Intergenic
979515368 4:121603107-121603129 ACATCTTACATGGCCGGAGCAGG + Intergenic
979595315 4:122528239-122528261 ACATCCTATATGGTTGGAGCAGG + Intergenic
979904648 4:126271492-126271514 AAATCCTTCTTGGCTAATGCTGG - Intergenic
980153561 4:129078944-129078966 ACATCTTACATGACTGGAGCAGG + Intronic
980289305 4:130824990-130825012 ACGTCTTACATGGCTGGAGCAGG - Intergenic
980406903 4:132365681-132365703 ACATATTACATGGCCAGAGCAGG + Intergenic
980407158 4:132367555-132367577 ACGTCTTACATGGCAGAAGCAGG + Intergenic
980439497 4:132821446-132821468 ACGTGCTACATGGCTTGAGCAGG + Intergenic
980457530 4:133065282-133065304 ATGTCCTACATGGCTGAAACAGG + Intergenic
980711416 4:136573318-136573340 ACATTATACATGGCCAGAGCAGG - Intergenic
980888902 4:138793237-138793259 ACATCCTACATGGCTGCAGCAGG - Intergenic
981132182 4:141169249-141169271 ACGTCCTACATGCCCAGAGCAGG - Intronic
981277581 4:142919939-142919961 ACATCTTCCATGGCTAGAGCAGG + Intergenic
981307317 4:143260496-143260518 ACATCTTACATGGCAGGAGCAGG - Intergenic
981912327 4:149995765-149995787 ACATCTCACAAGGCTAGAGCAGG - Intergenic
982187884 4:152820585-152820607 ACATCCTATATGGCTGGAGCAGG + Intronic
982271910 4:153599176-153599198 ACATCTTACATAGCTAAAGCAGG + Intronic
982428988 4:155299705-155299727 ACATCTTACATGGCCAGAGCAGG + Intergenic
982506168 4:156219834-156219856 ATATCTTACATGGCCAGAGCAGG - Intergenic
982790703 4:159587854-159587876 ACATCTTACATGGCTAGAATAGG + Intergenic
983075040 4:163316098-163316120 ACTTCTTACATGGCAAGAGCAGG + Intergenic
983153620 4:164316874-164316896 ACATCTTACATGGCTGGAGTAGG - Intronic
983161165 4:164416723-164416745 ACATGTCACATGGCTAAAGCAGG + Intergenic
983670491 4:170231617-170231639 ACATCCTACATGACTGGAGCAGG - Intergenic
983886656 4:172987779-172987801 ACATCTTACATGGCCAGAGAAGG - Intronic
984035967 4:174668091-174668113 ACTTCTTACATGGCTGGAGCAGG - Intronic
984085131 4:175300951-175300973 CCATCTTACATGGCTGGAGCAGG - Intergenic
984480806 4:180298876-180298898 ACATCTTACATGGCCAGAACAGG - Intergenic
984580868 4:181508722-181508744 ACATTCAACATGGCAAAAGTGGG - Intergenic
984786649 4:183573466-183573488 ACATCTTACATGGCTGGAGAAGG + Intergenic
984810617 4:183793354-183793376 GCATCTTACATGGCAAGAGCAGG + Intergenic
985368722 4:189261851-189261873 ATCTCCTACATGGCTGGAGCAGG + Intergenic
985933385 5:3076999-3077021 ATGTCATACATGGCTGAAGCAGG - Intergenic
986282042 5:6331256-6331278 ACATCTTACATGGCTGTAACAGG - Intergenic
986305413 5:6510660-6510682 ACATCTTACACGGCTGGAGCAGG + Intergenic
986474023 5:8106877-8106899 ACATCTTACATGGCTGGAGCAGG + Intergenic
986660276 5:10053183-10053205 ACATCTTACATAGCCAGAGCAGG + Intergenic
987214029 5:15714297-15714319 ACATCTTACATGGCCAGAGAAGG - Intronic
987246617 5:16055333-16055355 ACTTCCTACATGGCTGACACAGG + Intergenic
987289422 5:16494560-16494582 ACATCTTACATGGCCAGAGCAGG - Intronic
987492224 5:18595556-18595578 AAGTCTTACATGGCTGAAGCAGG + Intergenic
987514416 5:18887801-18887823 ACATCTTACATGGCGAAAGGTGG + Intergenic
987646865 5:20684657-20684679 ACATCTTACATGGCCAGAGCAGG - Intergenic
987717675 5:21593154-21593176 ACATCTTACATGCCTGGAGCAGG - Intergenic
987777397 5:22385830-22385852 ACATCTTACATGGCCAGAGCAGG + Intronic
987861843 5:23499538-23499560 ACGTTTTACATGGCTGAAGCAGG + Intergenic
987862261 5:23503969-23503991 ACGTCTTACATGGCTGGAGCAGG - Intergenic
988287366 5:29237460-29237482 ACATCTTAGATGGCAAGAGCAGG + Intergenic
988360444 5:30230354-30230376 ACATCTTACATGGCTGGAGCAGG + Intergenic
988366648 5:30309371-30309393 ACATCTTACATGGCCAAAGCAGG - Intergenic
988594662 5:32580781-32580803 ACATCCTACGTTGCTGGAGCAGG + Intronic
988608771 5:32705526-32705548 ATGTCTTACATGGCTAGAGCAGG + Intronic
988752609 5:34205532-34205554 ACATCTTACATGGCTGGAGAAGG - Intergenic
989366216 5:40658730-40658752 ACATCTTACATGACCAGAGCAGG - Intergenic
989662499 5:43814848-43814870 ACATCTTACATGGCTGAAGCAGG - Intergenic
989662755 5:43816800-43816822 ACATCTTACATGGCCTGAGCAGG - Intergenic
989817361 5:45752101-45752123 ACATCTTACATGGCACCAGCAGG + Intergenic
990494497 5:56334228-56334250 ACATCTTACATGGCTGGAGCGGG + Intergenic
990494753 5:56335945-56335967 ACATCTTACATGGCTGGAACAGG + Intergenic
990654013 5:57934637-57934659 ACATCTTACATGGCTGGAGTAGG - Intergenic
990802431 5:59619985-59620007 ACTTAGTCCATGGCTAAAGCTGG + Intronic
990922010 5:60978485-60978507 ACATCTTACATGTCCAGAGCAGG + Intronic
991012767 5:61901150-61901172 ACGTCTTATATGGCCAAAGCAGG - Intergenic
991604970 5:68392159-68392181 ACATCTTACATGGCTGGAGTAGG + Intergenic
991704439 5:69344726-69344748 ACGTCTTACATGGCTAGAGCAGG - Intergenic
991740378 5:69666346-69666368 ACATCTTACATGGCTGGAGAAGG - Intergenic
991746209 5:69744554-69744576 ACGTCTTACATGGCCGAAGCAGG + Intergenic
991751496 5:69810687-69810709 ACGTCTTACATGGCCGAAGCAGG - Intergenic
991757120 5:69886821-69886843 ACATCTTACATGGCTGGAGAAGG + Intergenic
991791953 5:70246087-70246109 ACATCTTACATGGCTGGAGAAGG - Intergenic
991797811 5:70324507-70324529 ACGTCTTACATGGCCGAAGCAGG + Intergenic
991819841 5:70542463-70542485 ACATCTTACATGGCTGGAGAAGG - Intergenic
991825587 5:70619868-70619890 ACGTCTTACATGGCCGAAGCAGG + Intergenic
991830783 5:70685581-70685603 ACGTCTTACATGGCCGAAGCAGG - Intergenic
991836523 5:70762703-70762725 ACATCTTACATGGCTGGAGAAGG + Intergenic
991884402 5:71246425-71246447 ACATCTTACATGGCTGGAGAAGG - Intergenic
991890154 5:71323826-71323848 ACGTCTTACATGGCCGAAGCAGG + Intergenic
992157265 5:73967627-73967649 ACGTCTTACATGGCTAGAGTAGG - Intergenic
992448359 5:76853980-76854002 ACATCTTACATGGCCAGAGCAGG - Intronic
992596350 5:78351344-78351366 ATGTCCTACATGGCTGGAGCAGG - Intergenic
992648776 5:78836902-78836924 ATGTCCTACATGGCTGGAGCAGG + Intronic
992843090 5:80715714-80715736 AAGTCCTACATGGCTGGAGCAGG + Intronic
992905146 5:81338446-81338468 ACGTCCTACATGGCTAGAGCAGG - Intronic
993031150 5:82707306-82707328 ACATCCTAAATGGAACAAGCAGG + Intergenic
993119464 5:83756900-83756922 ACATCCTCCAAGACTAAACCAGG + Intergenic
993344825 5:86769827-86769849 ATATCTTACATGGCTGGAGCAGG + Intergenic
993351833 5:86858996-86859018 ACATCTTACATGGCATAAGCAGG - Intergenic
993455029 5:88118053-88118075 ACATCTTACATGGCCAGAGCAGG + Intergenic
993583921 5:89699531-89699553 ACATCTTACATGGCCAGAGCAGG - Intergenic
993848213 5:92972336-92972358 ACATCTTACATGGCAAGAGCAGG + Intergenic
994073932 5:95630264-95630286 ACATTTTACATGGCTGGAGCCGG + Intergenic
994137076 5:96301153-96301175 ACATCCTACATGTCTGGAACAGG + Intergenic
994137364 5:96303138-96303160 ACATCCTACATGGCTGGAGCAGG + Intergenic
994443228 5:99836773-99836795 ACATCTTACATGGCTGGATCAGG - Intergenic
994647847 5:102492007-102492029 ACATCTTACATGGCCAGAGAAGG + Intronic
995091688 5:108185409-108185431 ACCTCTTACATGGCTAGAGAAGG - Intronic
995132624 5:108646668-108646690 GCATCTTACATGGCAAGAGCAGG - Intergenic
995250221 5:109984587-109984609 ATGCCCTACATGGCTAGAGCAGG - Intergenic
995430245 5:112066816-112066838 ACATCAAACATGGGAAAAGCTGG + Intergenic
995460941 5:112402217-112402239 ACATTCTACATGGCTAGACCAGG - Intronic
995477908 5:112566356-112566378 ACATCCTACATGGCTAGAGCAGG + Intergenic
995477978 5:112566851-112566873 AAATCCTACATGGCTGGAGCAGG + Intergenic
995533383 5:113112434-113112456 ACATCTTACATGGCCAGAGAAGG - Intronic
995955146 5:117768822-117768844 ACGTCCTACATGGCTGGAGCAGG - Intergenic
995966546 5:117914485-117914507 ATGTCCTACATGGCTGAAACAGG - Intergenic
996232963 5:121088488-121088510 ACATCCTAAATGGCTGGAGCAGG + Intergenic
996239149 5:121172478-121172500 ACGTCTTACATGGCTGGAGCAGG + Intergenic
996674584 5:126159219-126159241 ACATCTTACATGGCTGGAGCAGG + Intergenic
996911008 5:128656558-128656580 ACATCTTACATGGCTGGAGCAGG + Intronic
996980836 5:129492149-129492171 GCATCTCACATGGCGAAAGCAGG + Intronic
997182827 5:131849302-131849324 GCATCTTACATGGCCAGAGCAGG - Intronic
997222900 5:132183923-132183945 ACATCTTACATGGCTGGAGAAGG + Intergenic
997664137 5:135614941-135614963 ACGTCTTACATGGCTGAAGCAGG - Intergenic
998026403 5:138819953-138819975 ATATCTTACATGGCGAGAGCAGG - Intronic
998468023 5:142361482-142361504 ACATTCTACCTGGGTAAAGGAGG + Intergenic
998803971 5:145900291-145900313 ACATCTTACATGGCCAGAACAGG - Intergenic
999808756 5:155108401-155108423 ATATCTTACATGGCTGGAGCAGG - Intergenic
999876759 5:155815647-155815669 ACATCCTACATGGCTGGATTAGG + Intergenic
999949309 5:156631862-156631884 ACAGTCTACATCACTAAAGCAGG - Intronic
1000208091 5:159081473-159081495 ACATCCTTCATGGATAAAAGAGG + Intronic
1000414108 5:160965364-160965386 ACGTCTTACATGGCCAGAGCAGG - Intergenic
1001244127 5:170093018-170093040 ACATCCTGCCTGGCTGAAGCAGG - Intergenic
1003147596 6:3521786-3521808 ACATCTTCCATGGCTGGAGCAGG + Intergenic
1003201625 6:3966464-3966486 TCATCTTACATGGCTGGAGCAGG - Intergenic
1003970453 6:11294476-11294498 ACATCCTATATGGCTGGAACAGG - Intronic
1004076986 6:12352699-12352721 ATGTCCTACATGGCTGGAGCAGG + Intergenic
1004201155 6:13549245-13549267 ACATCTGACATGGCTGGAGCAGG - Intergenic
1004242325 6:13936022-13936044 ACATCTTACATGGCCAGAGCAGG + Intronic
1004277521 6:14251671-14251693 ACATCTTACATGGTTGGAGCAGG + Intergenic
1004317544 6:14603264-14603286 ACGTCCTACATGGCTGGAGCAGG - Intergenic
1004476488 6:15978063-15978085 ACATCCTACATGTCTGAAGCAGG - Intergenic
1004497286 6:16176347-16176369 ACGTCTTACATGGCCGAAGCAGG - Intergenic
1004523564 6:16384725-16384747 ACGTCCTACGTGGCTGGAGCAGG - Intronic
1004984118 6:21060390-21060412 CCATCCTTCATGCCTAAAGCTGG + Intronic
1005046850 6:21651497-21651519 ACATCTTACATGGCCAGAGCAGG + Intergenic
1005550773 6:26912252-26912274 ACATCTTACATGGCTGGAGAAGG - Intergenic
1005879781 6:30047303-30047325 ACATCTTACATGGCTGAAGCAGG + Intergenic
1006199721 6:32277181-32277203 ATATCTTACATGGCTGGAGCAGG - Intergenic
1006731333 6:36238574-36238596 ACATCTTACATGGCCAAAGCAGG + Intergenic
1006878439 6:37318395-37318417 AAATCCAATATGGCTGAAGCTGG - Intronic
1007438327 6:41834667-41834689 ACATCTTACATGGCTGGAGCAGG - Intronic
1008104803 6:47429870-47429892 ACATCTTACATGGCTGGAGTGGG + Intergenic
1008754548 6:54778527-54778549 ACGTCTTACATGGCTGGAGCAGG + Intergenic
1008877420 6:56344814-56344836 ACGTCCTACATAGCTGAAGCAGG - Intronic
1009056878 6:58346767-58346789 ACATCTTACATGGCCTGAGCAGG - Intergenic
1009234365 6:61104808-61104830 ACATCTTACATGGCCTGAGCAGG + Intergenic
1009596109 6:65738866-65738888 ATGTCCTACATGGCCAGAGCAGG - Intergenic
1010341546 6:74759291-74759313 ACATTTTACATGGCTGGAGCAGG - Intergenic
1010421480 6:75681305-75681327 ACATCTTACATGGCCAGAGCAGG - Intronic
1010466917 6:76178657-76178679 ACATCCTACATGGCCAGAGCAGG + Intergenic
1010552889 6:77244676-77244698 ACATCTCACATGGCTGAAGCAGG + Intergenic
1010572896 6:77499458-77499480 ACATCTTACATGGCAGAAGGAGG + Intergenic
1010642962 6:78353637-78353659 ACATCTTACATGGCTGGAGCAGG + Intergenic
1010677962 6:78766764-78766786 ACATCTTACATGGCAGAAACAGG - Intergenic
1010772914 6:79853111-79853133 ACATCTTACATGGCCAGAGAAGG + Intergenic
1010793800 6:80095807-80095829 ACATCTTATGTGGCTAGAGCAGG + Intergenic
1010832045 6:80542823-80542845 ACGTGCTACATGGCTGAAACAGG + Intergenic
1011118626 6:83925198-83925220 ACATCTTACATGGCTGGAGAAGG + Intronic
1011157050 6:84344482-84344504 ACATTTCACATGGCAAAAGCAGG - Intergenic
1011343625 6:86345820-86345842 ACATCTTACATGGCAGCAGCAGG + Intergenic
1011349163 6:86403194-86403216 ACATCTTACATGGCTGTAGCAGG + Intergenic
1011567415 6:88691244-88691266 ACATCTTACATGGCCAGAGCAGG - Intronic
1011645675 6:89455698-89455720 ACATCTTACATGGCCAGAGCAGG - Intronic
1011848804 6:91600738-91600760 ATGTCCTACGTGGCTAGAGCAGG - Intergenic
1011898402 6:92260942-92260964 ACATCTTACATGACTAGAGAAGG - Intergenic
1012128887 6:95466618-95466640 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1012210374 6:96510872-96510894 CCATCTCACATGGCTAAAGCAGG - Intergenic
1012511711 6:100010115-100010137 ACGTTCTACATGGCTTGAGCAGG + Intergenic
1012532236 6:100251801-100251823 ATGTCCTACATGGCTGGAGCAGG - Intergenic
1013419359 6:109951915-109951937 ATGTCCTACATGGCTGGAGCAGG - Intergenic
1013848019 6:114478262-114478284 ACATCTTACATGGCCAGAGCAGG + Intergenic
1013863838 6:114669795-114669817 ACATCCTACATGGCTGAAGCAGG + Intergenic
1014247848 6:119085844-119085866 ACGTCTTACATGGCCAGAGCAGG + Intronic
1014415720 6:121181410-121181432 ACATCTTACATGGCTGGAGCAGG - Intronic
1014430547 6:121365491-121365513 AATTCCTGTATGGCTAAAGCTGG - Intergenic
1014638861 6:123883514-123883536 ACATCTTACATGGCTGGAGCAGG - Intronic
1014928676 6:127306565-127306587 ACGTCCTACATGGCTGGAGCAGG - Intronic
1014937429 6:127400610-127400632 ACATCTTACATGGCTGGAGCAGG + Intergenic
1015267562 6:131303842-131303864 ACGTCCTCCATGGCTGGAGCAGG - Intergenic
1015329573 6:131961791-131961813 ACGTCCTACATGGCTGGAGCAGG - Intergenic
1015383143 6:132592684-132592706 ACATCTTACATGGCTGAAGCAGG - Intergenic
1015853917 6:137603591-137603613 ACATCTTACATGGATAAAATTGG - Intergenic
1016054535 6:139565669-139565691 ACCTCTTACATGGCCAGAGCAGG + Intergenic
1016157241 6:140825881-140825903 ACATCCTACATGGCTGGAGCAGG + Intergenic
1016230267 6:141795425-141795447 ACATCTTACATGGGCAGAGCAGG + Intergenic
1016392526 6:143589375-143589397 ACGTCTTACATGGCTGGAGCAGG - Intronic
1016455924 6:144230703-144230725 ACATCTGACATGGCTGGAGCAGG + Intergenic
1016568045 6:145480283-145480305 ACATCTTACATGGCCAGAGCAGG + Intergenic
1016589372 6:145728028-145728050 ACGTCCTACATGGCTGGAGCAGG - Intronic
1017108595 6:150911614-150911636 ATATCTTACATGGCCAGAGCAGG + Intronic
1017420318 6:154265922-154265944 ACATCATACATGGCTATTGATGG - Exonic
1017589990 6:155968426-155968448 ACATCTTACATGGCCAGAGAAGG - Intergenic
1017910361 6:158787116-158787138 ATTTCCTACCTGGCTGAAGCTGG - Exonic
1018029116 6:159828127-159828149 ACATCTTACATGGCTGGAGCAGG + Intergenic
1018353332 6:162986237-162986259 AGATCCCACATAGCCAAAGCAGG + Intronic
1018378605 6:163236889-163236911 TCATCTTACATGGCTTGAGCAGG + Intronic
1018805223 6:167254116-167254138 GCATCTTACATGGCTGGAGCAGG - Intergenic
1019053499 6:169202540-169202562 GCATCGTACATGGCTGGAGCAGG + Intergenic
1020474649 7:8581411-8581433 ACATCTTACATGGCTGGAGCAGG + Intronic
1020590795 7:10134151-10134173 ACATCTTACATGGCTGGAGAAGG - Intergenic
1021055387 7:16041106-16041128 AGATCCTACATGGCTGGAGCAGG - Intergenic
1021368996 7:19818078-19818100 ACATCCTACATGGCTGGAGCAGG + Intergenic
1021543983 7:21792029-21792051 GCATCTTACATGGCAGAAGCAGG + Intronic
1021763060 7:23920122-23920144 ACATATTACATGGCTAGAGCAGG - Intergenic
1021930499 7:25576797-25576819 ACATCTTACATGGCCTGAGCAGG + Intergenic
1022712433 7:32864507-32864529 ACGTCTTACATGGCCAGAGCAGG + Intergenic
1022724307 7:32966785-32966807 ACATCTCACATGGCAAGAGCAGG + Intronic
1022781504 7:33589134-33589156 ACATCCTCCATGGATAAGGAGGG - Intronic
1022800526 7:33772650-33772672 ACATCTTACATGGCCAGAGGAGG - Intergenic
1022910566 7:34896497-34896519 ACGTCTTACATGGCCAGAGCAGG - Intergenic
1023174313 7:37420996-37421018 ACATACTGCATGGCAGAAGCAGG - Intronic
1023275809 7:38517413-38517435 ACAGCTTACATGGCTGAAGCAGG - Intronic
1024244494 7:47458952-47458974 CCATCCTATCTGGCTAAAGTTGG - Intronic
1024373427 7:48611567-48611589 ACGTCTTACATGGCCAGAGCAGG + Intronic
1024403194 7:48948494-48948516 ACATCTCACATGGCAAGAGCAGG + Intergenic
1024572732 7:50737373-50737395 ACATCTTACGTGGCTGGAGCAGG - Intronic
1025049301 7:55721050-55721072 ACATCTCACATGGCAAGAGCAGG - Intergenic
1025610959 7:63075285-63075307 ACATCTTACATGACTGGAGCAGG + Intergenic
1025708443 7:63887602-63887624 ACATCTTACATGGCTGGAGCAGG - Intergenic
1026287559 7:68976641-68976663 ACGTCTTACATGGCTGGAGCAGG + Intergenic
1026302789 7:69112358-69112380 ACATCTTACATGGCAGGAGCAGG + Intergenic
1026334602 7:69382998-69383020 ACATCTTACATGGCTGGAGCAGG - Intergenic
1027566956 7:79807062-79807084 ACATCCTACATGACTGCAGCAGG - Intergenic
1027581749 7:80005444-80005466 ACATCTTACATGGCTGGAGCAGG - Intergenic
1027617036 7:80436118-80436140 ACATATCACATGGCAAAAGCAGG - Intronic
1027831338 7:83181966-83181988 ACATCCAACATGGCTGAAGAAGG + Intergenic
1028232743 7:88324777-88324799 ACATCTTACAGGGCCAGAGCAGG - Intergenic
1028257181 7:88613576-88613598 ACATCTTATATGGCCAAAGCAGG + Intergenic
1028928370 7:96385766-96385788 AAATATTACATGGCTAAAACTGG + Intergenic
1029174509 7:98655057-98655079 ACGTCTTACATGGCCAGAGCAGG - Intergenic
1029174713 7:98656427-98656449 ACGTCTTACATGGCCAGAGCAGG + Intergenic
1029232753 7:99085001-99085023 ACGTCTTACATGGCCAGAGCAGG - Intronic
1030007615 7:105134355-105134377 GCATCTTACATGGCTGGAGCAGG - Intronic
1030128697 7:106178823-106178845 AAATCCTACATGTCCAAGGCAGG + Intergenic
1030765051 7:113398452-113398474 ACAACTTACATGGCTGGAGCAGG - Intergenic
1030799932 7:113837394-113837416 GCATCTCACATGGCGAAAGCAGG - Intergenic
1031095070 7:117407439-117407461 ATATCCCCCATGGATAAAGCAGG - Intronic
1031182066 7:118431914-118431936 ACATCCTACATGGCTAGAACAGG - Intergenic
1031288217 7:119899821-119899843 ACATCCTACATGACTGTTGCAGG + Intergenic
1031360534 7:120844065-120844087 ACATCTTACATGGCCAGAGCAGG + Intronic
1031583343 7:123504559-123504581 ACATCTTACATGGCCAGAGGAGG + Intronic
1031583598 7:123506532-123506554 ACGTTTTACATGGCTGAAGCAGG + Intronic
1031749549 7:125555478-125555500 ACATTTTACATGGCCAGAGCAGG + Intergenic
1031749899 7:125558329-125558351 ACATCTTCCATGGCCAGAGCAGG + Intergenic
1032124929 7:129186873-129186895 ACATCTTACATGGCAGGAGCAGG + Intergenic
1032994707 7:137432084-137432106 ACATCCTACATGGCTGGAGCAGG - Intronic
1033078986 7:138276984-138277006 ACATCTTACATGGTGGAAGCAGG + Intergenic
1033400780 7:141022101-141022123 ACAGCCCACATAGCTGAAGCAGG - Intergenic
1033605760 7:142927565-142927587 ACATCCTACATGGCCGGAGCAGG + Intronic
1033639894 7:143252253-143252275 ACATCTTATGTGGCTAGAGCAGG - Intronic
1033671242 7:143495292-143495314 ACATCTTACACGGCCAGAGCAGG - Intergenic
1034136884 7:148779228-148779250 ATCTCCTAAATGGCTAAACCAGG - Intronic
1034362174 7:150509643-150509665 ACATCTTACAAGGCTGGAGCAGG - Intergenic
1035040653 7:155924608-155924630 GCATCTTACATGGCAAATGCAGG - Intergenic
1035180510 7:157085984-157086006 ACATCTTACATGGCCAGAGAAGG - Intergenic
1035405564 7:158594914-158594936 ACATCTTACATGGCCAGAGCAGG - Intergenic
1036418498 8:8573272-8573294 ACATCTTACATGGCCAGAGTAGG - Intergenic
1036456465 8:8913244-8913266 ACCTCTTACATGGCCATAGCAGG - Intergenic
1036726369 8:11224441-11224463 ACGTGTTACATGGCTGAAGCAGG + Intergenic
1036765723 8:11548199-11548221 ACATCCTCCATGGCTGACCCTGG + Intronic
1036967761 8:13319583-13319605 GCATCCTACATGGCTGGCGCTGG - Intronic
1037033931 8:14142850-14142872 ACATCTTACATGGCTGGGGCAGG - Intronic
1037565999 8:20118984-20119006 ACGTCTTACATGGCCAGAGCAGG - Intergenic
1037747478 8:21658568-21658590 TCATCTTACATGGCCAGAGCAGG + Intergenic
1038047872 8:23781524-23781546 CCATCCGACAGGGCCAAAGCTGG + Intergenic
1038168412 8:25106719-25106741 ATCTCTTACATGGCTAGAGCAGG - Intergenic
1038188217 8:25294831-25294853 ACGTCTTACATGGCCAGAGCAGG + Intronic
1038281902 8:26173348-26173370 ACATCTCACATGGCCGAAGCAGG - Intergenic
1038345083 8:26725246-26725268 ACTTCTTACATGGCGACAGCAGG - Intergenic
1038437590 8:27546965-27546987 ACATCCTACGTGTCTAGAACAGG + Intergenic
1039116688 8:34099242-34099264 ACATCCTACATGGCTGGAGCAGG + Intergenic
1039148820 8:34480241-34480263 ATATCTTACATGGCTGGAGCAGG + Intergenic
1041488456 8:58405388-58405410 ACATCTTACATGTCTGGAGCAGG - Intergenic
1042605604 8:70542476-70542498 ACATCTTACATGGCCAGAGAAGG - Intergenic
1042750842 8:72156001-72156023 ACATCTTACATGGCTGGAGCAGG + Intergenic
1042893977 8:73645782-73645804 ACATCTTACATGGCCAAAGCAGG + Intronic
1043493324 8:80772483-80772505 ACATCTTACATGGCCGAAGCAGG + Intronic
1044636693 8:94332319-94332341 ACATCTTACATGGCCAGAGGAGG + Intergenic
1045079228 8:98605917-98605939 ATATCTTTCATGGCTAGAGCAGG - Intronic
1045674703 8:104594034-104594056 ACACCCTAAATGGCTGGAGCAGG - Intronic
1045679782 8:104646301-104646323 ACATCTTACATGGCTGGAGCAGG - Intronic
1046276723 8:111971204-111971226 ACATCTCACATGGCCAAAGTAGG + Intergenic
1046391399 8:113577365-113577387 ACATCTTACATGACTGGAGCAGG - Intergenic
1046611383 8:116429454-116429476 ACATCTTCCATGGCCACAGCAGG + Intergenic
1046655123 8:116885349-116885371 ACATCTTACGTGGCTGGAGCAGG - Intergenic
1047574611 8:126138968-126138990 ACATCCTACATGGCAGAAGTAGG - Intergenic
1047691587 8:127360360-127360382 ACATCTTACATGGTTGGAGCAGG + Intergenic
1047843869 8:128784990-128785012 ATGTCCTACATGGCTGGAGCAGG + Intergenic
1047937866 8:129799722-129799744 ACAACTTACATGGCCAGAGCAGG + Intergenic
1047946786 8:129888236-129888258 ACGTCTTACATGGCCAGAGCAGG - Intronic
1048037677 8:130692992-130693014 ACAACTTACATGGCTGGAGCAGG + Intergenic
1048169529 8:132092596-132092618 AGATCTTACATGACTAGAGCAGG - Intronic
1048676156 8:136783537-136783559 ACATCTTACATGGCTGAAGCTGG - Intergenic
1048916170 8:139185060-139185082 ACATCTTACCTGGCTAGAGGAGG - Intergenic
1049653040 8:143784352-143784374 ACATTTTACATGGCTAGAGAAGG - Intergenic
1049871640 8:144983396-144983418 ACATCTTACATGGCTGGAGCAGG - Intergenic
1050109397 9:2199525-2199547 ACATCTTACATGGCAGAAACAGG + Intergenic
1050288793 9:4131577-4131599 ACATCTTACATGGCTGGAGCAGG - Intronic
1050697446 9:8294620-8294642 ATGTCTTACATGGCTAGAGCAGG - Intergenic
1050874956 9:10622847-10622869 ACATCTTACATGGCTGGAGCAGG + Intergenic
1050915939 9:11132753-11132775 ACATTCTACGTGGCTGGAGCAGG - Intergenic
1050935332 9:11388007-11388029 ACATATTACATGGCTGGAGCAGG - Intergenic
1051006053 9:12345962-12345984 ACATCTTACATAGCCAGAGCGGG - Intergenic
1051229704 9:14943125-14943147 ACGTCTCACATGGCTAGAGCAGG + Intergenic
1051582585 9:18694043-18694065 ACATCTTACATGGCTAGACAAGG + Intronic
1051582865 9:18695983-18696005 ACATCTTACATGGCCAGAGAAGG + Intronic
1051818875 9:21141508-21141530 AGATCCAACAGGGCTATAGCTGG + Exonic
1051873927 9:21770352-21770374 ACGTCTTACATGGCTGGAGCAGG - Intergenic
1051925343 9:22317932-22317954 ATGTCCTACATGGCTGGAGCAGG - Intergenic
1052090326 9:24319871-24319893 ACATATCACATGGCTAGAGCAGG + Intergenic
1052168173 9:25358795-25358817 ACATCTTACATGGCAATAGGGGG + Intergenic
1052502001 9:29304012-29304034 ACTTCCTACAGGGCTAGAGCAGG + Intergenic
1052668603 9:31526458-31526480 ACATCTTACATGGCCAAAAAAGG + Intergenic
1054837440 9:69692711-69692733 ACATCTTACATGGCCAGAGCAGG + Intergenic
1055122859 9:72682927-72682949 ACCTCCTACATGGCCGGAGCAGG + Intronic
1055337598 9:75248246-75248268 ACGTTCTACATGTCCAAAGCAGG - Intergenic
1055351971 9:75398994-75399016 ACATCCTGCATAGCTGGAGCAGG + Intergenic
1055453491 9:76452575-76452597 ACATCTTACACGGCTGGAGCAGG + Intronic
1055503146 9:76921808-76921830 ACATCCTTCATGGCTGGACCAGG - Intergenic
1055522994 9:77100915-77100937 ACATCTTACATGGTTGGAGCAGG - Intergenic
1055735797 9:79328696-79328718 ACCTCTTACATGGCCCAAGCAGG + Intergenic
1056465597 9:86850853-86850875 TCATCCTGAATGGCCAAAGCTGG - Intergenic
1056734535 9:89196764-89196786 ACATCTTACATGGCTAGAGCAGG + Intergenic
1056892779 9:90511556-90511578 ACATCTTACATGGCCAGAGAAGG - Intergenic
1056975130 9:91245889-91245911 CCATCCTTCTTGTCTAAAGCTGG + Intronic
1057424153 9:94935207-94935229 ACATCTTACATGGCTGGGGCGGG - Intronic
1058333246 9:103791403-103791425 TCATCTTACATGGCTGGAGCAGG - Intergenic
1059034202 9:110735811-110735833 ACATCTCACATGGCCAGAGCAGG + Intronic
1059458803 9:114416547-114416569 ACATCTTACATGGCTGGAGGAGG - Intronic
1059472218 9:114514307-114514329 ACATCTTACATGGCTGGAGCAGG + Intergenic
1059681737 9:116592338-116592360 ACATCTTACATGGTTGGAGCAGG + Intronic
1060033215 9:120233331-120233353 ATGTCTTACATGGCTGAAGCAGG + Intergenic
1060174610 9:121488259-121488281 ACATCCTAACAGGCTAAGGCGGG - Intergenic
1060623389 9:125088448-125088470 ACATCTTACATGGCTGGAGAAGG - Intronic
1185754054 X:2638582-2638604 ACATCTTACATGGCCACAGCAGG - Intergenic
1186005456 X:5065982-5066004 ACATCCTACGTGCCTAGAGCAGG + Intergenic
1186135421 X:6515356-6515378 CCATATTACATGGCTAGAGCAGG + Intergenic
1186373503 X:8970969-8970991 ACATCTTACACGGCTAGAGCAGG - Intergenic
1186656196 X:11614422-11614444 ACGTTCTACATGGCTAGAGCAGG + Intronic
1186679904 X:11861988-11862010 ACGTCTTACATGGCTGGAGCAGG + Intergenic
1187180377 X:16938480-16938502 GCATCTTACATGGCAGAAGCAGG + Intergenic
1187209001 X:17210436-17210458 ACATCTTACATGGCCAGAGCAGG + Intergenic
1187312449 X:18158224-18158246 ACATCTTACATGGCCTGAGCAGG - Intergenic
1187649816 X:21390461-21390483 ACGTCTTACATGGCTAGAGAAGG + Intronic
1187654396 X:21453815-21453837 ACATCTTACATGGCCAGAGAAGG + Intronic
1187843037 X:23508576-23508598 ACATCTTACATGGCCAGAGTAGG - Intergenic
1188105768 X:26145235-26145257 ACATCTTACATGGCTGAAGCAGG + Intergenic
1188405727 X:29806928-29806950 ACATCTTACATGGTCAGAGCAGG - Intronic
1188441343 X:30217332-30217354 ACATGTTACATGGCCAGAGCAGG + Intronic
1188822234 X:34789612-34789634 ACATCCTACATGGCTGGAGAAGG - Intergenic
1188989562 X:36801092-36801114 ACATCTTACATGGCCAGAGCAGG - Intergenic
1189053294 X:37669559-37669581 ACATCTTACATGGCCAGAGCAGG - Intronic
1189069800 X:37851254-37851276 ACATATTACATGGCTAGAACAGG - Intronic
1189220108 X:39364290-39364312 ACATTTTACATGGCTGGAGCAGG - Intergenic
1189378333 X:40483267-40483289 ACATCTCACATGGCCAGAGCAGG + Intergenic
1189431546 X:40951618-40951640 ACATCTCACATGGCCAGAGCAGG + Intergenic
1189662893 X:43321997-43322019 AGATCCCACATAGCCAAAGCAGG - Intergenic
1189680438 X:43510483-43510505 ACTTACTAAAAGGCTAAAGCAGG + Intergenic
1190035611 X:47020417-47020439 ATATATAACATGGCTAAAGCTGG - Intronic
1190087513 X:47408723-47408745 ACATCTTACATGGCCAGAGCAGG + Intronic
1190153708 X:47969752-47969774 ACATCTTATATGGCTGGAGCAGG + Intronic
1190368336 X:49718524-49718546 ACATCTTACATGACCAGAGCAGG + Intergenic
1190446775 X:50533562-50533584 GCATCTCACATGGCTAACGCAGG - Intergenic
1190506960 X:51135900-51135922 ACGTCCTACATGGCTGGAGCAGG - Intergenic
1190578407 X:51865922-51865944 ACATCTTACATGGCCAGAGCAGG - Intronic
1190901093 X:54673608-54673630 ACATCTTACATGGCTGGAGAAGG - Intergenic
1191211194 X:57886529-57886551 ACACATTACATGGCAAAAGCAGG + Intergenic
1191873473 X:65770065-65770087 ACATCTTACAAGGCCAGAGCAGG - Intergenic
1192066754 X:67892615-67892637 ACATCTTACATGACCAGAGCAGG - Intergenic
1192067474 X:67901914-67901936 GCATCTTACATGGCCAGAGCAGG - Intergenic
1192101932 X:68273960-68273982 ACATCTTACATGGCCAGAGCAGG + Intronic
1192114932 X:68400940-68400962 ACATCCTACATGGCCAGAGCAGG + Intronic
1192755236 X:74040210-74040232 ACATCTTACATGGCTGGAGCAGG + Intergenic
1192793426 X:74406551-74406573 ACTTCTCACATGGCAAAAGCAGG + Intergenic
1193143398 X:78053504-78053526 ACATCTTACATGGCATAAGCAGG + Intergenic
1193186822 X:78523220-78523242 ACTTCTTACGTGGCTGAAGCAGG + Intergenic
1193332818 X:80255032-80255054 ACATCTTACATGGCTAGAGCAGG - Intergenic
1193406305 X:81106333-81106355 ACATCTTACATGGCCAGAGCAGG - Intergenic
1193439697 X:81524445-81524467 ACATCTTACATGGCTGGAGAAGG + Intergenic
1193484635 X:82071517-82071539 ATGTCTTACATGGCTGAAGCAGG + Intergenic
1193558278 X:82984280-82984302 ATATCTTACATGGCCAGAGCAGG + Intergenic
1193634472 X:83931236-83931258 ACATCCTATATGGCCAGAGCAGG - Intergenic
1193780799 X:85699024-85699046 CCATCCTACTTGGCTCCAGCAGG + Intergenic
1193867792 X:86757733-86757755 ACGTCCTACGTGGCTGGAGCAGG - Intronic
1194206423 X:91016516-91016538 ACATCTTACATGGCCAGAGCAGG + Intergenic
1194244566 X:91494784-91494806 ACAACCTACATGGTTGGAGCAGG + Intergenic
1194269349 X:91791392-91791414 ACGTCTTATATGGCCAAAGCAGG + Intronic
1194360207 X:92941133-92941155 ACATCATACATTGTCAAAGCAGG + Intergenic
1194360457 X:92943149-92943171 ATGTCTTACATGGCCAAAGCGGG + Intergenic
1194453721 X:94077066-94077088 ACATCTTACATGGTTGGAGCAGG - Intergenic
1194461041 X:94168224-94168246 GCATGTTACATGGCAAAAGCAGG - Intergenic
1195164302 X:102203087-102203109 ACATCCTACGTGGCTGGAGAAGG - Intergenic
1195194558 X:102484008-102484030 ACATCCTACGTGGCTGGAGAAGG + Intergenic
1197006446 X:121507697-121507719 ACATCTTACATGGCTGGAGCAGG + Intergenic
1197103855 X:122689552-122689574 ATGTCTTACATGGCTGAAGCAGG - Intergenic
1197419878 X:126225733-126225755 ACATCTTACATGGCAGGAGCAGG - Intergenic
1197640134 X:128958812-128958834 ACATCTTACATGGCTAGAGCAGG + Intergenic
1197640342 X:128960152-128960174 ACATTTTACATGGCTGGAGCAGG + Intergenic
1197902382 X:131388248-131388270 ATGTCCTACATGGCAGAAGCAGG - Intronic
1197949146 X:131875249-131875271 ACTTTCTACATGGCTGCAGCAGG - Intergenic
1198506759 X:137308891-137308913 ACATCCTACATGGCTGGAGCAGG - Intergenic
1198563320 X:137877080-137877102 ACATCTTATATGGCTGGAGCAGG + Intergenic
1198818716 X:140622138-140622160 ACATCTTAGATGGCCAAAGCAGG + Intergenic
1198880268 X:141273499-141273521 ACATCTTACATGGCAGGAGCAGG + Intergenic
1199032631 X:143018132-143018154 ACATCTCACATGGCCAGAGCAGG - Intergenic
1199077756 X:143544208-143544230 ACATCTTACATGGCCAAAGCAGG + Intergenic
1199220666 X:145312219-145312241 ACATCTTACATGGCTGCAGCAGG + Intergenic
1199403627 X:147429766-147429788 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1199420928 X:147643903-147643925 ATGTCCTACATGGCTGGAGCAGG - Intergenic
1199440055 X:147857683-147857705 ATGTCCTACATGGCTGGAGCAGG + Intergenic
1199719050 X:150529087-150529109 ACATCTTACATGACTCGAGCAGG + Intergenic
1199865338 X:151843041-151843063 ACATGACACATGGCAAAAGCAGG - Intergenic
1199945631 X:152664265-152664287 ACGTCTTACATGGCTGAAGCAGG - Intergenic
1200552175 Y:4591337-4591359 ACATCTTACATGGCCAGAGCAGG + Intergenic
1200563543 Y:4736097-4736119 ACATCCTACATGGTTGGAGCAGG + Intergenic
1200586569 Y:5012377-5012399 ACGTCTTATATGGCCAAAGCAGG + Intronic
1200668410 Y:6056950-6056972 ACATCATACATTGTCAAAGCAGG + Intergenic
1200668660 Y:6058967-6058989 ATGTCTTACATGGCCAAAGCGGG + Intergenic
1201320262 Y:12690886-12690908 ACATCTTACATGGCAGGAGCAGG + Intergenic
1201343339 Y:12956933-12956955 ACATCTTACATGACTAAAGCAGG + Intergenic
1201688005 Y:16728744-16728766 ACATCTTACATGGCAGAAGCAGG - Intergenic
1201728399 Y:17180298-17180320 ACATCTTACAGGGCCAGAGCAGG - Intergenic