ID: 926097929

View in Genome Browser
Species Human (GRCh38)
Location 2:10094545-10094567
Sequence AGCTGCCTGTTTCAGAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926097926_926097929 -7 Left 926097926 2:10094529-10094551 CCCGTCTCTCACCTCTAGCTGCC No data
Right 926097929 2:10094545-10094567 AGCTGCCTGTTTCAGAACACTGG No data
926097927_926097929 -8 Left 926097927 2:10094530-10094552 CCGTCTCTCACCTCTAGCTGCCT No data
Right 926097929 2:10094545-10094567 AGCTGCCTGTTTCAGAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926097929 Original CRISPR AGCTGCCTGTTTCAGAACAC TGG Intergenic
No off target data available for this crispr