ID: 926100100

View in Genome Browser
Species Human (GRCh38)
Location 2:10110090-10110112
Sequence AATTTCTACTAAGACTAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926100099_926100100 1 Left 926100099 2:10110066-10110088 CCTCTCAGATATATAAAATTGGC No data
Right 926100100 2:10110090-10110112 AATTTCTACTAAGACTAATAAGG No data
926100096_926100100 16 Left 926100096 2:10110051-10110073 CCAAGTTTCTTTTTCCCTCTCAG No data
Right 926100100 2:10110090-10110112 AATTTCTACTAAGACTAATAAGG No data
926100097_926100100 2 Left 926100097 2:10110065-10110087 CCCTCTCAGATATATAAAATTGG No data
Right 926100100 2:10110090-10110112 AATTTCTACTAAGACTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926100100 Original CRISPR AATTTCTACTAAGACTAATA AGG Intergenic
No off target data available for this crispr