ID: 926101301 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:10120149-10120171 |
Sequence | TGTACCAGACGCCGTGCCGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
926101301_926101302 | 6 | Left | 926101301 | 2:10120149-10120171 | CCTTCGGCACGGCGTCTGGTACA | No data | ||
Right | 926101302 | 2:10120178-10120200 | GTGCTGAGCTCCCCGAGCCGCGG | No data | ||||
926101301_926101307 | 23 | Left | 926101301 | 2:10120149-10120171 | CCTTCGGCACGGCGTCTGGTACA | No data | ||
Right | 926101307 | 2:10120195-10120217 | CCGCGGTTTCTCCACCCTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
926101301 | Original CRISPR | TGTACCAGACGCCGTGCCGA AGG (reversed) | Intergenic | ||