ID: 926101301

View in Genome Browser
Species Human (GRCh38)
Location 2:10120149-10120171
Sequence TGTACCAGACGCCGTGCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926101301_926101302 6 Left 926101301 2:10120149-10120171 CCTTCGGCACGGCGTCTGGTACA No data
Right 926101302 2:10120178-10120200 GTGCTGAGCTCCCCGAGCCGCGG No data
926101301_926101307 23 Left 926101301 2:10120149-10120171 CCTTCGGCACGGCGTCTGGTACA No data
Right 926101307 2:10120195-10120217 CCGCGGTTTCTCCACCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926101301 Original CRISPR TGTACCAGACGCCGTGCCGA AGG (reversed) Intergenic