ID: 926101420

View in Genome Browser
Species Human (GRCh38)
Location 2:10120679-10120701
Sequence CCGGCAACTTTGCCCCGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926101420_926101435 25 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101435 2:10120727-10120749 AGATGACTCAGGTTTAGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 81
926101420_926101426 -10 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101426 2:10120692-10120714 AAGTTGCCGGACCTGGGGGCAGG 0: 1
1: 0
2: 1
3: 55
4: 2188
926101420_926101438 30 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101438 2:10120732-10120754 ACTCAGGTTTAGCGCGGGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 43
926101420_926101437 29 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
926101420_926101428 -6 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101428 2:10120696-10120718 TGCCGGACCTGGGGGCAGGAGGG 0: 1
1: 0
2: 1
3: 42
4: 328
926101420_926101431 14 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101431 2:10120716-10120738 GGGCCACGCCGAGATGACTCAGG 0: 1
1: 0
2: 0
3: 2
4: 54
926101420_926101427 -7 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101427 2:10120695-10120717 TTGCCGGACCTGGGGGCAGGAGG 0: 1
1: 0
2: 1
3: 30
4: 338
926101420_926101436 28 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101436 2:10120730-10120752 TGACTCAGGTTTAGCGCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
926101420_926101434 24 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101434 2:10120726-10120748 GAGATGACTCAGGTTTAGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926101420 Original CRISPR CCGGCAACTTTGCCCCGCTG CGG (reversed) Intergenic
903338865 1:22642148-22642170 CCGCCCACTTGGCCCCGCTCCGG - Intergenic
903351104 1:22717024-22717046 CAGGCAAATTTGCCCCCCAGCGG + Intronic
903773964 1:25781281-25781303 AGGACAACTTTGCCCAGCTGGGG - Intronic
903796593 1:25933587-25933609 CAGGCAAATGAGCCCCGCTGGGG - Intergenic
904211016 1:28887117-28887139 CCTGCCACTTTGCCCCGCCGGGG - Exonic
910289037 1:85582092-85582114 CCGGTAACTTTGACCAGCCGAGG - Exonic
913439038 1:118877949-118877971 CAGTTAACTTTGCCCCACTGGGG - Intergenic
916674156 1:167052421-167052443 AAGGCAACTTCGCTCCGCTGTGG - Intergenic
923148634 1:231215102-231215124 GCGTCTACTTTGCCCAGCTGTGG + Intronic
1062889831 10:1049574-1049596 CCGGCGACTTTGCTCCGCCTTGG - Exonic
1068369598 10:56095768-56095790 ACAGCCACTTTGCCACGCTGTGG + Intergenic
1073773942 10:106765596-106765618 CAGGCTATTTTGCCCTGCTGTGG - Intronic
1074160912 10:110835752-110835774 CTGGCATCTGTGCCCAGCTGTGG - Intronic
1074824460 10:117204504-117204526 CGGGCAATTTTGCCCCCCAGAGG - Intronic
1081531954 11:43968021-43968043 GGGGCAATTTTGCCCCTCTGAGG + Intergenic
1086635702 11:89081385-89081407 ACGGCAACTTTGCGCCTTTGGGG + Intergenic
1087672884 11:101128042-101128064 CCAGCGCCTTTGCCCCGCCGCGG - Exonic
1091613370 12:2030695-2030717 CAGGCATCTCTGCCCTGCTGTGG - Intronic
1091722107 12:2820994-2821016 CAAGCACCTTTGCCCCACTGGGG + Intronic
1094061061 12:26316042-26316064 ACAGCAGCTTTGCCACGCTGTGG + Intergenic
1095406365 12:41870940-41870962 CCAGCAGCTTTGCCACACTGTGG - Intergenic
1097492038 12:60282675-60282697 CCTGCTACTTTGGCCCCCTGTGG - Intergenic
1098706908 12:73702711-73702733 ACTGCCACTTTGCCGCGCTGTGG - Intergenic
1104590587 12:130081446-130081468 CAGGAAACTTGGCCCCACTGGGG + Intergenic
1104954991 12:132459956-132459978 CCGGCAACTCTGCCTAGCAGGGG - Intergenic
1105809324 13:23980320-23980342 CCGGCAACACAGCCACGCTGCGG - Intronic
1108960765 13:56225369-56225391 CCTGCTACTTTGCTCTGCTGTGG - Intergenic
1115265394 14:31494819-31494841 ACAGCCACTTTGCCACGCTGTGG - Intronic
1117172415 14:53114126-53114148 ACAGCCGCTTTGCCCCGCTGTGG - Intronic
1120271762 14:82321819-82321841 ACAGCAGCTTTGCCACGCTGTGG + Intergenic
1123719725 15:23049826-23049848 CCGGCACCTCTGCCCAGGTGTGG - Intergenic
1126902620 15:53329642-53329664 CAGGCAACTTGGCCAAGCTGGGG + Intergenic
1132906644 16:2285916-2285938 CCGGCGACCTTGCCCAGGTGTGG + Intronic
1143575134 17:7787902-7787924 CCGGCCACTGTATCCCGCTGCGG + Exonic
1148781441 17:50124180-50124202 CTGGGAACTCTGCCCAGCTGGGG + Intronic
1152210956 17:79002995-79003017 CCGGCGTCTCTGCCCCTCTGGGG + Intronic
1152946472 17:83200364-83200386 CCGTCACCGTTACCCCGCTGAGG + Intergenic
1157556537 18:48616358-48616380 CCGGAACCTGTGCCCAGCTGGGG + Intronic
1160741247 19:687096-687118 CCGGCACCGTGTCCCCGCTGTGG + Exonic
925225984 2:2184712-2184734 CCGGCAGATTTCCCCAGCTGTGG + Intronic
926101420 2:10120679-10120701 CCGGCAACTTTGCCCCGCTGCGG - Intergenic
927207596 2:20619873-20619895 CCGCCCACAGTGCCCCGCTGTGG + Intronic
927282097 2:21317887-21317909 CAAGCACCTTTGCCCCACTGTGG - Intergenic
937323956 2:120977998-120978020 CGGGCACGTTTGCCTCGCTGCGG + Intronic
943147673 2:184065894-184065916 ACAGCCACTTTGCCGCGCTGTGG + Intergenic
945482181 2:210357429-210357451 ACAGCCACTTTGCCACGCTGTGG + Intergenic
946248533 2:218400142-218400164 CCGGTACCTTTGCCCCGCAGCGG - Exonic
947641092 2:231708195-231708217 CGGGCAGCTTTGCCGCGCTTTGG + Intronic
1171959621 20:31484491-31484513 ACGGCGCCTTTGCCCCGCAGTGG - Exonic
1174082014 20:47977205-47977227 GTGGCAACTTTGCCCCCCAGAGG - Intergenic
1174134466 20:48369598-48369620 GGGGCAACTTTGCCCCCCAGAGG + Intergenic
1175659228 20:60797929-60797951 CTGGCAACTTTGCACCTATGTGG + Intergenic
1178727768 21:35070122-35070144 CCAGAAAATTTGCCCAGCTGAGG - Intronic
1182303870 22:29354489-29354511 GTGGCAGCTTTGCCCCCCTGAGG - Intronic
1184244028 22:43226916-43226938 CCTGCAACTGTGCCCCACTGAGG + Intronic
950196773 3:11014927-11014949 CCCGCAGCTTTGCCCGGCGGGGG - Intronic
960491616 3:118322344-118322366 GCAGCAACTTTGCCTAGCTGTGG + Intergenic
970789593 4:19840895-19840917 GGGGCAAATTTGCCCCTCTGGGG - Intergenic
977748524 4:100580367-100580389 CCTGCAGCTTTACCCAGCTGGGG - Intronic
985544519 5:502469-502491 CCGGGGACTGTGCTCCGCTGCGG - Intronic
1006929776 6:37680749-37680771 CCTGCCACTTGGCCCAGCTGGGG + Intronic
1011298914 6:85853618-85853640 ACAGCAACTTTGCCAAGCTGTGG + Intergenic
1022559749 7:31336260-31336282 TCGGCACCTTTGCCCCTCGGTGG + Intergenic
1028985787 7:97007067-97007089 ACGGCAACTTTGTCCCCCTCGGG - Intronic
1041510381 8:58649024-58649046 CCAGCAACTTTTCCATGCTGAGG - Intronic
1041584490 8:59499909-59499931 CTGTCACCTTTGCCCTGCTGAGG - Intergenic
1044821549 8:96159084-96159106 CCGGAAACCTTGCAGCGCTGGGG - Intronic
1055795991 9:79975386-79975408 CCGGCAGCCTTGCCTCGCTCAGG + Intergenic
1056378772 9:86038520-86038542 CCAGCCACTTTGTCCCACTGGGG + Intronic
1059609526 9:115877927-115877949 CCAGCAAGTTTGCCCCGCTCTGG + Intergenic
1062587009 9:137253994-137254016 CCTGCAACTTCGCCTGGCTGGGG + Intergenic
1187860474 X:23677987-23678009 CAGGCCACTGTGCCCGGCTGGGG - Intronic
1192102342 X:68277934-68277956 CCAGCAACTCTGCCCTCCTGGGG - Intronic
1195627597 X:107019946-107019968 CCAGCAACTTTTCCAGGCTGAGG + Intergenic
1199942427 X:152638686-152638708 CCGGCAGCTTTCCCCAGCTTTGG + Intronic