ID: 926101429

View in Genome Browser
Species Human (GRCh38)
Location 2:10120698-10120720
Sequence GGCCCTCCTGCCCCCAGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 421}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926101429_926101439 14 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101439 2:10120735-10120757 CAGGTTTAGCGCGGGAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 122
926101429_926101437 10 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
926101429_926101438 11 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101438 2:10120732-10120754 ACTCAGGTTTAGCGCGGGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 43
926101429_926101440 18 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101440 2:10120739-10120761 TTTAGCGCGGGAGGGGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 209
926101429_926101434 5 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101434 2:10120726-10120748 GAGATGACTCAGGTTTAGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 118
926101429_926101435 6 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101435 2:10120727-10120749 AGATGACTCAGGTTTAGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 81
926101429_926101436 9 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101436 2:10120730-10120752 TGACTCAGGTTTAGCGCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
926101429_926101431 -5 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101431 2:10120716-10120738 GGGCCACGCCGAGATGACTCAGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926101429 Original CRISPR GGCCCTCCTGCCCCCAGGTC CGG (reversed) Intergenic
900090375 1:917687-917709 GTCCCTCCTGCCGCCCGGGCTGG + Intergenic
900118092 1:1037031-1037053 TACCCTCCTGCCCCCAGTCCTGG - Intronic
900124310 1:1062754-1062776 GGCGCTCCTTCCCTCAGCTCTGG + Intergenic
900206260 1:1433158-1433180 GGGCGTCCTGCCCTCAGCTCGGG + Intergenic
900368420 1:2320832-2320854 GGCAATCCTGCCCGCAGGACGGG - Intergenic
900410324 1:2509730-2509752 GCCTCTCCTGACCCCAGGCCCGG - Intronic
900423344 1:2565116-2565138 GGAGCTGCTGCTCCCAGGTCTGG + Intronic
900432764 1:2610819-2610841 GGCCCCCCAGCCCCCAGCACGGG + Intronic
900457701 1:2785520-2785542 GGCCCTTCTCCCCTCAGGACTGG + Intronic
900547196 1:3235694-3235716 GGCGCTCTTTCCCCCATGTCAGG - Intronic
900945409 1:5828552-5828574 GGCCCTCCTCCCCGCAGGTCAGG - Intergenic
901195794 1:7439134-7439156 GGCCCTGCTGCTCCCAGGTGGGG + Intronic
901394858 1:8973673-8973695 GGCCCACCTTCCCTCAGGCCTGG + Intronic
902290841 1:15433666-15433688 GCCCCTCCTGACTCCAGGCCTGG - Intergenic
902763857 1:18601842-18601864 GTCCCTCCTCCTCCAAGGTCAGG + Intergenic
903012657 1:20342530-20342552 GGGTCTCCTGGCCCCAGGGCAGG - Exonic
903015893 1:20361663-20361685 GCCCCTCCTTCCCCCAGGCTAGG - Intergenic
903667425 1:25016619-25016641 GGCCCCAGGGCCCCCAGGTCAGG - Intergenic
903741163 1:25559488-25559510 GGCCCTTCTGCTGCCTGGTCAGG - Intronic
903787834 1:25873250-25873272 TGCCCTCCCGCCTCCAGGGCTGG - Intergenic
904068413 1:27773345-27773367 GGCCCTCGGGGCCCCAGCTCCGG + Exonic
904264767 1:29311830-29311852 CACCCTCCTGCTCCCAGGGCTGG - Intronic
904349328 1:29894598-29894620 AGCCCACATGCCCCCAGTTCTGG - Intergenic
904533505 1:31184009-31184031 GGCCCCTTTGCCCCCAGGACCGG - Exonic
904823166 1:33257949-33257971 GGTCCTCCTGCCCCCAGAGGTGG + Intronic
904853786 1:33479609-33479631 GGCGTGCCTGCACCCAGGTCTGG - Exonic
905474744 1:38218081-38218103 AGCCCTGCTGACTCCAGGTCTGG - Intergenic
906061601 1:42952704-42952726 GGACTTCCTGCCCCTAGGTGGGG - Intronic
906318778 1:44804230-44804252 AGCCTTCATGCCCCCAGGTAAGG + Exonic
906673660 1:47677794-47677816 GGCCTTCCTGCCCCCATTTTAGG + Intergenic
907223019 1:52921242-52921264 GGCCCCGCGGCCCCCAGGCCAGG - Intronic
908567376 1:65371019-65371041 GGTCCTCTGGCCCCCAGGCCAGG - Intronic
910396644 1:86800445-86800467 GGCCATCCAGCCTCCTGGTCAGG + Intergenic
910805859 1:91189365-91189387 GGCCCAGCTGCCCGCAAGTCAGG + Intergenic
915511860 1:156390946-156390968 GGCCCTGCTGGCCTCAGCTCTGG + Intergenic
916193102 1:162198037-162198059 GGCCCTCCTACAGCCAGGCCGGG - Intronic
916740055 1:167639826-167639848 GGCCCTCCTAGCCTCAGCTCTGG - Intronic
917788848 1:178486896-178486918 GGCCCTCCAGCCCCAAGGGGCGG - Intergenic
917930674 1:179820630-179820652 GGCCCTGCTGCCTCCAGATTCGG - Intergenic
917931087 1:179823390-179823412 GGCCCTGCTGCCTCCAGATTTGG - Intergenic
919793203 1:201305637-201305659 GGCCCTCCTCTTCCCAGGGCTGG + Intronic
920215571 1:204359748-204359770 GGCACCCCTCCCCCCAGCTCAGG + Exonic
920389691 1:205591750-205591772 GACTCTCCTACCCCCAGGGCTGG + Intronic
921131994 1:212227860-212227882 GGCCCCCCTGCCTCCATGCCAGG + Intergenic
922028328 1:221774150-221774172 CCCTCTCCTGCCCTCAGGTCTGG - Intergenic
922838665 1:228635410-228635432 CGCCCTCTTGCCCCCCGGCCGGG - Intergenic
1063662504 10:8043955-8043977 GGCCCTCCTGCCCTCTCCTCTGG - Intergenic
1063993172 10:11589019-11589041 GGCCCTATTGCCCCCATGTATGG + Intronic
1066438464 10:35415273-35415295 AGCCCTCCTGCCCTCAGGACAGG - Intronic
1067784011 10:49229485-49229507 GTCCCTCCTGTCCCCAGCCCAGG - Intergenic
1067945405 10:50685517-50685539 GGCCACCCAGCCCCCAAGTCAGG - Intergenic
1069510358 10:69037597-69037619 GGCCATCATGTCCCCAGGTGAGG + Intergenic
1069573280 10:69507226-69507248 GGCCCTCCTTTCTCCAGGCCTGG + Exonic
1069577184 10:69539115-69539137 GGCCTTCAAGCCCCCAGGCCTGG - Intergenic
1069750983 10:70744787-70744809 GGCCCTCCCGACCCAAGGCCTGG - Intronic
1069845570 10:71368533-71368555 GTGTGTCCTGCCCCCAGGTCAGG - Intergenic
1069909797 10:71752054-71752076 GGCCCTGATGCCCTCAGCTCAGG - Intronic
1070638579 10:78149047-78149069 GGCCCTACTGCCCTCATGTTAGG - Intergenic
1070742282 10:78911038-78911060 GGCCTTCCTGACCCCCGGGCAGG - Intergenic
1070759704 10:79016417-79016439 GGCCCTGCTGCCCCAAACTCAGG + Intergenic
1070777390 10:79117834-79117856 GAGCCTCAGGCCCCCAGGTCAGG + Intronic
1070866915 10:79712389-79712411 GGCCACCCAGCCCCCAAGTCAGG - Exonic
1070880705 10:79850510-79850532 GGCCACCCAGCCCCCAAGTCAGG - Exonic
1071564607 10:86665279-86665301 GGGCTTCCTGTCCCCAGGTCAGG - Intronic
1071633827 10:87234612-87234634 GGCCACCCAGCCCCCAAGTCAGG - Exonic
1071647276 10:87366828-87366850 GGCCACCCAGCCCCCAAGTCAGG - Exonic
1072805645 10:98422590-98422612 GGCCCTCCTGCCACCATGACTGG - Intronic
1073112763 10:101072359-101072381 GGCCTTCCTGCACACATGTCTGG - Intergenic
1074896501 10:117781964-117781986 GGCACTGCTGCTCCCAGGACAGG - Intergenic
1074966405 10:118494840-118494862 GGCCCACATGACCCAAGGTCGGG + Intergenic
1075301398 10:121327739-121327761 TTCCCACCTGCCCCCAGTTCTGG + Intergenic
1075473963 10:122717390-122717412 TGCCCTCCTGGGGCCAGGTCAGG - Intergenic
1076345869 10:129778607-129778629 GGCCGTGCTGCCCCGCGGTCTGG - Intergenic
1076378784 10:130011130-130011152 GGCCCTCCAGCCCCTAGGCCTGG + Intergenic
1076411511 10:130254856-130254878 AGCCCTGCTGCCCCCAGGTGGGG - Intergenic
1076693787 10:132237277-132237299 GGCCCTACTGGCCTCTGGTCAGG - Intronic
1076714162 10:132354814-132354836 CTCCATCCTGCCCCCAGATCCGG - Intronic
1076887017 10:133267596-133267618 TGCTCTCCGGCCCCCAGCTCGGG - Intronic
1077025590 11:438545-438567 GGCCCACCAGCCTCCAGGACCGG + Intronic
1077051254 11:568071-568093 GACCCTCCTGGCCCCGTGTCCGG - Intergenic
1077128166 11:953778-953800 GGCTCTCCTGTCCTCAGGTCTGG + Intronic
1077184640 11:1230703-1230725 CCCCCTCCAGCCCCCAGGCCAGG + Intronic
1077184652 11:1230727-1230749 CCCCCTCCAGCCCCCAGGTCAGG + Intronic
1077228398 11:1448184-1448206 GGCCCTGCTGCCCCTGGGGCCGG + Intronic
1077250406 11:1558343-1558365 GGCCCTCCTGACGGCAGGGCAGG - Intronic
1077391058 11:2300845-2300867 GGGCCTCCTGCCCCTAGACCTGG + Intronic
1077445236 11:2587699-2587721 AGCCCACCTGCCACCAGGGCAGG + Intronic
1077533531 11:3108192-3108214 GGCACACCTGTCCCCAGGCCGGG - Intronic
1078132080 11:8621276-8621298 GGCCACCCAGGCCCCAGGTCTGG - Exonic
1078546300 11:12249492-12249514 TGCCCTCCTACCCCCAGCCCTGG + Intronic
1079555138 11:21751367-21751389 TGCCCCCCCGCCCCCAGCTCTGG + Intergenic
1081869123 11:46375377-46375399 GACCCCCCTGCCCCCAGCCCTGG + Intronic
1083271406 11:61574726-61574748 GGCCCTCCCGGGCCCAGGCCTGG + Intronic
1083278163 11:61609132-61609154 GGCCCTTCTTCCCCCATCTCTGG - Intergenic
1083663232 11:64261776-64261798 GGCCCTCCTGCACCCTGGCCTGG + Intronic
1083681531 11:64353987-64354009 TGCCCTCTTGCCCCCAGGAAGGG + Exonic
1083815478 11:65130283-65130305 GTCCCGCCTCCCCCCAGCTCAGG - Exonic
1084084299 11:66847839-66847861 TGCCCACCTGCCCACAGGTAGGG - Intergenic
1084607771 11:70182448-70182470 GGCCCTTCTGCGCCCAGGCTGGG + Intronic
1084685979 11:70695614-70695636 GGCTCTACTGCCCACAGATCAGG + Intronic
1084750133 11:71199062-71199084 GTCCCTCATGCCCCCTGGCCTGG - Intronic
1084790940 11:71474833-71474855 GGACCTCCCGCCCTCGGGTCTGG + Intronic
1084891762 11:72240193-72240215 GGCCCCTGTGCCCGCAGGTCTGG - Exonic
1085306182 11:75487334-75487356 TTCCTTCCTGCCCCTAGGTCTGG - Intronic
1085324278 11:75594809-75594831 GGAGCTCCTTCCCCCAAGTCAGG - Intronic
1085456031 11:76665906-76665928 GGCCCTGCTGACCCTAGGCCTGG - Exonic
1085523681 11:77152443-77152465 GGCCCTTCTGCCACCAGAGCAGG + Intronic
1085524265 11:77155139-77155161 GGCCCTTCTGCCACCAGAGCAGG - Intronic
1087314610 11:96589680-96589702 TGCCCTCCTGACACCTGGTCCGG + Intergenic
1088986580 11:114914499-114914521 GGCACACCTGCCCCCAGGCAAGG + Intergenic
1089146380 11:116332302-116332324 GGCCCTGCTGCCCTCCTGTCTGG - Intergenic
1089975370 11:122727514-122727536 GGCCCGCCTGTCCCCACGTAGGG + Intronic
1090202366 11:124865814-124865836 AGCGCTCCTGTCCCGAGGTCCGG + Intronic
1090242599 11:125194534-125194556 GGCCCTCCTGCCCCCGAGTTGGG + Intronic
1091219361 11:133920907-133920929 GGCCCTCCAGCCCGCGGGGCTGG + Exonic
1091583035 12:1800256-1800278 TGCCCTCCTTCCCCGGGGTCTGG + Intronic
1092441367 12:8508181-8508203 GGCCCTGCTGCCCCCAAGCAGGG - Intergenic
1094174136 12:27524349-27524371 GGCTCTCCACCCCCCAGGTAAGG + Exonic
1096264278 12:50111131-50111153 GGCCTTGCTGAGCCCAGGTCTGG + Exonic
1100343831 12:93707669-93707691 CCCCCTCCTGACCCCAAGTCTGG - Intronic
1101479579 12:105084318-105084340 GGCCCTCCCGCCCCGGAGTCTGG + Intronic
1101658851 12:106748361-106748383 GGACCTCCAGCCCTCAGGTGGGG - Intronic
1101773788 12:107775608-107775630 CGCCCTCGAGCCCCCAGGCCTGG - Exonic
1101968538 12:109296683-109296705 GACCCTCATGCCCCCAGGGGAGG + Intronic
1102258313 12:111428767-111428789 GGCCCTCCTGTGCCCAGGCAGGG - Intronic
1102624087 12:114220585-114220607 TGCTCTCCATCCCCCAGGTCAGG - Intergenic
1102993368 12:117330514-117330536 GGCCCCCAGGCCCCCAGGCCAGG - Exonic
1103364467 12:120371092-120371114 GGCCCTCCAGTCCCCAGTCCAGG - Intergenic
1103723867 12:122988402-122988424 GGGCCTCCTCCTCCCAGGGCAGG - Intronic
1103861786 12:124021141-124021163 GGCCCTCCTTCCTCCAGATCAGG - Intronic
1103953608 12:124565241-124565263 TGCGCTCCCGCCCCCATGTCTGG + Intronic
1104752126 12:131246342-131246364 AACCCTCCTGCCCCCAAGTGAGG - Intergenic
1105070672 12:133232547-133232569 GGTGTTCCTGCCCCCACGTCAGG - Intronic
1107711225 13:43152368-43152390 GGACCTCCTGCCCCCGGCCCAGG + Intergenic
1108288428 13:48932465-48932487 CGCCCTCTTACCCCCAGGGCTGG - Intergenic
1108691320 13:52861813-52861835 GGCCCTCTTCCACCCAGGCCTGG + Intergenic
1112185986 13:97128114-97128136 GACCCTCTTGCCTCCAGGTGGGG - Intergenic
1113651272 13:112035592-112035614 TGCCCTCCTGTCCCCATTTCAGG + Intergenic
1113843521 13:113373390-113373412 GGCCCTCCTGCACCCACCCCAGG - Intergenic
1113877320 13:113602414-113602436 GACCCTCCTGGCCCCAGCACGGG - Intronic
1115907514 14:38216839-38216861 ACCCCTCCTTCCCCCAGCTCAGG + Intergenic
1117410989 14:55450920-55450942 CTGCCTCCTGCCCCCAGCTCAGG - Intronic
1119781597 14:77279775-77279797 TGCCCTGCTGCCGCCAGGTCAGG + Intronic
1121527353 14:94628372-94628394 GTCCCTCCTGACCCCAGTCCAGG + Intergenic
1121751694 14:96363181-96363203 GGTCCTCCTGGCCCCAGGCCAGG + Exonic
1122292623 14:100687772-100687794 GGTCCTGCTGGCCCCAGGCCTGG - Intergenic
1122625819 14:103084907-103084929 TGCCCCACTGCTCCCAGGTCCGG - Intergenic
1122722934 14:103732223-103732245 TGCCCACCTGCACCCAGGGCTGG - Intronic
1122859028 14:104573998-104574020 GGCCCTCCCTCCCCCGGTTCTGG + Intronic
1122883511 14:104700469-104700491 GGCCCTCCTGCAACCATGTATGG - Intronic
1122889310 14:104725072-104725094 GGCCCTCCCTCTCCCATGTCTGG - Intronic
1122895226 14:104753397-104753419 GGCCCTCCAGCCCCCCGCTCAGG - Intronic
1122922450 14:104885602-104885624 GGGCCCGCTGACCCCAGGTCCGG - Intronic
1123062013 14:105598652-105598674 AGCCCACCTGCACCCAGCTCTGG - Intergenic
1123086756 14:105720383-105720405 AGCCCACCTGCACCCAGCTCTGG - Intergenic
1123118823 14:105907692-105907714 TGCTCCCCTGCCTCCAGGTCTGG + Intergenic
1202904351 14_GL000194v1_random:59835-59857 GGCTCCCCTGGCCCCAGGTTTGG - Intergenic
1124188956 15:27554718-27554740 TGCACACCTGCCTCCAGGTCAGG - Intergenic
1125274594 15:37977727-37977749 GGCCCTGCTGTCCCCAAGCCAGG - Intergenic
1127692598 15:61412696-61412718 GTGCCTCCTGTTCCCAGGTCTGG - Intergenic
1127774442 15:62254258-62254280 GCCTCTCCTGCTCCCAGTTCAGG + Intergenic
1127969242 15:63945868-63945890 AGGTCTCCTGGCCCCAGGTCAGG + Intronic
1131133342 15:89913696-89913718 GGCCCACCTGCCCCGAGGCCTGG - Intergenic
1131367796 15:91854171-91854193 TGCCCGCCTGCCCCCAGCGCCGG - Intronic
1132017857 15:98334884-98334906 GGCCCTCCTTCCCACAGAGCTGG + Intergenic
1132556133 16:573453-573475 GTCCTTCCTGCCCCCAGGGAGGG + Intronic
1132768374 16:1546702-1546724 GGCCCTCCCGCCCGCAGCTCTGG + Intronic
1132873078 16:2124205-2124227 GGCCCTGCTGCCCACAGCCCTGG - Intronic
1132884396 16:2176248-2176270 GTCCCATGTGCCCCCAGGTCTGG + Exonic
1132933425 16:2469900-2469922 GGCCCTCCTGCTCCCTCCTCTGG + Intergenic
1133215279 16:4288514-4288536 GGCCCTCCTCTCCCCAAGTCAGG + Intergenic
1133828659 16:9301775-9301797 GGCTCTCCTGCCCACAGGGATGG - Intergenic
1134112620 16:11524662-11524684 GGCCCCTCGGCCCCCAGCTCAGG + Intergenic
1134552167 16:15143386-15143408 GGCCCTGCTGCCCACAGCCCTGG - Intergenic
1135324139 16:21515304-21515326 GCCCATCCTGCCCACTGGTCCGG + Intergenic
1136064013 16:27746749-27746771 GGCCCTCCTGCTCCCTGGACAGG - Intronic
1136335620 16:29608576-29608598 GCCCATCCTGCCCACTGGTCCGG + Intergenic
1136552768 16:30990289-30990311 GGCCCTCCTGCTCCCATCTCGGG - Exonic
1137391169 16:48082562-48082584 GGCACTCCTTCCTCCACGTCTGG + Intergenic
1137458755 16:48638668-48638690 GGCCTTCCAGCCCCCAGAACTGG + Intergenic
1137891645 16:52169342-52169364 GGCTCTGCTTCCCCCAGATCTGG - Intergenic
1138339368 16:56278723-56278745 GCTCCTCCTACCCCCAGATCAGG - Intronic
1138445173 16:57059025-57059047 TGCCCTCCTGCCCACGTGTCCGG + Exonic
1138522225 16:57577633-57577655 GGACCCCCTGCCCCAAGGCCTGG - Intronic
1139446851 16:67003382-67003404 GGCCCTCAGGCAGCCAGGTCAGG - Intronic
1139601712 16:67991318-67991340 GGCCCTCCTGCTGCCAGGCATGG - Intronic
1139901714 16:70333404-70333426 GGCCCTGCTGCCCCCTGCTTAGG + Intronic
1139906805 16:70371808-70371830 GGCCCTGCTGCCCCCTGCTTAGG + Intronic
1140427633 16:74874298-74874320 GGCCACCGTGCCCACAGGTCAGG + Exonic
1141664511 16:85458944-85458966 GTGCCACCTGCCCGCAGGTCTGG + Intergenic
1142036348 16:87864412-87864434 GCCCATCCTGCCCACTGGTCCGG + Intronic
1142141170 16:88473502-88473524 GGCCCCGCTGCCCCGGGGTCTGG + Intronic
1142250388 16:88989293-88989315 GCTCCTCCTGCCCCCAGCCCCGG + Intergenic
1142303087 16:89270274-89270296 GGGCCGCCTGCTCCCAGGCCTGG + Intronic
1142354320 16:89595148-89595170 GGGCCTCCTGTGCCCAGCTCAGG - Intronic
1142468280 17:148054-148076 GGACCACCTGCCCCTAGGTCAGG - Intronic
1143500266 17:7334820-7334842 AGCCCTCCTGCCCCCTAGGCTGG - Intergenic
1143531923 17:7510168-7510190 GCCCAACCTGCCCCCAAGTCTGG - Intronic
1143863671 17:9908872-9908894 GACCCTCCTGCCCTCTGGCCTGG + Intergenic
1144857527 17:18277926-18277948 GGCCCTCCTGCTCCCGGATTGGG + Exonic
1146639219 17:34527458-34527480 GGCCATCCTGCCCGCATGACTGG + Intergenic
1147422688 17:40330521-40330543 GGCCCTCCTTCCCCCAGTGAGGG - Intronic
1147571815 17:41576172-41576194 GGCCCTCCTCCCCCTACATCTGG + Intergenic
1147951441 17:44110098-44110120 GGCGCTCCTCTCCCCAGGTCTGG - Intronic
1147967074 17:44199394-44199416 GGGCCCCCTCCCCCCAGGTCTGG - Intronic
1148074387 17:44927143-44927165 CTCCCTCCAGCCCCCAGCTCGGG + Intronic
1150559258 17:66280867-66280889 GGCCCTCCTGCTTGCAGGACAGG + Intergenic
1150675863 17:67245434-67245456 GGCCTCCCTGCCCCCACGCCCGG + Intronic
1150710347 17:67526007-67526029 GGACCTCAAGGCCCCAGGTCAGG - Intronic
1151186825 17:72370960-72370982 GGGCCTCCTGCCAGCAGGCCTGG - Intergenic
1151367812 17:73628656-73628678 GGCTCTCCTGACCCCAGAACTGG - Intronic
1151451519 17:74200956-74200978 GGCCATCCTGCCCTCGAGTCCGG + Intergenic
1151511711 17:74564855-74564877 AGGCCTCCTGCTCCCAGGTCTGG + Intergenic
1151684986 17:75640995-75641017 GGCTCCCCTGGCCCCAGCTCTGG + Exonic
1151912702 17:77094405-77094427 TGCCTTCCTGCTCCCAGGGCAGG + Intronic
1152239853 17:79155579-79155601 GACCCCCCTGCCCCCAGCTGTGG - Intronic
1152616265 17:81339370-81339392 GGCCCTGCCGCCCACAGGGCAGG + Intergenic
1152636775 17:81433427-81433449 GCCCCTCCTGTGCCCAGGGCTGG + Intronic
1152636787 17:81433468-81433490 GCCCCTCCTGTGCCCAGGGCAGG + Intronic
1152636828 17:81433630-81433652 GCCCCTCCTGTGCCCAGGGCAGG + Intronic
1152657279 17:81525868-81525890 GCCCCTCCTGCCTCCACCTCAGG - Intergenic
1152877390 17:82794763-82794785 TGCCCTCCTGCACCCATGCCTGG + Intronic
1156447637 18:37249134-37249156 GGATCTCCTTCCCCCAGATCAGG + Intronic
1157766204 18:50298976-50298998 GTCCCGCCTGTCCCCAGGTGTGG - Intergenic
1157862506 18:51153837-51153859 GGTCCCCATGCCCCCAGGCCAGG + Intergenic
1158205688 18:54990249-54990271 CCCCCTCCTACCCCTAGGTCAGG - Intergenic
1159956091 18:74519492-74519514 GCCCCTCCTGCTCCCAAGGCTGG - Intronic
1160018651 18:75163816-75163838 GTCTCTCCTGCCCCCATTTCAGG + Intergenic
1160578577 18:79870953-79870975 GGGCCTCCAGCCTCCAGGACCGG - Intronic
1160662629 19:308250-308272 GGCCTTCCTGCCCCAGGGTGGGG - Intronic
1160718807 19:588813-588835 GGGCCTCCTGCCTCCAGGTGGGG + Intergenic
1160740091 19:681587-681609 GGTTCTCCGGCCCCCAGGACAGG - Intronic
1160782501 19:884099-884121 GCCCCACGTGCCCCCACGTCTGG + Intronic
1160820701 19:1056401-1056423 TGCTCACCTGCCCCCAGGCCCGG + Exonic
1160834350 19:1117561-1117583 GGCCCACCTGCCGCCAGCCCTGG + Intronic
1160887131 19:1355192-1355214 GCCCCCCCTCCCCCCAGGCCCGG - Intronic
1160965489 19:1745402-1745424 GGAGCCCCTGCCCCCAGGCCTGG + Intergenic
1161048682 19:2150868-2150890 GGCCCACCTGCCCCCGTCTCGGG - Intronic
1161063982 19:2228635-2228657 GGCACAGCTGCCCCCAGGGCTGG - Intronic
1161076325 19:2287538-2287560 GGCCCTCCCGGCCACAGCTCAGG + Intronic
1161078018 19:2295940-2295962 GGTCCTCCTGCCCCCAGCTTGGG + Intronic
1161124130 19:2546426-2546448 GGCCCTCCCGCCCGCAGCCCTGG - Intronic
1161149436 19:2699975-2699997 GACTCTCCTGCCACCAGGTGTGG + Intronic
1161319039 19:3632636-3632658 GACCCTCCTGCCCTCAGCTTGGG - Exonic
1161722375 19:5910237-5910259 CTCCCTCTTGCCCCCAGGCCAGG - Exonic
1162019321 19:7861509-7861531 TGCCCTCTGGCCCCCAGGCCAGG - Intronic
1162609699 19:11739317-11739339 TCCCCTCCTGCTCCGAGGTCCGG - Intergenic
1162916353 19:13876575-13876597 TGCCCCCCGGCCCCCAGCTCTGG - Intronic
1162921601 19:13906401-13906423 GGACCACCTGCCCCCAAGCCCGG - Exonic
1163638786 19:18450217-18450239 GGGCCTCCGGCCCCCAGTGCTGG + Intronic
1165320226 19:35080441-35080463 GGCCCACCTGCCCCTACGCCTGG + Intergenic
1165486738 19:36101052-36101074 CCCCCTCCTTCCCCCAGGTCAGG - Intronic
1165782927 19:38444275-38444297 GTTCCTCCTGCTCCCAGGTCTGG + Intronic
1166343481 19:42151736-42151758 TGCCCTCCCCCACCCAGGTCAGG + Intronic
1166959338 19:46488351-46488373 GGCCCTCCCGGCCCCAGGGGAGG - Intronic
1167103424 19:47417569-47417591 GGTCCTCCTGCCCACATGTCAGG - Intronic
1168513925 19:56994830-56994852 TGCCCACCTCCTCCCAGGTCGGG + Intergenic
925449593 2:3957227-3957249 TGCCCACCTGCCCTCAGGGCAGG + Intergenic
926101429 2:10120698-10120720 GGCCCTCCTGCCCCCAGGTCCGG - Intergenic
926108282 2:10166071-10166093 GGTCCTTCTGCCCCGAGGTTTGG + Intronic
927694167 2:25229256-25229278 GGTCCTCCTGACCCCAGCACAGG + Exonic
927700820 2:25267792-25267814 GCACCCCCTGCCCCCAGGGCTGG - Intronic
927885780 2:26717715-26717737 GGCCCCACCGGCCCCAGGTCAGG + Intronic
927917174 2:26944774-26944796 GTCCCTCATGCCCCCATGCCGGG - Exonic
930637422 2:53821699-53821721 AGCCCTCCTGTCTCCAGGTGAGG + Intergenic
932568019 2:72921457-72921479 AGGCCTCCTTCCCACAGGTCGGG + Intronic
934502294 2:94870566-94870588 GGCTCCCCTGGCCCCAGGTTAGG + Intergenic
935291360 2:101613503-101613525 GGACCTCAGGCCCCCAGGTGTGG + Intergenic
936104513 2:109613709-109613731 GACCCACCGGCCCCCTGGTCCGG - Intronic
937862598 2:126722742-126722764 GCCCCTCCTGCCCACGTGTCTGG + Intergenic
937996117 2:127696205-127696227 GGCTCTGCTGCCCCAAGGTCGGG + Intergenic
938463015 2:131510068-131510090 GGCCCACCTACCCCAACGTCTGG - Intergenic
939182361 2:138818306-138818328 TGCCCTTCTGCCACCAGCTCTGG - Intergenic
943706611 2:191041838-191041860 CTCCCTCCTGTGCCCAGGTCTGG - Intronic
946404023 2:219483433-219483455 GGCCCTCCCCTCCCCAGGCCAGG + Exonic
946412390 2:219521829-219521851 GGGCCTCCTGCCCCCAGTGCTGG - Intronic
946426761 2:219602618-219602640 GGCCCTCCTCCCCAAAGGCCTGG - Intronic
947111155 2:226721086-226721108 GGCCGTCCTGCCCCCACCTCTGG - Intergenic
947872991 2:233450001-233450023 AGCCCTCCTGCTCCTGGGTCTGG - Exonic
948430325 2:237914333-237914355 GGCCCCCGGGCCCCCAGGTGGGG + Intergenic
948466860 2:238156452-238156474 GGCCCTCCTGCCCACTGGACAGG - Intergenic
948546899 2:238739088-238739110 GGCCCTGCTGCCCACAGACCAGG - Intergenic
948572295 2:238925270-238925292 GGTCCTCCTGCCCCGAGAGCAGG - Intergenic
948628898 2:239289028-239289050 TGCCCTGCTGGCCCCAGGACAGG + Intronic
948825644 2:240572406-240572428 GGCCATCCTGCCCACAGATCTGG + Exonic
948885230 2:240878911-240878933 GGCTTTCCTGTCCCCAGGCCTGG - Exonic
948892602 2:240914735-240914757 CCCCCTCCCGCCCCCAGCTCAGG + Intergenic
1168773682 20:431811-431833 GGCCTTTCTGCCTCCAGGGCCGG - Intergenic
1168893255 20:1307714-1307736 GGGGCTCCTGCCCCGAGGGCTGG - Exonic
1171012733 20:21517321-21517343 TGCCCAGCTGCCCCCAGGCCAGG - Intergenic
1171865661 20:30485989-30486011 GCCCCGCCTGCCCCCAGAGCCGG - Intergenic
1172424366 20:34845254-34845276 GTCCCTCCTTCTCCCAGGTTTGG - Exonic
1173174154 20:40751701-40751723 GACCCACCTGTCCCCAGGCCTGG + Intergenic
1173182615 20:40816087-40816109 GCCCCTCCTGGGCCCAGGACAGG - Intergenic
1174172171 20:48624528-48624550 CTCCCTGCTGCCCCCAGGCCTGG - Exonic
1174459497 20:50672625-50672647 GTCCCTGTTGCCCCCAGGACTGG - Intronic
1174575294 20:51532906-51532928 GGGCATCCAGCCCCCAGGCCAGG - Intronic
1175124176 20:56739288-56739310 GGCCCTCCTGCTCTCAGGTGTGG - Intergenic
1175197374 20:57253613-57253635 GGCTCTCCTGCCCCCAGCCTTGG + Intronic
1175798707 20:61788496-61788518 GGGCCTCCTGACCCCACCTCTGG - Intronic
1175872400 20:62214640-62214662 AGCCTTCCTGCCCCCAGGACAGG - Intergenic
1175889710 20:62310757-62310779 GCCCCTCCTGGCTCCAGGCCCGG + Exonic
1175998682 20:62822369-62822391 GGCCATCCTGCCCCAAGGACAGG + Intronic
1176138266 20:63534508-63534530 GCCCCTCCTGCCCCCGTGCCAGG + Intronic
1176222995 20:63978978-63979000 GTCCCTCCCGCCCCAACGTCAGG + Intronic
1176285359 21:5016447-5016469 TGCCCTCCTGCACCCAGGGCTGG + Intergenic
1176292992 21:5056070-5056092 TGTCCTCCTGCCCCCAGCCCTGG + Intergenic
1176382485 21:6120279-6120301 GGCCCTCCCTCCTCCAAGTCGGG - Intronic
1176386199 21:6139681-6139703 GGCCCTAGTGACTCCAGGTCAGG + Intergenic
1176623719 21:9074602-9074624 GGCTCCCCTGGCCCCAGGTTTGG - Intergenic
1178029740 21:28510539-28510561 GGCCCTGCTTCCCCCAGATCAGG + Intergenic
1178550185 21:33530833-33530855 GGCCCCCATGCCCCCAGCACAGG - Exonic
1179712316 21:43270406-43270428 GGCCCCACTGCCCCCAGGCCGGG + Intergenic
1179737274 21:43398571-43398593 GGCCCTAGTGACTCCAGGTCAGG - Intergenic
1179740987 21:43417960-43417982 GGCCCTCCCTCCTCCAAGTCGGG + Intronic
1179827255 21:43973179-43973201 GGCCCCACTGACCCCGGGTCGGG - Intronic
1179827398 21:43973844-43973866 GGCTCTCCTGTCCCCAGGGCTGG + Intronic
1179864268 21:44207580-44207602 TGTCCTCCTGCCCCCAGCCCTGG - Intergenic
1179871822 21:44247028-44247050 TGCCCTCCTGCACCCAGGGCTGG - Intronic
1180160794 21:45997936-45997958 GCCCCTCCTGCCCCGAGATCCGG + Intronic
1180232716 21:46437065-46437087 GGCCCACCTCCTCCCAGGTAAGG + Exonic
1181005221 22:20010259-20010281 GGGCCTCCTGCCACCAGCTTGGG - Intronic
1181050118 22:20234400-20234422 GGCCTTCCCATCCCCAGGTCAGG - Intergenic
1181566675 22:23742925-23742947 AGCCCTCCTGCCCCAGTGTCAGG - Exonic
1182304915 22:29361252-29361274 GGACCTCCTGCCAGCAGCTCCGG - Intronic
1182312229 22:29417387-29417409 GGACCTCCTGCCAGCAGCTCCGG - Intronic
1182424798 22:30266348-30266370 GGCCCTGGGGCCCCCAGGCCTGG + Intronic
1182472708 22:30558450-30558472 GGCCCTCCCTCCCCCAGGCCTGG + Intronic
1182688038 22:32135855-32135877 GGACCTCCTGCCAGCAGCTCCGG + Intergenic
1183265847 22:36824522-36824544 GTCCCTCCTGCCCCCATCACTGG + Intergenic
1183293740 22:37018318-37018340 GGCCCTCCTTCAGCCAGTTCCGG + Exonic
1183408132 22:37640281-37640303 GCCCCTCCTCCCACCAGGCCAGG - Intronic
1183975960 22:41512515-41512537 AGCCCTCCTGCCCACAGGCCTGG - Intronic
1184315473 22:43684823-43684845 AGCTCTCCAGCCCCTAGGTCAGG - Intronic
1184361023 22:44018745-44018767 TGCCCTCCAGCACCCAGGTCAGG - Intronic
1184521364 22:44996130-44996152 GGCCATGCTGCCCCCAGCTGAGG + Intronic
1184538375 22:45103162-45103184 GTCCCTGCTTCCCCCAGGTCAGG + Intergenic
1185002513 22:48254493-48254515 TGCCATCCTGCCTCCATGTCAGG + Intergenic
1185167628 22:49271352-49271374 GGCTCTGCTGCCCCCAGGAGAGG + Intergenic
1185316358 22:50180919-50180941 GGCCCACCTGCCACCTGGCCTGG + Intergenic
1185317068 22:50183861-50183883 AGGCCTCCAGCCCCCAGGCCAGG + Intergenic
1185393256 22:50573832-50573854 GGCCTTCCTGCCCCCTGGATGGG + Intronic
1185402758 22:50627207-50627229 GGCCTTCCTGCCCCCCCATCAGG - Exonic
950530214 3:13548868-13548890 GGCACTGCTGCCCACAGGGCAGG - Intergenic
953046522 3:39298117-39298139 GACCCTCCTGCCCCCAGCAGTGG + Intergenic
953569634 3:44060999-44061021 GACCCTCCTCCCCCAAGGGCTGG - Intergenic
953624182 3:44557146-44557168 TGCTGCCCTGCCCCCAGGTCTGG - Exonic
953748685 3:45593992-45594014 GGGCCTCCTGCCCCCAGGCCTGG - Intronic
954142931 3:48619694-48619716 GGCCTGCCTGACCCCAGGTTGGG + Intergenic
954228659 3:49199568-49199590 AGCCCTCCTGTCCCCACCTCTGG - Intronic
954449127 3:50562294-50562316 GGCCCACCAGTCCCCAGGCCGGG - Intronic
955977074 3:64489638-64489660 GGCCCGACTGCCCGCATGTCGGG + Intergenic
961623823 3:128245400-128245422 GGCCCTCCTGCCCCTTGACCTGG + Intronic
961683455 3:128614191-128614213 GGACCTCCTGCCTGCAAGTCAGG - Intergenic
961810415 3:129518721-129518743 GTCCCTGCTGACCCCAGGGCGGG - Intronic
961928071 3:130504334-130504356 GGACCTCCAGCCCTCAGGTCAGG + Intergenic
968479843 4:828459-828481 GGCCCCCCCACCCCCAGGTTAGG - Intergenic
968561252 4:1283949-1283971 GGCCTCCCTGCTCCCAGGTGGGG - Intergenic
968891881 4:3373737-3373759 GGCCCTCCTGCACCAGGCTCAGG - Intronic
968960336 4:3740056-3740078 AGCCCACCTGTGCCCAGGTCTGG - Intergenic
969103883 4:4790587-4790609 GGCCCTGCTGCCTCCAAGGCCGG + Intergenic
969523519 4:7692545-7692567 GGCACTCCTGCCCCCATGCCAGG + Intronic
969617462 4:8262050-8262072 GGCACCCCTGCCCGCAGGCCTGG - Intergenic
969645780 4:8428164-8428186 GGCCCTCCTGGCCCCTGCTCTGG + Intronic
969674387 4:8606978-8607000 GGCTCTCCTGTCCCCAGGGAAGG - Intronic
969704333 4:8783852-8783874 GGCCTTCCTGCGGCCAGCTCTGG - Intergenic
981580307 4:146243628-146243650 GGCCCTGCTGCTCCCAGGGAGGG - Intergenic
984702120 4:182825275-182825297 GGCCACCCTGCCCGCAGGCCAGG + Intergenic
985525354 5:398766-398788 GGGCCTTCTGCCGCCAGGCCTGG + Intronic
985715936 5:1461540-1461562 GCCCCACCTGCCCACGGGTCTGG + Exonic
985769410 5:1799580-1799602 CCCCCTCCTGTCGCCAGGTCGGG + Intronic
987333998 5:16882736-16882758 GTCCCTCCCGCACCCAGCTCTGG - Intronic
989481219 5:41932373-41932395 AGTCCTCCAGCCACCAGGTCTGG - Intronic
990999485 5:61768501-61768523 GTCTCTCTTGCCACCAGGTCAGG + Intergenic
992742500 5:79788112-79788134 GGCTCTCCAGCACCCAGGTTAGG + Intronic
996526416 5:124484953-124484975 GGCCCTCCTTCCCCCAGTACAGG - Intergenic
998040831 5:138950122-138950144 GTCCCTGCTGCCCCCAGCCCTGG - Intronic
999756596 5:154669183-154669205 GGCCCTCCTGGCCACATGGCAGG - Intergenic
1002105318 5:176877064-176877086 GGCCCCTCTGTCCCCAGGCCGGG + Intronic
1002137517 5:177117074-177117096 GGCCCTGCCGCACTCAGGTCGGG - Intergenic
1002400043 5:178986562-178986584 GGGCCTCATGTCCCCAGGACAGG + Exonic
1002450267 5:179314723-179314745 AGCCTTCCTGCACCCAGGTGGGG + Intronic
1002522183 5:179798078-179798100 GGCCCTGCTGACCCTGGGTCCGG - Intronic
1002644870 5:180648177-180648199 GGCCCTCCTGGACCCAGCCCAGG - Intronic
1003185465 6:3826504-3826526 GGCCCTGCTGCCACCATGGCTGG - Intergenic
1003426868 6:6003524-6003546 GGGGCTCCTGGCCCCAGCTCAGG + Intronic
1003507391 6:6751236-6751258 TGCCCTCCTGCTCCCTGTTCAGG - Intergenic
1004756417 6:18615369-18615391 GGCCCTCCTCCCACCAGCTCAGG - Intergenic
1004829649 6:19463336-19463358 GGCCCTTTTGTCCCCAGGTTTGG + Intergenic
1006047115 6:31307769-31307791 GGTCCTCCAGGCCCCACGTCAGG - Intronic
1006174472 6:32113675-32113697 CTCCTTCCTGCCCCCAGTTCGGG - Intronic
1006446370 6:34081944-34081966 GGCCCTGCTCACCCCAGCTCGGG - Intronic
1006582897 6:35086867-35086889 GCCCCTCCCACCCCCAGGCCAGG - Intronic
1007166180 6:39830622-39830644 GGCCCACCTCCCCCAAGGCCAGG + Intronic
1007664995 6:43508769-43508791 TGGCCTCCTGCCCCCAGATGGGG - Exonic
1007704785 6:43784005-43784027 GAGCCTCCTGTCCCCAGGGCAGG + Intronic
1010150566 6:72727183-72727205 GTCCCTCTTGCCCCCATGGCAGG - Intronic
1010569817 6:77463404-77463426 GGCTCTCCTCGCCCCAGCTCCGG + Exonic
1012624675 6:101392192-101392214 GGCCCTGCTGCGCCAGGGTCCGG + Intergenic
1017197528 6:151717302-151717324 GGCCATCTTGCCCCTTGGTCTGG + Intronic
1019210011 6:170397419-170397441 GGCCCCTCTGCCCCCAAATCTGG - Intronic
1019541066 7:1551179-1551201 AACCCTCCTGCGCCCAGGGCGGG - Intronic
1019854729 7:3593339-3593361 AAATCTCCTGCCCCCAGGTCTGG + Intronic
1019916552 7:4136748-4136770 GGCCCTCCTGCTGGCAGGGCGGG - Intronic
1022698005 7:32728674-32728696 GGCCCCCCGGCCCCCAGCCCTGG - Intergenic
1023660591 7:42467450-42467472 GTCCCTCTAGCCTCCAGGTCTGG + Intergenic
1023867695 7:44246098-44246120 GTCTCTGCTGCCCCCAGCTCAGG - Intronic
1025078790 7:55964816-55964838 GGCCCCACTGCCCCGAGGCCGGG - Intronic
1025835043 7:65086033-65086055 TGTCCTCCTGCCCCGAGGCCTGG + Intergenic
1025904816 7:65775512-65775534 TGTCCTCCTGCCCCGAGGCCTGG + Intergenic
1027267988 7:76504482-76504504 TGGCCTCCTGCCGCCTGGTCAGG - Intronic
1027319799 7:77004344-77004366 TGGCCTCCTGCCGCCTGGTCAGG - Intergenic
1027338836 7:77183564-77183586 GCCCATCCTGCACCCAGGCCAGG + Intronic
1029606624 7:101602924-101602946 GTCCCTCCTTCCCCCATGGCTGG + Intergenic
1032002210 7:128272481-128272503 GCTCCTGCTGCCCGCAGGTCCGG + Intergenic
1032091591 7:128914196-128914218 GTTCCTCCTGCCCCCAGGCTGGG - Intergenic
1032254362 7:130285239-130285261 CGTCCTCCTGTCCCCAGCTCTGG - Intronic
1033420569 7:141201243-141201265 GGGCCACCGGCTCCCAGGTCTGG - Intronic
1034176418 7:149103606-149103628 AGCCCTCCAGCCTCTAGGTCAGG - Exonic
1034263866 7:149772415-149772437 GGTCCTCCGGCCCCCAAGCCTGG + Intronic
1035255072 7:157620942-157620964 AGGCCTCCTGCCCCCGGGACTGG + Intronic
1035255092 7:157621007-157621029 AGGCCTCCTGCCCCCGGGACTGG + Intronic
1036293510 8:7516975-7516997 GGGCCTCCTGGGCCCAGCTCAGG + Intergenic
1036329049 8:7804020-7804042 GGGCCTCCTGGGCCCAGCTCAGG - Intergenic
1037636468 8:20704880-20704902 TTCCCTCCTGCACCCAAGTCAGG + Intergenic
1037905512 8:22713919-22713941 GGCTCCCCTGACCCCAGGACAGG + Intronic
1037977571 8:23224549-23224571 GGCTCTGCTGCCTCCAGGCCCGG + Intronic
1039493102 8:37962470-37962492 GGCCCTCCTCTCCCCATCTCTGG - Intergenic
1041851092 8:62394654-62394676 TGCCCCGCTGCCGCCAGGTCTGG - Intronic
1042376827 8:68061485-68061507 GGCCCTGCTGCACCCAGGAGTGG + Intronic
1042533622 8:69838245-69838267 GGCCCTCAAGCCACCAGGGCTGG - Intergenic
1042695153 8:71547622-71547644 CGCCCTCCTGCCCCGGGGTGGGG + Exonic
1047387880 8:124426379-124426401 GCTCCTCCTGGCCCCTGGTCAGG + Intergenic
1048049886 8:130806770-130806792 GGCCCTCAGGCACCCAGGTGAGG - Intronic
1048237118 8:132701702-132701724 GGCCATCTTGCCCCCAGGTTGGG + Intronic
1049058077 8:140254593-140254615 GGCCCTCCTCCTCCCAGGAAGGG + Intronic
1049217666 8:141415447-141415469 GACCCTCCTGCCCTCTGGCCGGG + Intronic
1049353111 8:142174726-142174748 GGACTTCCAGCCCCCAGGTTGGG - Intergenic
1049356628 8:142192442-142192464 TGCTCTCCAGCTCCCAGGTCAGG + Intergenic
1049456702 8:142695651-142695673 CGTCCTCCTGCCCCCTGCTCTGG + Intergenic
1049658947 8:143811189-143811211 GGCCGTCCTGCCACCAGAGCTGG - Exonic
1049670898 8:143869428-143869450 TGGCCTCCTGCCCACAGGCCTGG - Exonic
1049709687 8:144057918-144057940 GCCCTTCCTTCCCCTAGGTCTGG - Exonic
1049726438 8:144148486-144148508 GGCCCTTCTCCCCCCAGGCGGGG + Intronic
1049775261 8:144401070-144401092 GCCCCCTCTGCCCCCAGGACGGG - Exonic
1049797413 8:144503053-144503075 GCCCCTCTGGCCCCCAGGCCGGG - Intronic
1052904080 9:33818070-33818092 GGCCTTCCTGCCTCCAGGGATGG - Intronic
1053122999 9:35560267-35560289 GGCCCTCCTGGCCCCGGGCCCGG - Exonic
1053129313 9:35605967-35605989 GCTGCTCCTGCCCCCAGGTTCGG + Exonic
1053142544 9:35690553-35690575 GGGCTTGCTGCCCCCAGGACCGG + Exonic
1053556085 9:39138382-39138404 GGCCATCCTGTCCCCAAGTAAGG - Intronic
1056454091 9:86743680-86743702 GGTCCTCTTGGCTCCAGGTCAGG - Intergenic
1057021105 9:91698170-91698192 GGCACTCCTTCCCCCAGGGTAGG - Intronic
1058425088 9:104869133-104869155 TGCCCTCCAGTCCCCAGCTCAGG + Intronic
1059322955 9:113483448-113483470 GGCCATCCTGCCCCTAGTTTGGG - Intronic
1060413590 9:123415622-123415644 GGCCCTCCTGCTCCCACCGCAGG + Intronic
1061010826 9:127953680-127953702 TGCCCTCCTCCCCTCAGATCTGG - Intronic
1061159062 9:128882738-128882760 GGGGATCCTGCCCCCAAGTCAGG - Exonic
1061162344 9:128902585-128902607 AGCCTGCCTGCCCCCAAGTCTGG - Intronic
1061621598 9:131814419-131814441 GGCCCCACTGCCCCCAGTTCAGG - Intergenic
1061860320 9:133464589-133464611 GGCCCTTCTGTCCCCAGGCCTGG - Intronic
1062216649 9:135393041-135393063 GCCCCTCCTGCCCACTGCTCTGG + Intergenic
1062397444 9:136358158-136358180 GGGCCGCCTGCCCCCTGCTCCGG - Exonic
1062397768 9:136359294-136359316 GGCCCCACAGCCCCCAGGGCTGG + Exonic
1062453984 9:136627161-136627183 GTCCCCCCTGCCCCCAGTCCAGG - Intergenic
1062543028 9:137049863-137049885 GGCTCACCTGAGCCCAGGTCTGG + Exonic
1203746905 Un_GL000218v1:45030-45052 GGCTCCCCTGGCCCCAGGTTTGG - Intergenic
1203563201 Un_KI270744v1:74450-74472 GGCTCCCCTGGCCCCAGGTTTGG + Intergenic
1185528747 X:800359-800381 GCTCTTCCTGCCCCCAGTTCTGG - Intergenic
1190745107 X:53317865-53317887 GGCCCTCCTGATGCCAGGCCAGG + Intronic
1192179627 X:68908424-68908446 GTCCATCCAGCCCCCATGTCTGG + Intergenic
1192231266 X:69266708-69266730 AGCCCTCTTTCCCCCATGTCAGG + Intergenic
1192739280 X:73877195-73877217 GCCCCTGCTGCCCACAGGCCAGG + Intergenic
1195639224 X:107155413-107155435 GGCCCTGGAGCCCCCAGATCAGG - Intronic
1197674221 X:129312528-129312550 GGCCCTCCTGCTTACAGTTCAGG - Intergenic
1198084098 X:133266496-133266518 AGCCCGGCTGCCGCCAGGTCTGG - Intergenic
1200122186 X:153796365-153796387 GGCCATCCTGCCCTCAGACCGGG + Intronic
1200257286 X:154590261-154590283 GGACCTCCTTCCCCCAGTTTTGG - Intergenic
1200260484 X:154614141-154614163 GGACCTCCTTCCCCCAGTTTTGG + Intergenic