ID: 926101430

View in Genome Browser
Species Human (GRCh38)
Location 2:10120703-10120725
Sequence GGCGTGGCCCTCCTGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 331}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926101430_926101434 0 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101434 2:10120726-10120748 GAGATGACTCAGGTTTAGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 118
926101430_926101439 9 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101439 2:10120735-10120757 CAGGTTTAGCGCGGGAGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 122
926101430_926101441 26 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101441 2:10120752-10120774 GGGAGGATGGCGACTTCACCCGG 0: 1
1: 0
2: 1
3: 12
4: 109
926101430_926101437 5 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
926101430_926101435 1 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101435 2:10120727-10120749 AGATGACTCAGGTTTAGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 81
926101430_926101438 6 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101438 2:10120732-10120754 ACTCAGGTTTAGCGCGGGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 43
926101430_926101431 -10 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101431 2:10120716-10120738 GGGCCACGCCGAGATGACTCAGG 0: 1
1: 0
2: 0
3: 2
4: 54
926101430_926101440 13 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101440 2:10120739-10120761 TTTAGCGCGGGAGGGGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 209
926101430_926101436 4 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101436 2:10120730-10120752 TGACTCAGGTTTAGCGCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926101430 Original CRISPR GGCGTGGCCCTCCTGCCCCC AGG (reversed) Intergenic
900122312 1:1054061-1054083 GGCGTGTCCTCCCTGACCCCTGG - Intronic
900265670 1:1755895-1755917 AGCGTGGCCCTACAGCCCCAGGG + Intronic
900340373 1:2185953-2185975 GGCGCGGACCTCCTGCTCCCGGG + Intronic
900431910 1:2606613-2606635 GAGGTGCCACTCCTGCCCCCGGG + Intronic
900457780 1:2785793-2785815 GGAGCTGCCCACCTGCCCCCAGG - Intronic
900506504 1:3032116-3032138 GGTCTGGCCCTGCTGCCACCCGG + Intergenic
900533515 1:3166056-3166078 GGCGAGCCCCTCCTAGCCCCTGG + Intronic
900644332 1:3702249-3702271 GGAGGGTCCCGCCTGCCCCCTGG - Intronic
900648066 1:3717945-3717967 GGCCTGGCTCTCCTCCCCACAGG - Intronic
901039574 1:6355880-6355902 GGGGAGCCGCTCCTGCCCCCTGG + Intronic
901049752 1:6420178-6420200 CACCTGGCCCTCCTGCCCTCGGG - Intronic
901470971 1:9456218-9456240 GGCTTAGGCCTCCTGGCCCCAGG + Intergenic
901494944 1:9615498-9615520 GCTGTGGTCCTCCTGCCCGCTGG - Intergenic
902219224 1:14954177-14954199 ACGGTGGCCCTCCTGCCCCAGGG - Intronic
902818957 1:18931983-18932005 GCCGAGGCCTTCCTGCACCCTGG - Intronic
902843696 1:19092826-19092848 GGCCTGGCCATCCAGCACCCTGG - Exonic
903012660 1:20342535-20342557 GGCCTGGGTCTCCTGGCCCCAGG - Exonic
903180777 1:21603728-21603750 GACGTTGCCCCTCTGCCCCCGGG - Intronic
903186666 1:21633192-21633214 GGCTTGGCCCTTTGGCCCCCCGG + Intronic
903792913 1:25906591-25906613 GGCATTGTCCTCCTGCCCTCCGG - Intronic
903808647 1:26022401-26022423 GGCCTGGCCCCCCTGCTCTCAGG - Exonic
905295010 1:36948755-36948777 GGCCAGGCGCTCCTTCCCCCAGG - Intronic
906667456 1:47631820-47631842 GGTGTGGCCCCCCATCCCCCTGG - Intergenic
907406800 1:54258686-54258708 CCCCCGGCCCTCCTGCCCCCAGG - Intronic
907524185 1:55044497-55044519 AGGGTGGCCCTCCTCCCTCCTGG + Intronic
908388311 1:63663099-63663121 GGCACCTCCCTCCTGCCCCCAGG + Intergenic
913963121 1:143354235-143354257 GGGGTCGCCCGCCTGGCCCCGGG + Intergenic
914057477 1:144179821-144179843 GGGGTCGCCCGCCTGGCCCCGGG + Intergenic
914121669 1:144786545-144786567 GGGGTCGCCCGCCTGGCCCCGGG - Intergenic
915586049 1:156844548-156844570 CACCTGGCCCTGCTGCCCCCTGG - Exonic
915734698 1:158077427-158077449 GGCCTTGCCCTCCTTCCTCCAGG - Intronic
917471501 1:175329930-175329952 GGCATGGCCCTTCTTCTCCCTGG + Intronic
918076860 1:181177125-181177147 AGCGTGGCCCTGCTGACTCCTGG + Intergenic
919182428 1:194103570-194103592 GGAGTTGCCCTCAGGCCCCCAGG + Intergenic
919801672 1:201358150-201358172 GGCGTGGCTCTCATGCTCCCAGG - Intergenic
920562619 1:206949440-206949462 GGCCTGTCCCTCCTCCCCCAGGG - Intergenic
922221104 1:223609243-223609265 GGCCGGGCCCGGCTGCCCCCTGG - Exonic
923657837 1:235933627-235933649 TGCTTGCCCCTGCTGCCCCCTGG + Intergenic
924557550 1:245130742-245130764 AGCGTGGCCCTGCTGCCACCTGG - Intergenic
924561178 1:245156878-245156900 GACTCGGTCCTCCTGCCCCCCGG - Intronic
1063101063 10:2950699-2950721 TGCTTGGCCCTCCTCCTCCCCGG + Intergenic
1064142459 10:12802222-12802244 AGCGAGGCACTCCTGTCCCCTGG + Intronic
1066107356 10:32167555-32167577 GCTGAGACCCTCCTGCCCCCAGG + Intergenic
1067062156 10:43083083-43083105 GGCCTGGCCCTCCTCACCCAGGG + Intronic
1069686768 10:70323833-70323855 GGCCTGGCCCACCTGGCCCTGGG - Intronic
1072059783 10:91798610-91798632 GGCCTCGCCCTCCTGCTCGCGGG + Exonic
1072533489 10:96341581-96341603 GCCATGGCCCTCCTGCCACGTGG - Intergenic
1073242842 10:102069400-102069422 GGCTTGGTCCTCCTGTGCCCAGG + Intergenic
1073794556 10:106973563-106973585 TGCTTGTCTCTCCTGCCCCCAGG - Intronic
1074769959 10:116726717-116726739 GGCATGGCCCTACTGCCTCCAGG + Intronic
1075483372 10:122800340-122800362 CCCCAGGCCCTCCTGCCCCCAGG - Intergenic
1075734226 10:124654297-124654319 GGCCTGGCCCTCCCAACCCCTGG + Intronic
1075787054 10:125057077-125057099 GCTGTCTCCCTCCTGCCCCCAGG - Intronic
1075790659 10:125082164-125082186 GGGGCTGCCCTCCTCCCCCCAGG + Intronic
1075989756 10:126825670-126825692 GGGAAGGCCCTCCTGACCCCAGG - Intergenic
1076148418 10:128143627-128143649 GCTGTGGCCTTCCTGCCTCCTGG + Intergenic
1076723480 10:132402904-132402926 GGTGTGGCCCGCTGGCCCCCGGG + Intronic
1076756686 10:132576240-132576262 GGTGTGCCCCTCCTGCCCCCAGG + Intronic
1076802517 10:132837093-132837115 TGCGTGCCTCTGCTGCCCCCTGG - Intronic
1076946721 10:133656622-133656644 GCCCTGGCCTTCCTGCCCTCAGG - Intergenic
1077225600 11:1437882-1437904 GGAGGGGCCCTCCTGCTCCAGGG + Intronic
1077273626 11:1693363-1693385 CGCGGGGCCCTCCTGCCACCAGG + Intergenic
1077338187 11:2014652-2014674 GGCCTCTCCATCCTGCCCCCTGG + Intergenic
1078829888 11:14969086-14969108 TGCCTGCCCCTCCTGCTCCCAGG - Intronic
1078988090 11:16613948-16613970 AGCGTGGCCCGCCCGCCCGCAGG - Intronic
1079191306 11:18279162-18279184 GGCCTGGACCTCCTGGCCTCAGG + Exonic
1079974525 11:27075542-27075564 GGAGAGGCCATCCTTCCCCCTGG - Intronic
1080333934 11:31174585-31174607 GGCCTGGCACCCTTGCCCCCAGG - Intronic
1082050446 11:47766897-47766919 GGCCTGGCCCTTCTGCGGCCCGG + Intronic
1083582163 11:63831981-63832003 GGCGTGAGCCACCTGCGCCCAGG + Intergenic
1083648215 11:64185452-64185474 GGCCCGGCCCTCCTGCCTCCTGG - Exonic
1083757519 11:64799630-64799652 GGCTGGGCCGTGCTGCCCCCGGG + Exonic
1083995113 11:66267767-66267789 GGGGAGCCCCTCCTGCCACCAGG - Exonic
1084182503 11:67453987-67454009 AGGATGGCCCTCCTGACCCCAGG - Intronic
1084192244 11:67504497-67504519 GAGGTGGCCCTCCCGCCCGCCGG - Intronic
1084318961 11:68362876-68362898 GGCGGGGACCCTCTGCCCCCAGG + Intronic
1084542102 11:69793173-69793195 GGGGTGGCCCTGCTGGGCCCTGG - Intergenic
1084671457 11:70609049-70609071 GGCTGGGCCCTCCTGCCAACAGG - Intronic
1084733823 11:71091754-71091776 GCCCTGGCTCTCCTGCTCCCGGG + Intronic
1084750134 11:71199067-71199089 GGGGGGTCCCTCATGCCCCCTGG - Intronic
1085454669 11:76659098-76659120 GGCTTGGCCCTCCCTCACCCTGG + Exonic
1088879885 11:113964899-113964921 CACGTCGCCCTCCTGCCCCGGGG - Intergenic
1089300510 11:117495987-117496009 TGCCTGGGCTTCCTGCCCCCAGG + Intronic
1089320033 11:117619361-117619383 GGCCAGGCCCTCCTGACCCAGGG - Intronic
1089349583 11:117814800-117814822 CTCGTCCCCCTCCTGCCCCCTGG + Intronic
1090062057 11:123472728-123472750 GGAGTGGCCAGCCTTCCCCCTGG - Intergenic
1202821171 11_KI270721v1_random:69834-69856 GGCCTCTCCATCCTGCCCCCTGG + Intergenic
1091588871 12:1831318-1831340 GGCCTGGCCCAGTTGCCCCCTGG + Exonic
1091740827 12:2959435-2959457 GCTGCGGCCCTCCCGCCCCCTGG - Exonic
1091791724 12:3275754-3275776 GGCCTGTGCCTCCTGTCCCCTGG - Intronic
1091795231 12:3294286-3294308 ACCATGGCCCCCCTGCCCCCAGG + Intergenic
1102006945 12:109595186-109595208 AGCCTGGCCCACCTACCCCCGGG - Intronic
1102010975 12:109618101-109618123 GGCGCTGGCCTGCTGCCCCCTGG + Intergenic
1102035073 12:109766332-109766354 GCCATGGCCCTCCTTCCCCATGG + Intronic
1102171787 12:110847989-110848011 GGCAAGGGCCTCCTGCCCCTTGG - Intronic
1102258315 12:111428772-111428794 GGCACGGCCCTCCTGTGCCCAGG - Intronic
1102993370 12:117330519-117330541 GGCCTGGCCCCCAGGCCCCCAGG - Exonic
1103779449 12:123389240-123389262 CGCGTCGCCCTCCCGCCGCCCGG - Intronic
1103939571 12:124494549-124494571 AGCGAGGCCCACCTGCTCCCAGG + Intronic
1104061583 12:125272917-125272939 CCAGTGGCCCTCCTGACCCCCGG - Intronic
1104697016 12:130871706-130871728 GTCGCGGCTCTCCTGCCTCCCGG - Intergenic
1105645257 13:22311381-22311403 AGCGTGGCCCTGCTGGCACCTGG + Intergenic
1105927516 13:25020343-25020365 GACTTGGCCCGCCTGCACCCAGG + Intergenic
1107467532 13:40664775-40664797 GGCGCGGGCTTCCTGCGCCCGGG + Intronic
1110573151 13:77027246-77027268 GGCGCGGCCCTACTCCCGCCGGG - Intergenic
1113771225 13:112910731-112910753 GGCTCGGGCTTCCTGCCCCCCGG + Intronic
1114066233 14:19061903-19061925 GGGGAGGCCCTGCTGCCCTCCGG + Intergenic
1114096035 14:19338121-19338143 GGGGAGGCCCTGCTGCCCTCCGG - Intergenic
1119338694 14:73856388-73856410 GGCATGGGCCACCTGCCCACCGG + Intronic
1119418861 14:74494089-74494111 GGCGTCGTCCTCCAGCCCCGAGG + Exonic
1119768505 14:77205743-77205765 GGGGAGGCCCTCTTGGCCCCAGG - Intronic
1121001279 14:90453727-90453749 GGCGCCCCTCTCCTGCCCCCGGG + Intergenic
1121957389 14:98226657-98226679 GGCCTGGCCCTCCCACCCCTCGG - Intergenic
1122228194 14:100291825-100291847 GGGGTGGCCCACCACCCCCCCGG + Exonic
1122552051 14:102555528-102555550 GGCCTGGCCCTCGCTCCCCCGGG + Intergenic
1122951145 14:105045817-105045839 GGCGCGGCCCGGCTGCCCACGGG + Intergenic
1202920805 14_KI270723v1_random:29176-29198 GCCCTGGCCTTCCTGCCCTCAGG - Intergenic
1123424100 15:20155146-20155168 GGTGTGGCCCTCCTGCCTGGGGG + Intergenic
1123533320 15:21161675-21161697 GGTGTGGCCCTCCTGCCTGGGGG + Intergenic
1123700820 15:22913736-22913758 GGCATGGGCCTCCTTGCCCCTGG - Intronic
1128258706 15:66216933-66216955 GGCTTGGCCCTCTTGCCTCAAGG + Intronic
1128563768 15:68685603-68685625 GGCCTGGGCCTCCTGCCTCCTGG - Intronic
1128593602 15:68925047-68925069 GGTGAGGCTCTACTGCCCCCGGG + Intronic
1129326205 15:74801500-74801522 GGTCTGTCCTTCCTGCCCCCAGG + Exonic
1129741571 15:77992130-77992152 GGCTGGGCCCTCCTGCCCCATGG - Intronic
1129844074 15:78760249-78760271 GGCTGGGCCCTCCTGCCCCGTGG + Intronic
1130144228 15:81261309-81261331 AGCCAGGCCCTCTTGCCCCCTGG + Intronic
1130257727 15:82333551-82333573 GGCTGGGCCCTCCTGCCCCGTGG - Intergenic
1130597208 15:85256412-85256434 GGCTGGGCCCTCCTGCCCCGTGG + Intergenic
1132556130 16:573448-573470 GGCAGGTCCTTCCTGCCCCCAGG + Intronic
1132559493 16:586932-586954 GGGGTGTCCACCCTGCCCCCGGG - Intergenic
1132678890 16:1131638-1131660 GGCGTGTCGCTCCTGCCCAAGGG - Intergenic
1134208787 16:12259016-12259038 GGCGTGGCACTCCTGCCAGAGGG - Intronic
1134645002 16:15858494-15858516 CGAGTGGCCTTCCTGCTCCCCGG + Intergenic
1134745559 16:16585411-16585433 GGCGTGGACCTCCTCTCCCTAGG - Intergenic
1134999916 16:18768333-18768355 GGCGTGGACCTCCTCTCCCTAGG + Intergenic
1136220130 16:28823323-28823345 GCCGTGGCCCGTCGGCCCCCCGG + Exonic
1136287217 16:29251627-29251649 GGCCTGTCCCTCCTGACCCCAGG + Intergenic
1137706163 16:50537330-50537352 GACTAGGCCCTCCTTCCCCCAGG + Intergenic
1138180856 16:54939277-54939299 GGTGCGACCCTCCAGCCCCCAGG + Intergenic
1141435861 16:83999364-83999386 GGGGTGGCCCTACTTCACCCTGG - Intronic
1141964755 16:87434375-87434397 GGCGTGGGGCTCCTGGCGCCTGG - Intronic
1142092828 16:88224260-88224282 GGCCTGTCCCTCCTGACCCCAGG + Intergenic
1203122264 16_KI270728v1_random:1548921-1548943 GGTGTGGCCCTCCTGCCTGGGGG - Intergenic
1143029817 17:3961672-3961694 GGGGTGTCCCTTCTGCCCTCAGG + Intronic
1143110567 17:4550459-4550481 GCTGTTGCCCGCCTGCCCCCGGG - Intronic
1143482993 17:7238110-7238132 GGCGTGGTCATCCTGGACCCTGG - Intronic
1143697551 17:8631158-8631180 GCCGCGGCCCACCTGCCCCGCGG - Intergenic
1144874050 17:18387791-18387813 GGTCTGGACCTCCTGCCCCCAGG - Intronic
1145766338 17:27460633-27460655 GGGGAGGCCCTCCTGCCATCTGG + Intronic
1147967075 17:44199399-44199421 GGCTTGGGCCCCCTCCCCCCAGG - Intronic
1148324645 17:46776229-46776251 GGCCTGGCCCATCTGCACCCTGG + Intronic
1149600882 17:57892314-57892336 GGGGTTAGCCTCCTGCCCCCTGG - Intronic
1149993840 17:61396929-61396951 GGCGGGGACCCCCTGCCACCTGG + Intergenic
1150208266 17:63426025-63426047 GGCGGGCACCTCTTGCCCCCTGG - Exonic
1150220045 17:63491063-63491085 GGCGGGGCCTCCCTGCCCCTGGG - Intronic
1150295468 17:64005070-64005092 TGCGGGGCCCTCCTCTCCCCTGG - Intronic
1150634399 17:66902691-66902713 GGGGCTGCCCTCCAGCCCCCTGG - Intergenic
1150654995 17:67033542-67033564 AGCCTGGCCTCCCTGCCCCCTGG - Intergenic
1151283384 17:73092710-73092732 CACGTGGCCCTCCCGCCTCCGGG + Intronic
1151557108 17:74852115-74852137 GGCGTGGCCATTCTGGCCCTGGG - Exonic
1151978387 17:77495102-77495124 GGCGTGCCTCTGCTGCACCCTGG + Intronic
1152322941 17:79618491-79618513 AGCACGGCCCTCCTTCCCCCAGG - Intergenic
1152594295 17:81230708-81230730 GGCGTGGACCTGCTGCCCCATGG - Intronic
1152748745 17:82052854-82052876 GGGCTGGTCCTCCTGCCTCCTGG + Intronic
1153854960 18:9136694-9136716 GGCGTGACCGCCCCGCCCCCCGG - Intronic
1154070666 18:11149163-11149185 GGTCTCGCCCTCCAGCCCCCAGG + Intergenic
1158564799 18:58545601-58545623 GGCTTGGCCCTCCTGGCCCCGGG - Intronic
1158649430 18:59272981-59273003 CGCGCGGCCCGCCTGCCCCAAGG - Exonic
1160357752 18:78242954-78242976 GGCGTGGGCGTCCGGCTCCCAGG - Intergenic
1160505377 18:79423672-79423694 AGCCCGGCCCTCCTGCCCGCCGG - Intronic
1160679870 19:407739-407761 GGCGGGGCCCTCATGAGCCCCGG - Exonic
1160732567 19:647960-647982 GGCCCGGCCCACCGGCCCCCTGG - Exonic
1160760706 19:782727-782749 GGCGAGGTCCTCCTCCCGCCGGG + Intergenic
1160791546 19:925874-925896 GGCGAGGCCCTCCCGCGCCCGGG + Intronic
1160990863 19:1859811-1859833 GGGGTGACCCTGCAGCCCCCTGG + Intronic
1161303683 19:3555734-3555756 CGCCTGCCCCTCCTGCCACCTGG + Intronic
1161468904 19:4446769-4446791 AGCCGGGCCCTCCTGCCCCGAGG + Intronic
1161769595 19:6224005-6224027 AGCGTGGCCCCCCTCCTCCCTGG - Intronic
1162042605 19:7979717-7979739 GGAGTGGCGCGCCTGCCCTCAGG + Intronic
1162463366 19:10826425-10826447 GGCGTCACCCGCCTGGCCCCGGG + Intronic
1162744762 19:12792157-12792179 GGCGAAGCCCTCCTGCTCCTCGG - Exonic
1163426987 19:17245449-17245471 AGCGTGCCCCTCCCGGCCCCGGG - Exonic
1163567099 19:18058365-18058387 GGCCTGGGCCTCTTGCCTCCTGG + Intergenic
1164308921 19:24029624-24029646 GCCCTGGCCTTCCTGCCCTCAGG - Intergenic
1164679544 19:30124493-30124515 GGCCTGGCCCTCTTGCTGCCTGG + Intergenic
1164965706 19:32480942-32480964 GGTGGGGCCCTCCTGCCCTCCGG + Intronic
1165829220 19:38722273-38722295 GGCCTGGGCCTCCTGCTGCCTGG - Intronic
1166218504 19:41351620-41351642 AGCGGGGTCCTCCTGCCCCTTGG + Intronic
1166571562 19:43799924-43799946 GGCCTGGCCCCTCTGCTCCCAGG + Intronic
1166888206 19:45973844-45973866 GGCTCGGCCCTCTTGCCCCAGGG - Intergenic
1167099958 19:47398668-47398690 GACTCAGCCCTCCTGCCCCCAGG + Intergenic
1167469368 19:49666806-49666828 GGAGTGGCCCTTCTCCCCCAGGG + Intronic
1202696959 1_KI270712v1_random:132494-132516 GGGGTCGCCCGCCTGGCCCCGGG + Intergenic
925154652 2:1640022-1640044 GCCGTGTCCCTCCTGGTCCCCGG + Intronic
925154667 2:1640065-1640087 GCCGTGTCCCTCCTGGTCCCCGG + Intronic
925154682 2:1640108-1640130 GCCGTGTCCCTCCTGGTCCCCGG + Intronic
925154697 2:1640151-1640173 GCCGTGTCCCTCCTGGTCCCCGG + Intronic
925271755 2:2614767-2614789 GCCGTGGCCCTGCTGAACCCTGG - Intergenic
925369639 2:3335389-3335411 GGCATGGCCTTTCTGCACCCTGG - Intronic
926101430 2:10120703-10120725 GGCGTGGCCCTCCTGCCCCCAGG - Intergenic
927937207 2:27082740-27082762 GGGGTGGCCTCCCTGCCCCGCGG - Exonic
929051335 2:37839402-37839424 GGAGTCTCCCTCCTTCCCCCAGG - Intergenic
932714198 2:74089802-74089824 GGGGTGGCCCTGCTGAGCCCTGG - Intronic
932928160 2:76001143-76001165 GGTGTGGCCCTGCTGACACCTGG - Intergenic
934278119 2:91589508-91589530 GGGGTCGCCCGCCTGGCCCCGGG + Intergenic
934763812 2:96869631-96869653 GGCGCGCCCCTCCGGCCCCGGGG + Intronic
934945421 2:98537747-98537769 AGCTCGGCCCTGCTGCCCCCAGG + Intronic
935332654 2:101988536-101988558 GGCCTTGCCCTTCTGCCCCGTGG - Intergenic
935709133 2:105881820-105881842 GACGAGGCCCACCTGGCCCCGGG - Exonic
936954937 2:118013963-118013985 ACCCTGGCCCTCCGGCCCCCTGG + Exonic
937221679 2:120345936-120345958 GGCGCGCCCCTCGGGCCCCCGGG + Intergenic
939498088 2:142948114-142948136 GGAGTGGCACTGCTGCACCCTGG + Intronic
940426203 2:153534566-153534588 GACTTGGCCCGCCTGCACCCAGG - Intergenic
942313901 2:174681713-174681735 CGTGTGTCCGTCCTGCCCCCTGG - Intronic
942901875 2:181129770-181129792 GGGGTGGCCCTCCTACCCAAAGG - Intergenic
947719754 2:232363296-232363318 GGCGGGGCCCTGCTGCAGCCAGG - Intergenic
947741385 2:232486547-232486569 CGCGGGGCCTCCCTGCCCCCGGG - Exonic
947743623 2:232496628-232496650 GGCGGGTCCCTCCTACCCCTGGG + Intergenic
948466861 2:238156457-238156479 GCAGAGGCCCTCCTGCCCACTGG - Intergenic
948958621 2:241315178-241315200 GACGTGGCCTTCCTGTGCCCGGG - Intronic
1169080989 20:2797698-2797720 GGCGTGCCCCTTCTGGCCCGGGG - Intronic
1169200370 20:3706315-3706337 GGGGTGGCCTGGCTGCCCCCCGG - Intronic
1169211568 20:3768553-3768575 GGCGTGGCCCTCCGGTCTGCGGG + Intergenic
1169680668 20:8209122-8209144 GGGGTGGCCGTCCTGACCACAGG + Intronic
1170702901 20:18719707-18719729 GGCATGCCCCTCCTGTCCCTTGG + Intronic
1172274075 20:33670386-33670408 GGCGGGGCCCAGCTGTCCCCAGG + Intronic
1172756644 20:37289876-37289898 GGCGAGGCCCTCCGCCTCCCGGG - Intronic
1174295485 20:49542382-49542404 GGGCTGGAGCTCCTGCCCCCTGG - Intronic
1174658627 20:52191914-52191936 CGCGTGGCCATCCAGCTCCCCGG - Exonic
1175599159 20:60258663-60258685 TGCCTGGTCCTCCTGCCCCTCGG - Intergenic
1175875479 20:62227488-62227510 GGCCTGGCCCAGCGGCCCCCTGG - Intergenic
1175973456 20:62698790-62698812 GGCCAGCCCCTGCTGCCCCCTGG - Intergenic
1175973514 20:62698992-62699014 GGCCAGCCCCTGCTGCCCCCTGG - Intergenic
1176221972 20:63974043-63974065 GGCGTGACGCCACTGCCCCCTGG + Intronic
1176286326 21:5021171-5021193 GGCGGGGGCCACCTGCCCTCCGG - Intergenic
1176309276 21:5141222-5141244 GGAGGGGCCCTCCTGTCTCCTGG - Intronic
1176373588 21:6076666-6076688 GGCGTGGCCCTACTGCCTGTGGG - Intergenic
1178913420 21:36693864-36693886 AGCGGGGCCCGCCTGCCCGCCGG + Intergenic
1179749889 21:43461577-43461599 GGCGTGGCCCTACTGCCTGTGGG + Intergenic
1179799505 21:43804387-43804409 GGCGGGGCGCTCCTGCCTCCAGG - Exonic
1179847786 21:44120811-44120833 GGAGGGGCCCTCCTGTCTCCTGG + Intronic
1179870855 21:44242304-44242326 GGCGGGGGCCACCTGCCCTCCGG + Intergenic
1179887894 21:44322225-44322247 GCCCTGGCCCTCCTGCCCCCAGG - Intronic
1180021536 21:45131516-45131538 GGGGTGGCCCTGCTCCCTCCAGG + Intronic
1180484711 22:15784494-15784516 GGGGAGGCCCTGCTGCCCTCCGG + Intergenic
1180794489 22:18595349-18595371 GGTGTGGACCTCCTCCCCCTGGG - Intergenic
1181055970 22:20260633-20260655 AGGGTGGGCCACCTGCCCCCGGG - Intronic
1181227250 22:21399971-21399993 GGTGTGGACCTCCTCCCCCTGGG + Intergenic
1181251400 22:21534868-21534890 GGTGTGGACCTCCTCCCCCTGGG - Intergenic
1181357063 22:22304593-22304615 GGTGTGGCCCTCCTGCCCAGGGG + Intergenic
1181632917 22:24160795-24160817 TGCACAGCCCTCCTGCCCCCAGG + Intronic
1182061598 22:27402359-27402381 GGAGGGACCTTCCTGCCCCCAGG - Intergenic
1182146705 22:28001176-28001198 GGCACGGCCCTCATGACCCCTGG - Intronic
1184107978 22:42379460-42379482 GGGGGGGTCCTCCTGCCTCCCGG - Intergenic
1184406558 22:44303931-44303953 GGTGAGGCCCTCCGCCCCCCAGG + Intronic
1184919253 22:47594128-47594150 GCAGTGCCCCTTCTGCCCCCAGG + Intergenic
1185244418 22:49765626-49765648 GCCCTGACCCTCCTGTCCCCAGG + Intergenic
1185393253 22:50573827-50573849 GCCTGGGCCTTCCTGCCCCCTGG + Intronic
950263891 3:11561031-11561053 GGCAGGGCCCTCCTTCCTCCTGG - Intronic
950289319 3:11770895-11770917 GGCCTGGCCCTCCAGCCCTCTGG - Intergenic
952673675 3:36000789-36000811 GTGGTGGCCCTCCTTCCCCTGGG + Intergenic
952898813 3:38096334-38096356 GGCATTGCCCTGCTGCCTCCAGG - Intronic
953748686 3:45593997-45594019 TGGCTGGGCCTCCTGCCCCCAGG - Intronic
954093111 3:48301182-48301204 GGCCACGCCCTCCAGCCCCCCGG + Intronic
954417165 3:50399021-50399043 GGGGTGCCCATCCTGGCCCCAGG - Intronic
954594385 3:51812875-51812897 AGCTTGGCCCTCCTGACACCTGG - Intergenic
954615519 3:51967252-51967274 GGCGCGGGCTCCCTGCCCCCGGG + Intronic
954618582 3:51983200-51983222 CGCCTGCCACTCCTGCCCCCAGG - Exonic
954881233 3:53837370-53837392 GGCGTAGCCCACCTGCCCTCTGG + Intronic
955589963 3:60524633-60524655 AGCGTGGCCCTGCTGACACCTGG - Intronic
957080733 3:75633788-75633810 GCCCTGGCCTTCCTGCCCTCAGG + Intergenic
961170363 3:124793485-124793507 GGCGGGGCCCTCCTGCACATGGG + Intronic
961215806 3:125159666-125159688 GGCGTGAGCCACCAGCCCCCAGG + Intronic
962105358 3:132383434-132383456 GACCTGGGCCTCCTGCTCCCTGG - Intergenic
964622577 3:158732143-158732165 CGCGCGGCCCTCCTGCACCTCGG + Exonic
967921728 3:194619107-194619129 GGCCTGGGCCTCCTGCCTCTTGG + Intronic
968656453 4:1780344-1780366 GGTGTGGGCCTCCTGACCACAGG - Intergenic
968689418 4:1982941-1982963 GGCAGTGCCCTCCTACCCCCAGG - Exonic
969535616 4:7754804-7754826 GACGTGGCCCTCATCCCCCACGG + Intergenic
983023552 4:162709495-162709517 GACTTGGCCCGCCTGCACCCAGG + Intergenic
984705727 4:182845843-182845865 GGCGTGGCCCTGCTGACACCTGG - Intergenic
984776125 4:183482953-183482975 GGCTTGGCCCTGCCGGCCCCGGG - Intergenic
985450177 4:190057421-190057443 GCCCTGGCCTTCCTGCCCTCAGG - Intergenic
985555674 5:556821-556843 GGGGTGGCTCTCATGCCCCGGGG + Intergenic
985922523 5:2989777-2989799 GGTGTGGCCATCCTGCCTGCAGG - Intergenic
986725791 5:10595354-10595376 AGCGTGGCCCTGCTGTCACCTGG - Intronic
988952407 5:36276849-36276871 TGCCTGTCCCTCATGCCCCCTGG - Intronic
990697998 5:58443975-58443997 GGCGTGGAACTCCTGACCTCAGG - Intergenic
993106838 5:83609709-83609731 GGCCTGGAACTCCTGACCCCAGG - Intergenic
993384833 5:87251777-87251799 GGACTGGCCAACCTGCCCCCAGG + Intergenic
997353893 5:133249904-133249926 GGCGCTGCACCCCTGCCCCCCGG - Intronic
997460836 5:134051195-134051217 GGCCTGGCCCCCCTGGCTCCTGG - Intergenic
999079061 5:148826432-148826454 GGCGGGGCCCAACTGCTCCCTGG - Exonic
999281590 5:150369803-150369825 GGTGTCCCTCTCCTGCCCCCAGG - Intronic
999664740 5:153901210-153901232 TGCATCTCCCTCCTGCCCCCAGG + Intergenic
1001907412 5:175484477-175484499 GGCGTGCACCTGCTGGCCCCGGG - Intronic
1002077771 5:176719247-176719269 GCGGGAGCCCTCCTGCCCCCAGG - Intergenic
1002400042 5:178986557-178986579 GGCGTGGGCCTCATGTCCCCAGG + Exonic
1002431844 5:179208481-179208503 GGCACTGACCTCCTGCCCCCAGG + Intronic
1002637677 5:180616206-180616228 CTGGTGGACCTCCTGCCCCCAGG - Intronic
1003640107 6:7869138-7869160 GTGGTGGCCCTCCAGCCCCGCGG + Intronic
1003654945 6:7998481-7998503 TGCCTGGCCCTCCTCCACCCAGG + Intronic
1007388988 6:41538982-41539004 GCCATGGCTCTCCAGCCCCCAGG - Intergenic
1007820262 6:44555723-44555745 GTAGTTGCCCCCCTGCCCCCAGG - Intergenic
1011275276 6:85625234-85625256 TGTGTGGCCCTCCTGATCCCAGG + Intronic
1013272796 6:108559373-108559395 GGCGTGGCCTCCCTGACTCCGGG - Intergenic
1015970015 6:138734361-138734383 GGTGTGGAACTCCTGACCCCAGG - Intergenic
1017955072 6:159170252-159170274 CGCGCGGGCCTCCTGCCGCCTGG - Intronic
1019547248 7:1584425-1584447 GGCACGGCCCTCTTGCCCACTGG - Intergenic
1023789027 7:43737425-43737447 GACGTGGGCCTCCTGGCTCCAGG + Intergenic
1023984084 7:45085298-45085320 GAAGTGGCCCTCCTGGCCCCAGG + Exonic
1025829792 7:65038722-65038744 GGCGGGGCGCTCCTGCCCGGGGG + Intergenic
1025917046 7:65873722-65873744 GGCGGGGCGCTCCTGCCCGGGGG + Intronic
1026589681 7:71684132-71684154 GCTGTTGCCCTCCTGCACCCAGG + Intronic
1029545079 7:101206360-101206382 GGCTGGGCACTCCTGCACCCCGG - Exonic
1035278674 7:157763752-157763774 GCCGGGGCTCTCCTGCCCTCAGG - Intronic
1035426715 7:158783015-158783037 AGCGTGCCCCTCCTTCCCCATGG + Intronic
1035673350 8:1436964-1436986 GGCATAGGCCTCCTGCTCCCAGG - Intergenic
1035713244 8:1734540-1734562 GGCCTGACCTTCCTGCTCCCGGG - Intergenic
1036707205 8:11054823-11054845 GGGCTGGCCCTCCTCCTCCCAGG - Intronic
1040059647 8:43093447-43093469 AGCGTGGCGCTGCTGCCCCCTGG - Intergenic
1042872048 8:73408284-73408306 GCCATGGCCCTCCTGCAGCCAGG + Intergenic
1044026855 8:87183839-87183861 GGCCTGGTCCTAGTGCCCCCAGG - Intronic
1044430713 8:92103339-92103361 CGCGCGGCGCTCCTGCTCCCCGG - Intergenic
1046625510 8:116572680-116572702 GCCGTGGCCCTCCTGGCACTGGG + Intergenic
1048006252 8:130421615-130421637 TCTGTGGCCCTGCTGCCCCCTGG - Intronic
1048237116 8:132701697-132701719 TGTGTGGCCATCTTGCCCCCAGG + Intronic
1048995069 8:139789185-139789207 GGCGTGGGTCTCCCGCCCGCCGG - Intronic
1049217664 8:141415442-141415464 GGAGGGACCCTCCTGCCCTCTGG + Intronic
1049321428 8:141998948-141998970 AGTGTGGCCCTCCTGGCACCTGG - Intergenic
1049570889 8:143369809-143369831 CGCGCGGCCCTCCTCCCCTCTGG + Intronic
1049685571 8:143938000-143938022 GACGAGGCCAGCCTGCCCCCAGG + Intronic
1049797416 8:144503058-144503080 GGCCTGCCCCTCTGGCCCCCAGG - Intronic
1049804093 8:144531069-144531091 GGCGTGACCCACATGCCTCCAGG - Intronic
1051341301 9:16113328-16113350 GGCATGGTCCTCCTGCCCCCAGG - Intergenic
1053689643 9:40577680-40577702 GGTGTGGCCCTCCTGCCTGGGGG - Intergenic
1054274386 9:63053377-63053399 GGTGTGGCCCTCCTGCCTGGGGG + Intergenic
1054300890 9:63378619-63378641 GGTGTGGCCCTCCTGCCTGGGGG - Intergenic
1054400438 9:64711552-64711574 GGTGTGGCCCTCCTGCCTGGGGG - Intergenic
1054434028 9:65195808-65195830 GGTGTGGCCCTCCTGCCTGGGGG - Intergenic
1054496359 9:65825860-65825882 GGTGTGGCCCTCCTGCCTGGGGG + Intergenic
1056580081 9:87884046-87884068 GGTGAGGCTCTGCTGCCCCCCGG + Exonic
1056823284 9:89859563-89859585 GGCATGACCCTTCTGCCCCTGGG - Intergenic
1057209737 9:93193216-93193238 GGCAGGGCCCTCCTACCCCTGGG - Intronic
1057314828 9:93961377-93961399 GGCCTGGCCTCCCTGCCACCAGG - Intergenic
1057512155 9:95689778-95689800 TTCCTGGCTCTCCTGCCCCCTGG + Intergenic
1057906826 9:98989837-98989859 GGCCTGGACCTCCTCCCTCCTGG + Intronic
1060554059 9:124499331-124499353 GGCATGGCCTTCTTTCCCCCTGG - Intronic
1061039671 9:128132720-128132742 GGCATGACCCTTCTGCCCCTGGG + Intergenic
1061248504 9:129413631-129413653 GGCGTCCTCCTCCTGCACCCCGG - Intergenic
1061750118 9:132771262-132771284 GGCCTGGCCCTCCTGCCCACAGG + Intronic
1061781662 9:132999820-132999842 TGCCTGGCCCTCCTGCTCCCAGG - Intergenic
1061801621 9:133116143-133116165 TCCGTGACCCTCCTGCCCTCGGG + Intronic
1061852298 9:133423417-133423439 GGCTGGCCCCTCCTGCCCCATGG + Intronic
1061959336 9:133980073-133980095 GTCCTGGGCCTCCTGCTCCCGGG - Intronic
1062261338 9:135664674-135664696 GGAGTGGAGCTCCAGCCCCCTGG - Intronic
1062413121 9:136434627-136434649 GGCTCTGCCCTCCTGGCCCCAGG + Intronic
1062428968 9:136518493-136518515 ACTGTGGCCCTCCTGCACCCAGG - Intronic
1062521150 9:136958551-136958573 GGCGGTGCCCTCCTCCTCCCTGG + Intergenic
1189856480 X:45229530-45229552 GACGTGGGCCTCCTGCTCCATGG - Intergenic
1192340613 X:70260259-70260281 GGCCTGTCCCTCCTCCCACCTGG + Intergenic
1199881198 X:151975052-151975074 GGCGACCCCCTCCTGCCCGCTGG + Intergenic
1200151140 X:153952064-153952086 GGCCTGGCCCTCCTGACCCTCGG + Exonic
1200204017 X:154302972-154302994 AGCGTGGCCCTGCTGCCACCTGG + Intronic