ID: 926101436

View in Genome Browser
Species Human (GRCh38)
Location 2:10120730-10120752
Sequence TGACTCAGGTTTAGCGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926101429_926101436 9 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101436 2:10120730-10120752 TGACTCAGGTTTAGCGCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
926101420_926101436 28 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101436 2:10120730-10120752 TGACTCAGGTTTAGCGCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
926101430_926101436 4 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101436 2:10120730-10120752 TGACTCAGGTTTAGCGCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926101436 Original CRISPR TGACTCAGGTTTAGCGCGGG AGG Intergenic
906647786 1:47488412-47488434 GGACTCAGGTTTAGGGCAGGGGG - Intergenic
910701963 1:90085124-90085146 TGACTCAGATTTAGCTAGTGAGG + Intergenic
912387223 1:109277526-109277548 TGAAGCAGGTTTAGAGTGGGAGG + Intergenic
912878906 1:113390234-113390256 TGACTGAAGTTTAGAGAGGGTGG - Intergenic
918559372 1:185846224-185846246 AGACTCAGGTTGAGGGCTGGGGG - Intronic
1065784619 10:29201889-29201911 TGACTCACGTGGAGCTCGGGGGG + Intergenic
1066689270 10:38010696-38010718 TTTCTCAGGTTTTGCGTGGGAGG + Exonic
1067003416 10:42638539-42638561 TGTCTCACGTTTTGCGTGGGAGG - Exonic
1069799158 10:71071530-71071552 TGACTCAGGTGTATTGAGGGGGG + Intergenic
1073267738 10:102238349-102238371 GGACTCAGGTTCAGGACGGGAGG - Intronic
1075577186 10:123585862-123585884 TGACTCAGGTGTGCGGCGGGAGG - Intergenic
1077370158 11:2177994-2178016 TGGCTCAGGCTTAGGGCTGGAGG - Intergenic
1078986819 11:16605671-16605693 TGACACTGGTTGAGGGCGGGCGG - Intronic
1081808658 11:45903301-45903323 TGATCCAGGTTTAGCGGGGCAGG - Intronic
1113459592 13:110472687-110472709 TCACTCAGTTTTAGGGCTGGGGG + Intronic
1122855509 14:104558093-104558115 GGACTCAGGTTTGGCTAGGGAGG + Intronic
1129975817 15:79820819-79820841 TGACTCAGATTTTGGGCAGGTGG - Intergenic
1148855486 17:50576850-50576872 AGACTCAGGTTTAGCCAGTGGGG - Intronic
1149152008 17:53577919-53577941 TGTCCCAGGTTTAGTGAGGGAGG - Intergenic
1157275929 18:46311194-46311216 GGACTCAGGCCTAGGGCGGGCGG - Intergenic
1157594480 18:48855850-48855872 TGACTGAGGTTTTGAGCTGGAGG + Intronic
1167272514 19:48513845-48513867 TGAGGCAGGTTCATCGCGGGAGG + Intergenic
926101436 2:10120730-10120752 TGACTCAGGTTTAGCGCGGGAGG + Intergenic
926685325 2:15693464-15693486 AGACTCAGGCTTAACCCGGGAGG + Intronic
948719868 2:239892832-239892854 TGAGTCAGGTTTATCCCAGGAGG + Intronic
1170498986 20:16955356-16955378 TGACTCAGTTTGAGTGCTGGAGG - Intergenic
952942270 3:38454015-38454037 CGACTCAGGCATAGCGCGGCGGG - Exonic
982115545 4:152095861-152095883 TGACTCAGGTATAGCCAGTGAGG - Intergenic
1034590497 7:152134090-152134112 TGGCGCAGGTTTAGCTCGCGTGG - Intergenic
1035759793 8:2061167-2061189 TGTCTCCGGTTTAGTGAGGGAGG + Intronic
1044123284 8:88425025-88425047 TGAGTCAGGCTGAGCGGGGGAGG + Intergenic
1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG + Intronic
1192244343 X:69360414-69360436 GGACTCAGGTTGAGAGTGGGTGG + Intergenic