ID: 926101437

View in Genome Browser
Species Human (GRCh38)
Location 2:10120731-10120753
Sequence GACTCAGGTTTAGCGCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926101430_926101437 5 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC No data
Right 926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
926101429_926101437 10 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC No data
Right 926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
926101420_926101437 29 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG No data
Right 926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926101437 Original CRISPR GACTCAGGTTTAGCGCGGGA GGG Intergenic