ID: 926101437

View in Genome Browser
Species Human (GRCh38)
Location 2:10120731-10120753
Sequence GACTCAGGTTTAGCGCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926101420_926101437 29 Left 926101420 2:10120679-10120701 CCGCAGCGGGGCAAAGTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
926101430_926101437 5 Left 926101430 2:10120703-10120725 CCTGGGGGCAGGAGGGCCACGCC 0: 1
1: 0
2: 5
3: 28
4: 331
Right 926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
926101429_926101437 10 Left 926101429 2:10120698-10120720 CCGGACCTGGGGGCAGGAGGGCC 0: 1
1: 0
2: 2
3: 55
4: 421
Right 926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926101437 Original CRISPR GACTCAGGTTTAGCGCGGGA GGG Intergenic
916202240 1:162283338-162283360 GCCTCAGGTTTAGGGCTGGCTGG + Intronic
920038713 1:203082522-203082544 GATTCAGATTTAGCTCGGGGAGG - Intergenic
1070479701 10:76870235-76870257 GACTCAGGGTCAGCGTGGGAAGG - Intronic
1073267737 10:102238348-102238370 GACTCAGGTTCAGGACGGGAGGG - Intronic
1077370157 11:2177993-2178015 GGCTCAGGCTTAGGGCTGGAGGG - Intergenic
1112816381 13:103278587-103278609 AACTGAGGTTTAGCCCAGGAGGG - Intergenic
1124612822 15:31220235-31220257 GACACAGGCTGAGCGGGGGATGG - Intergenic
1136592429 16:31225351-31225373 AACTAAGGTTGAGCGAGGGAGGG + Intronic
1139473988 16:67193335-67193357 GACTCAGGTCCACCGGGGGAGGG - Intronic
1140723243 16:77789221-77789243 AACTCAGCTTTCGCACGGGAGGG + Intronic
1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG + Intergenic
1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG + Intronic
1145024543 17:19458110-19458132 GACTCAGGCCTAGCAGGGGAAGG + Intergenic
1164088685 19:21928427-21928449 GACTCTTTTTTAGGGCGGGAAGG + Intergenic
1167272515 19:48513846-48513868 GAGGCAGGTTCATCGCGGGAGGG + Intergenic
1167820937 19:51927274-51927296 TATTCAGGGATAGCGCGGGACGG - Exonic
1167903843 19:52642121-52642143 GACTCAGGTGTACAGAGGGACGG + Intronic
925371913 2:3351942-3351964 GACTCACGTTTCGGGTGGGATGG - Intronic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
932773476 2:74514273-74514295 GAGCCAGGCTCAGCGCGGGAGGG - Intronic
1182353862 22:29713426-29713448 GACCCAGCTGTAGCTCGGGAAGG + Intergenic
952942269 3:38454014-38454036 GACTCAGGCATAGCGCGGCGGGG - Exonic
960996807 3:123345589-123345611 GGCTCAGGTTTAAAGTGGGAAGG - Intronic
969180618 4:5437809-5437831 TACACAGGTTTAGAGCTGGAAGG - Intronic
1001542513 5:172549531-172549553 GACTCAGGCTTTGTCCGGGAAGG + Intergenic
1001672215 5:173483229-173483251 GACCAAGGTTTAGAGCTGGAAGG - Intergenic
1007759971 6:44127851-44127873 GACTCACATTTGGCTCGGGATGG - Intronic
1035759794 8:2061168-2061190 GTCTCCGGTTTAGTGAGGGAGGG + Intronic
1049731237 8:144179614-144179636 GACTCAGGCCTAGCTTGGGAAGG + Intronic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1190689009 X:52898049-52898071 GTCTCATGTTTAGAGAGGGAGGG + Exonic
1190696974 X:52957743-52957765 GTCTCATGTTTAGAGAGGGAGGG - Intronic
1192244344 X:69360415-69360437 GACTCAGGTTGAGAGTGGGTGGG + Intergenic