ID: 926101747

View in Genome Browser
Species Human (GRCh38)
Location 2:10122504-10122526
Sequence CGTCCACGGGGGTGTCCCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926101738_926101747 -5 Left 926101738 2:10122486-10122508 CCGGGAGGTCCCGGGGGGCGTCC 0: 1
1: 0
2: 1
3: 17
4: 135
Right 926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 46
926101728_926101747 19 Left 926101728 2:10122462-10122484 CCAGCGGACGGGCCGGGGGGGGA 0: 1
1: 0
2: 0
3: 18
4: 217
Right 926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 46
926101721_926101747 24 Left 926101721 2:10122457-10122479 CCCAGCCAGCGGACGGGCCGGGG 0: 1
1: 0
2: 0
3: 13
4: 141
Right 926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 46
926101723_926101747 23 Left 926101723 2:10122458-10122480 CCAGCCAGCGGACGGGCCGGGGG 0: 1
1: 0
2: 2
3: 19
4: 189
Right 926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 46
926101715_926101747 30 Left 926101715 2:10122451-10122473 CCCCGACCCAGCCAGCGGACGGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 46
926101718_926101747 28 Left 926101718 2:10122453-10122475 CCGACCCAGCCAGCGGACGGGCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 46
926101732_926101747 7 Left 926101732 2:10122474-10122496 CCGGGGGGGGAACCGGGAGGTCC 0: 1
1: 0
2: 19
3: 8
4: 140
Right 926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 46
926101717_926101747 29 Left 926101717 2:10122452-10122474 CCCGACCCAGCCAGCGGACGGGC 0: 1
1: 0
2: 0
3: 8
4: 115
Right 926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926101747 Original CRISPR CGTCCACGGGGGTGTCCCCG GGG Exonic