ID: 926103012

View in Genome Browser
Species Human (GRCh38)
Location 2:10132632-10132654
Sequence CTGAAGTATTTTGGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926103002_926103012 30 Left 926103002 2:10132579-10132601 CCAAGGATCAGGTATTTAAGTGA 0: 1
1: 0
2: 0
3: 9
4: 145
Right 926103012 2:10132632-10132654 CTGAAGTATTTTGGGGTGGATGG 0: 1
1: 0
2: 5
3: 52
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926103012 Original CRISPR CTGAAGTATTTTGGGGTGGA TGG Intergenic
901584312 1:10275028-10275050 CTGAAGTGTTTAGGGGTAAATGG + Intronic
902626777 1:17681249-17681271 CCGAAGTATTTAGGGGTAAAGGG - Intronic
902876212 1:19342379-19342401 CTGAAGCATGGGGGGGTGGACGG + Intronic
902968778 1:20031648-20031670 AGGAAGAATTTTGGGGTGGGGGG + Intronic
903890084 1:26563792-26563814 CTTCAGTTTTTTGGGGGGGATGG + Intronic
904045576 1:27606324-27606346 CTGAAGTAGCCTGGGGTGGGAGG - Intergenic
904376349 1:30084812-30084834 CTGAAGTCTTATGAGGTGGGTGG + Intergenic
905210187 1:36368901-36368923 CTCAAGTGTTTTGGGGTGAAGGG + Intronic
905510919 1:38519270-38519292 CTGAAGTCTTTAGGGGTAAAGGG + Intergenic
906195342 1:43927022-43927044 ATGAAGTATTTATGGTTGGAGGG - Intronic
906630605 1:47364073-47364095 CTGCAGCATTTTGGGGTGTTTGG + Intronic
908136904 1:61142717-61142739 CTGAAGTGTTTTCGGGAGGGAGG + Intronic
908276288 1:62475247-62475269 CTGAAGCATTTTGGGGTCTGCGG + Exonic
909279140 1:73726357-73726379 CTGATGTATTTTCTGGTGCATGG + Intergenic
910968233 1:92829276-92829298 CTGAACTATTTTGGAGTAGTGGG - Intergenic
911089069 1:94003046-94003068 CTGAAGTATTTAGGAGTGAAGGG - Intronic
912435884 1:109660695-109660717 CTGAGGGATTTGGGGGAGGATGG + Intronic
912573575 1:110643310-110643332 CTTCAGTATTTGGGGGTGGGGGG - Intergenic
912690852 1:111803630-111803652 CTGAAGTATTTATGGGTGAAAGG + Intronic
913021779 1:114795357-114795379 CTAAAGTACTCTGGGATGGAGGG + Intergenic
915259658 1:154667675-154667697 CTAAAGTATTTGGGGGTAAAGGG - Intergenic
916431051 1:164728814-164728836 CTGAAATATGTTGCGGTGGGTGG - Intronic
917996965 1:180450005-180450027 TTGAAGATTTTTGGGGTGGGGGG - Intronic
919768725 1:201143710-201143732 TTGAAGCATTTTGGGGAGGTGGG + Intronic
1064333921 10:14421128-14421150 CTGAAGTATTTAGTGGTAAAGGG + Intronic
1065590575 10:27258155-27258177 ATGCACTATCTTGGGGTGGAGGG - Intergenic
1067316085 10:45164362-45164384 CTGCAGTGTTTTAGGGTGAAGGG + Intergenic
1067938989 10:50636507-50636529 GTGAAGTATTGTGGGGTGGAAGG - Intergenic
1068946378 10:62733650-62733672 AAAAAGTATTTTGGGGTGGTGGG + Intergenic
1068996930 10:63217134-63217156 TTGATGTATTTTGGGGGGCATGG + Intronic
1069356787 10:67596237-67596259 CTTAAGTGTTTTGTGGTGGCTGG + Intronic
1070239569 10:74665028-74665050 CTGAAGTATTAAGGGGTAAAAGG + Intronic
1070443475 10:76469442-76469464 CTCAAGAATGATGGGGTGGAGGG + Intronic
1071596577 10:86932224-86932246 CTGAAGTATTTAGGGATAAAGGG - Exonic
1072002197 10:91207487-91207509 CTGAAGTATTTAGAGGTAAAGGG - Intronic
1072683043 10:97520567-97520589 ATGAATTATTTTGGAATGGAGGG + Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075786923 10:125056462-125056484 CTGAAGGCATCTGGGGTGGAGGG - Intronic
1075818072 10:125281474-125281496 CTGAAGTATTTAGGGGTGATAGG + Intergenic
1075896749 10:126002824-126002846 CTGACGTATTGAGGGGTGAAGGG - Intronic
1075977883 10:126712497-126712519 CTGAAGAATTTAGGGGTAAAAGG + Intergenic
1076492470 10:130871979-130872001 CACAAGTAGTTTGGGGTGGCAGG - Intergenic
1076862737 10:133148249-133148271 CTGAAGTTTTTTTGGTTGGTAGG - Intergenic
1078744816 11:14102035-14102057 CTGAAGTATTTAGAGGTAAAAGG - Intronic
1079481239 11:20882607-20882629 CTGAAGTATTTAGGGGTAGAGGG - Intronic
1080029109 11:27642425-27642447 ATGAAGTATTTAGAGCTGGAGGG + Intergenic
1080642815 11:34167594-34167616 TAGAAGTATTTGGGGATGGAAGG + Intronic
1081616362 11:44593549-44593571 CTGGGGTCTTTTGGAGTGGAGGG + Intronic
1083663062 11:64260933-64260955 CTGAAGTATTTATGGGTAAAGGG + Intronic
1084083190 11:66842700-66842722 CTGCAGGGTTTTGGTGTGGATGG + Intronic
1084122451 11:67077586-67077608 CTGAAGGATTTGGGGGAGGAGGG - Intergenic
1084163521 11:67364323-67364345 CAGTAGCATTTTGGGGTGTAGGG - Exonic
1087220819 11:95544495-95544517 TTGAAGTTTTTAGGGGTGCAGGG - Intergenic
1088671048 11:112140951-112140973 ATGCATTATTTTGGGGTTGAGGG - Intronic
1088699920 11:112402765-112402787 ATGAAGTTTTGTGGGGAGGAAGG - Intergenic
1088782400 11:113148731-113148753 CTGCAGTAGTTTTGGGTGGAGGG + Intronic
1089992276 11:122872813-122872835 CTGAAGGATTTGGGGGGTGATGG - Intergenic
1090997367 11:131878885-131878907 CTGGAGTATTTAGGGGTGGTGGG - Intronic
1092214677 12:6672645-6672667 CTGGAGTGTTTTTGGGAGGAGGG - Intronic
1093512161 12:19942256-19942278 CTGAAGTATTTTGTGGAGGCAGG + Intergenic
1093560859 12:20538252-20538274 CTTCAGGATGTTGGGGTGGAGGG + Intronic
1094300312 12:28957340-28957362 TTGAAGTCTTTTTGGGAGGAGGG - Intergenic
1095416741 12:41985456-41985478 ATGAAGTATTTTGGGCAGTATGG - Intergenic
1096280164 12:50245899-50245921 CTGAAATATTTTGGGGGCCAGGG - Intronic
1096431223 12:51544872-51544894 CTGAAGTATTTAGGAGTAAAGGG - Intergenic
1097981370 12:65741135-65741157 CGGAAATAATTTGGGGTGAAGGG + Intergenic
1098266992 12:68731715-68731737 CTGAGGTAATTTGGGATGGGGGG + Exonic
1101577331 12:106010023-106010045 CTGAAGTATTAAGAGGTGAAGGG + Intergenic
1102145752 12:110653960-110653982 TTGAAGTATTTAGGAGTGAAGGG + Intronic
1102196745 12:111031317-111031339 CTGAAGTATTTAGGGATAAAGGG - Intergenic
1102676634 12:114664019-114664041 CTGACGTATGTGGAGGTGGAAGG + Intergenic
1102765871 12:115432631-115432653 CATAAGTATTTAGGGCTGGATGG - Intergenic
1104296801 12:127523266-127523288 CTTAAGTAATTTGGGGTGACTGG + Intergenic
1104502380 12:129298604-129298626 CAGAAAGATTGTGGGGTGGATGG - Intronic
1105208592 13:18243584-18243606 CTGAAATAATGTGGGGTAGAGGG + Intergenic
1106314416 13:28580459-28580481 ATGAATTGGTTTGGGGTGGAAGG + Intergenic
1107139738 13:36984957-36984979 CTGACGTATTGTGTGGTGGTAGG + Intronic
1108682854 13:52794260-52794282 CAGAAATATATTGGAGTGGAGGG - Intergenic
1108775765 13:53763080-53763102 TTGAAGTATTTTGGGGGGGGGGG - Intergenic
1109764032 13:66869855-66869877 CAAAAATATTTTGGGATGGAAGG + Intronic
1109915391 13:68978572-68978594 CTGCAGCATTTTTGGGGGGACGG + Intergenic
1110899374 13:80801476-80801498 CTGGAGTATTTTAGGTTGAAAGG - Intergenic
1111339652 13:86866955-86866977 CTGAAGTATTTAGGGGTAAAGGG - Intergenic
1112665832 13:101572259-101572281 CTGAAGTAGTTTGGAGCAGAAGG + Intronic
1112800144 13:103101429-103101451 ATGCAATATTGTGGGGTGGAGGG - Intergenic
1114698093 14:24646177-24646199 CTGAGGTCTTTTCAGGTGGAAGG - Intergenic
1117127266 14:52642569-52642591 CTGAAGTATTTAGGGTTTAAGGG + Exonic
1117613828 14:57512304-57512326 ATGAAGTATTTTGTTGTGGGTGG + Intergenic
1117959544 14:61149154-61149176 CTGAACCTGTTTGGGGTGGAGGG - Intergenic
1118515148 14:66520231-66520253 CTGTAGAATTTTGGGGTCAAGGG + Intronic
1118697595 14:68399693-68399715 CTGAAGTATTTGGGGATGAAAGG - Intronic
1119358610 14:74028405-74028427 CTGAAGTCTTCTGGGGTAAAAGG + Intronic
1120719062 14:87870704-87870726 TTGATGTGTTTTGGGGAGGAAGG - Intronic
1120724239 14:87919923-87919945 CTTAAGTATTTTGGGGAGATGGG - Intronic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1121378321 14:93434501-93434523 CAGAAAAAGTTTGGGGTGGAGGG - Intronic
1122704786 14:103613903-103613925 CTGAAGCATTTAGGAGTGAAGGG + Intronic
1123806875 15:23882881-23882903 CTACAGTATTTAGGGATGGAAGG - Intergenic
1125370377 15:38969687-38969709 CTGAAGGATTGTGAGCTGGAAGG - Intergenic
1126249823 15:46554438-46554460 CTGAAGTATGTAGGGGTAGCAGG - Intergenic
1128584579 15:68837031-68837053 TTGAAGTATTTTTTGGTGGAGGG - Intronic
1129105954 15:73307406-73307428 CTGAAATAATTAGGGGTGGAGGG + Intergenic
1129964925 15:79725970-79725992 CTGAAGAGTTTCGGGTTGGAGGG + Intergenic
1130226335 15:82061077-82061099 CTGAAGAATTTAGGGGTAAAGGG - Intergenic
1130234524 15:82121739-82121761 CTGAAATATTTGGGAGTGGGAGG + Intergenic
1131037422 15:89232430-89232452 CTGAAGTATTTAGGAGTAGAAGG - Intergenic
1131176468 15:90212331-90212353 CTGAAGCCTGTCGGGGTGGAGGG + Intronic
1132126099 15:99226331-99226353 CTGAAGAATTTGGGGGTAAAGGG + Intronic
1133178088 16:4031261-4031283 CTGAAGAATTTAAGGGTGCAGGG + Intronic
1133862694 16:9611193-9611215 CAGAATTATTTTGGGCTGAAAGG - Intergenic
1133906420 16:10026786-10026808 CTGCATTGTTTTGGGGTGGGAGG - Intronic
1134318166 16:13138959-13138981 CTGAAGCATTGCGGGATGGAGGG + Intronic
1135929520 16:26724794-26724816 ATGAAGTATTTTGGTGTTCATGG + Intergenic
1137385478 16:48038695-48038717 CAGAAGTATTTTTAGGTTGAAGG - Intergenic
1137578519 16:49619947-49619969 CTGCAGCATTTTGGAGGGGAAGG - Intronic
1138359342 16:56413996-56414018 CTGAAGTATTTAGGGGTAAAGGG + Intronic
1139313191 16:66044310-66044332 GTGAAGTATGGTGGGGTAGATGG + Intergenic
1140196219 16:72857875-72857897 ATGAAGGATTTTGGTGGGGAAGG - Intronic
1141269072 16:82522528-82522550 CTGAAGTAAATGGTGGTGGAGGG + Intergenic
1143070486 17:4288041-4288063 CTGAAACATTTTGGGGTGAAGGG + Intronic
1143532604 17:7513913-7513935 GGGGAGTATTTTGGGGTGGTGGG - Exonic
1144537718 17:16107247-16107269 CAGAAGAATTTTGGTGGGGAGGG - Intronic
1146419978 17:32674802-32674824 CTGATGTATTTTGGGATGCAGGG - Intronic
1146746588 17:35336253-35336275 CTGAAGTATTTAGAGGTAAATGG + Intergenic
1146756533 17:35437017-35437039 CTGAAGTATTTAGTGGTAAATGG + Exonic
1147190181 17:38733869-38733891 CTGTAGTTCTTTGGGGTGGAGGG - Exonic
1147510105 17:41060713-41060735 CTGTACTATTTGGGGGTGGAGGG + Intergenic
1147618496 17:41845803-41845825 CTGCTCTTTTTTGGGGTGGATGG + Intronic
1148119381 17:45198853-45198875 CTGAAGTATTTGGGGGCAAAGGG - Intergenic
1149293891 17:55243204-55243226 ATGAAGTTTTTTTGGGGGGATGG - Intergenic
1149524419 17:57343519-57343541 CTGATGTATTTAGGAGTGGAGGG - Intronic
1149681187 17:58508421-58508443 CGGAAGTAGTTTGGTGTGGAAGG + Intronic
1150271856 17:63871972-63871994 CTATAATATTATGGGGTGGAAGG - Intergenic
1150275405 17:63894873-63894895 CTATAATATTATGGGGTGGAAGG - Intergenic
1150277536 17:63909562-63909584 CTATAATATTATGGGGTGGAAGG - Intergenic
1150278826 17:63917158-63917180 CTATAATATTATGGGGTGGAGGG - Intronic
1150796704 17:68244256-68244278 CTGAGATATTTTGGAGTGCAGGG + Intergenic
1151595326 17:75074890-75074912 CTGATGTGTTTGTGGGTGGAGGG - Intergenic
1153452475 18:5244985-5245007 TTGAATTGTTTTGGGGTGGGGGG + Intergenic
1155310639 18:24519418-24519440 CTCAAGTATTCTGGGGTAAAGGG - Intergenic
1155476582 18:26241213-26241235 CTGGAGTATTTTTGGTTGGTAGG + Intronic
1156372636 18:36485072-36485094 CTTGAGCATTTGGGGGTGGATGG + Intronic
1157578094 18:48757293-48757315 ATGAAGTTTTGCGGGGTGGATGG + Intronic
1157585375 18:48797644-48797666 CTGTGGTATTCTGGGGTGGGGGG + Intronic
1158473088 18:57755958-57755980 CTGAAGTATTTAGGGGTAAAGGG - Intronic
1163669759 19:18620636-18620658 AGGAAGGATTTGGGGGTGGAGGG - Exonic
1163823042 19:19507208-19507230 TTGATGTTTTTTGGGGTGGGAGG + Exonic
1164065395 19:21710576-21710598 GTGAAGTTTTTTGGGGGGGGGGG - Intergenic
1164924245 19:32114823-32114845 ATGAAGTATTTAGGGGTAAAGGG + Intergenic
1165704244 19:37964090-37964112 CTGAAATATTTATGGGTGAAGGG - Intronic
1166319258 19:42006292-42006314 CTTTTGTATTTTGGGGTGGTGGG - Intronic
1167037468 19:47002691-47002713 CTCACGTAATTGGGGGTGGAGGG + Exonic
1168318120 19:55493138-55493160 CTGATGTCCTTTGGGGAGGAAGG - Intronic
926024633 2:9530774-9530796 CAGAAGTATTTAGGGGTGAAGGG + Intronic
926103012 2:10132632-10132654 CTGAAGTATTTTGGGGTGGATGG + Intergenic
926633004 2:15154674-15154696 CTGGTGGCTTTTGGGGTGGAAGG - Intergenic
928025314 2:27734918-27734940 CTGAAGTATTTAGGGATAAAGGG - Intergenic
928156411 2:28881011-28881033 CTGAAGTATTTAGGGATAAAGGG - Intergenic
928179273 2:29056527-29056549 CTAGAGTATTCTGGGGTTGACGG + Exonic
929201420 2:39241187-39241209 CTGAAGTATTTACGGGTGAAGGG + Intergenic
929584170 2:43103029-43103051 CTGAAGTATTTAAGGGTAAAGGG + Intergenic
929590772 2:43144519-43144541 CTGAAGTATTTAGAGGTAAAAGG + Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930072177 2:47375614-47375636 CTGAAGTACTTAGGGGTAAAGGG - Intronic
930371287 2:50504356-50504378 CTGAAGTATTTCGGGTTAAAGGG + Intronic
930995201 2:57708618-57708640 CTGACTTTTTTTGGGGTAGAGGG + Intergenic
931138368 2:59429958-59429980 CTGTAGTATTTTCTTGTGGAAGG - Intergenic
932290220 2:70570878-70570900 GAGAGGTATATTGGGGTGGACGG - Intergenic
932328295 2:70879410-70879432 CTGGACTATTTTGGGGTGGTGGG - Intergenic
932708385 2:74044781-74044803 CTGAAGTATTTAGGAGTAAAGGG - Intronic
932762193 2:74445498-74445520 CTGAAGATTTTTGGGAAGGAGGG + Intergenic
932988905 2:76762468-76762490 TTGAAGTAGTTTGGGGTGAAGGG - Intronic
936453126 2:112648267-112648289 CTGAAGTTTTTTTGGGGGGCGGG - Intronic
936641512 2:114317166-114317188 CTGAAGTACTTTGGGGTCCTAGG - Intergenic
937963151 2:127478827-127478849 CTGAAGTATTTGGGGCTCAAGGG + Intronic
940341138 2:152582697-152582719 AGGAAGTATGTTTGGGTGGATGG + Intronic
941469525 2:165867192-165867214 CTGAAGTACTTAGGGGTACAGGG + Intronic
941790204 2:169544076-169544098 CTAAAGTAATTAGGGATGGAGGG + Intronic
942211978 2:173680410-173680432 CTGAAGTATTTAGGTGTAAAGGG + Intergenic
943703678 2:191013373-191013395 CTATATTATTTTGGGGTGGGGGG + Intronic
944904002 2:204244430-204244452 ATGAGGGATTTTGGGGAGGATGG + Intergenic
946126828 2:217570031-217570053 CTGAAAGATTTTTGGGTGGCAGG - Intronic
946283287 2:218682360-218682382 CTAAAGTATTTAGGGGTAAAGGG - Intronic
946565756 2:220963628-220963650 CTAAAGTATTTAGGGGTAAAGGG - Intergenic
946944734 2:224808973-224808995 CTGAAGTATTTGAGGGAGCAAGG + Intronic
947730004 2:232422589-232422611 CAGAAGTATTTTTTGGTGAAAGG - Intergenic
947804383 2:232955254-232955276 CTGAAGTATTTGGGGATGATGGG - Intronic
948501314 2:238397006-238397028 TTGAAGTCATTTGGGATGGAAGG + Intronic
948927269 2:241107313-241107335 GTGAAGTCATGTGGGGTGGAGGG + Intronic
1168812040 20:710495-710517 TTGAAGAATTGTGGGGCGGAGGG + Intergenic
1170257146 20:14357893-14357915 CCAAAGTTTTTTGGGGAGGAGGG - Intronic
1170849220 20:19989027-19989049 TTGAAGTATTTAGGGGTAAAGGG - Intronic
1171094628 20:22319592-22319614 CTGAAGTGTTTAGGAGTGAAGGG + Intergenic
1171824929 20:29887978-29888000 TTGAAGCATTTTGAGGTGTATGG - Intergenic
1172277687 20:33688948-33688970 CTGAAGGATTGTGGGACGGAGGG - Intergenic
1172586061 20:36085775-36085797 TTGCAGTATTTTGGGATGAAAGG + Intergenic
1172637090 20:36417232-36417254 GTGAAGTGTTGAGGGGTGGATGG + Intronic
1172729891 20:37077752-37077774 CTGAAGTATTTTTGGGTAAAGGG - Intronic
1172731028 20:37087905-37087927 GTGAAGTATTTTGGGGTAAAAGG + Intronic
1172911119 20:38409764-38409786 CTGAAGTATTAAGGGGTAAAGGG + Intergenic
1173170867 20:40722507-40722529 CTGAAGTCTTCTGGGGCTGAGGG - Intergenic
1173592920 20:44239490-44239512 TTGAAGTGTTTTGGGGCGGAAGG + Intergenic
1174797505 20:53534493-53534515 CTCAAGTGTTTTGGGGTTCATGG - Intergenic
1179079448 21:38157221-38157243 CTGAAATTTTTAGGGGTGGTTGG + Intronic
1180778638 22:18506639-18506661 CTGAAATAATGTGGGGTAGAGGG + Intergenic
1180811363 22:18763947-18763969 CTGAAATAATGTGGGGTAGAGGG + Intergenic
1181108778 22:20589660-20589682 CTCAAGGATTTGGGGGTGAACGG - Intergenic
1181197514 22:21198201-21198223 CTGAAATAATGTGGGGTAGAGGG + Intergenic
1181396052 22:22623073-22623095 CTGAAATAATGTGGGGTAGAGGG - Intergenic
1181704233 22:24638980-24639002 CTGAAATAATGTGGGGTAGAGGG - Intergenic
1182008328 22:26979744-26979766 ATGAAGTATTTCAGAGTGGATGG - Intergenic
1182747563 22:32617268-32617290 CTGAAGTATTTTCAGATGAAAGG + Intronic
1183965912 22:41442419-41442441 CTATTGTATTTTGGGGTGGGAGG - Intronic
1203229285 22_KI270731v1_random:96634-96656 CTGAAATAATGTGGGGTAGAGGG - Intergenic
950244221 3:11400608-11400630 AAGCAGTATTTTGGGGTGGGGGG - Intronic
950443030 3:13020884-13020906 CACAAGTATTTTGGGAAGGAAGG + Intronic
950739927 3:15042221-15042243 TTGAAGAAACTTGGGGTGGAGGG - Intronic
950885871 3:16362421-16362443 CACAAGTATTTTGGGGTCCAAGG + Intronic
951222337 3:20081996-20082018 TTGAAATATTTAGGGGAGGAAGG - Intronic
951379440 3:21965777-21965799 CTGAAGTATTTAGGGATAAAAGG + Intronic
952285765 3:31968144-31968166 CTGAAGTATTTAAGGGTAAAGGG - Intronic
953459723 3:43072760-43072782 CTGAAGACTTTTGGGGTGGCTGG + Intergenic
953503473 3:43460430-43460452 GTGAACTTTCTTGGGGTGGAAGG + Intronic
954258865 3:49424584-49424606 CTGGAGTGTTTTTGGGTAGAAGG + Exonic
954304023 3:49716193-49716215 CTGTAGTGTGTTGGGGTGCAGGG - Intronic
956631040 3:71316568-71316590 GGGAAGTAATTTGGGGAGGAAGG - Intronic
957664288 3:83204191-83204213 ATTAAGAATTTTGGGGTGGAAGG + Intergenic
957675328 3:83357098-83357120 TAGAAGGATTATGGGGTGGAGGG + Intergenic
957816125 3:85299633-85299655 CTGAAGTAATATGGGCTGCAAGG - Intronic
958897518 3:99845478-99845500 ATGAAATATGTGGGGGTGGAGGG - Intronic
959236067 3:103723098-103723120 CCTAAGTATTTTGGGGAGGATGG - Intergenic
959494418 3:107033050-107033072 CTGAAGTATTCTTTGCTGGAAGG - Intergenic
959874351 3:111364186-111364208 GTGATGTATTTGGTGGTGGAAGG + Intronic
961039773 3:123669589-123669611 CTGAAGTATTTAGGTGTAGAGGG + Intronic
963156533 3:142103529-142103551 CTAAAATATTTAGGAGTGGAGGG + Intronic
963388474 3:144627200-144627222 CTGAATTGCTTTGGAGTGGAGGG + Intergenic
963826967 3:149966298-149966320 CAGAATTATTTTGGGGGGGGAGG + Exonic
965661386 3:171045814-171045836 ATCAAGTACTTTGTGGTGGATGG + Intergenic
966298250 3:178449221-178449243 CTGAAGTGTTTTGGGGTATCAGG - Intronic
967286633 3:187877623-187877645 CTGAAGTATTTAGGAGTAAAAGG + Intergenic
967881954 3:194307782-194307804 CTGAAGTATTGTGGGGGAAATGG + Intergenic
968653775 4:1770122-1770144 ATGAAGTGTCTTGGGGTGGTGGG - Intergenic
971418100 4:26452126-26452148 CAGCTGTGTTTTGGGGTGGAAGG + Intergenic
972305341 4:37825220-37825242 ATGCAGTATTTTGGGGTGACGGG + Intergenic
972480874 4:39494639-39494661 CTGAAGTATTTAGGGGAAAAGGG + Intergenic
972801698 4:42482486-42482508 CTGAATAAATTTGGGGTGGGGGG + Intronic
972889672 4:43541312-43541334 CTGGAGTATTTAGAGGTGAAGGG - Intergenic
973746482 4:53968222-53968244 CTGAAGCATTCTGAGGTGGGAGG + Intronic
975477285 4:74837904-74837926 GTGAAGCTTTTTGGGGAGGAGGG + Intergenic
976307683 4:83577454-83577476 CTGAAGTATTTGGGGGTAATGGG + Intronic
976595422 4:86891321-86891343 GTGAAGTATTTTGAGGTGTCTGG - Intronic
978195308 4:105965155-105965177 CTCAAGAATTTTGGGGAGGGAGG - Intronic
979408274 4:120341696-120341718 ATGAAATATTTTGGGGAAGAGGG + Intergenic
980615182 4:135211443-135211465 TTTTAGTATTTTGGGGTGGCAGG - Intergenic
981976312 4:150733353-150733375 CTGAAGTATTTTGAGGTAGAAGG + Intronic
983553369 4:169038283-169038305 CTGAATTTTTTTGGGGGGGTGGG + Intergenic
984990389 4:185375033-185375055 CTGATGGATTTGGGGGTGGAGGG - Intronic
985190213 4:187364881-187364903 CTGAAGTATTTAGGAGTAAAGGG + Intergenic
985850895 5:2388400-2388422 CTGAATGAATTGGGGGTGGAGGG - Intergenic
986144809 5:5067382-5067404 CTGGAGTGTGTTGGGGTGGTCGG - Intergenic
986328649 5:6701397-6701419 CTGAAGGGGTTTGGGGTGGCCGG + Intergenic
987431843 5:17844627-17844649 GTGAAGCATTTTGGTGTTGAAGG + Intergenic
987856964 5:23432425-23432447 CTGAAGTATTTAGGGGTTAAGGG - Intergenic
988063129 5:26199498-26199520 GTGAAGTATTTTGGAGTGTGAGG - Intergenic
988504699 5:31811656-31811678 CTGAACTATTATGGGGTCGAGGG + Intronic
989464637 5:41740634-41740656 TTGAAGAATTCTTGGGTGGAAGG - Intronic
991069637 5:62462690-62462712 CTGAAGTATTTTATAGTGGCCGG - Intronic
991076333 5:62543314-62543336 CTGGAGTATTTTTGGTTGGTAGG + Intronic
991226879 5:64283967-64283989 CTTAAGTATTTTGTGGTGGCCGG + Intronic
991673808 5:69073450-69073472 CTAAAGTATTTAGGGGTGATTGG + Intergenic
995651462 5:114373732-114373754 TTGGAGTTTGTTGGGGTGGAAGG + Intronic
997533954 5:134601710-134601732 TTTAAATATTTTGGGGTGAAAGG - Exonic
998200907 5:140119482-140119504 CTGAATTAAATTTGGGTGGAAGG + Exonic
998269806 5:140696298-140696320 GTGGGCTATTTTGGGGTGGAAGG + Intronic
998582603 5:143394922-143394944 ATGAATTAATTGGGGGTGGAGGG - Intronic
999426629 5:151493224-151493246 CTCAAGTATTTTGGGGGGCGGGG - Intergenic
999587664 5:153108820-153108842 CTGAAGTAATATGGTGTGAAGGG - Intergenic
1000374633 5:160567872-160567894 CCGAAATAATTTGGGGTGAAAGG + Intronic
1001074273 5:168613863-168613885 CTGATGTATTTAGGGGTAAAGGG + Intergenic
1001240093 5:170062324-170062346 CTGGTGCATTTGGGGGTGGAGGG - Intronic
1001783465 5:174391013-174391035 CTGAAGTGCTGTGGGGTGTAGGG - Intergenic
1001973061 5:175972273-175972295 CTGAAATATTTAGGGGTAAAGGG - Intronic
1002017696 5:176338600-176338622 CTGAAGTATTGAGGGGTAGAGGG + Intronic
1002244373 5:177871509-177871531 CTGAAATATTTAGGGGTAAAGGG + Intergenic
1002339157 5:178503546-178503568 CTGAAGTATTTAGGGGTGAGGGG + Intronic
1002669492 5:180855074-180855096 CTGAAGTATTTAGGGATAAAGGG + Intronic
1003605393 6:7555452-7555474 CTGAAATATTTGGGGGTAGAAGG + Intronic
1003779694 6:9410484-9410506 CTGAAGTATTTAGGGGTAAAGGG - Intergenic
1003859091 6:10305399-10305421 ATGAAGTATTTTGGGGTTTTTGG + Intergenic
1003980861 6:11388517-11388539 CTGCAGTGTTTTGGGGCAGAGGG - Intergenic
1005679966 6:28197033-28197055 CTTCATTATTTTTGGGTGGAGGG + Intergenic
1005937948 6:30538602-30538624 ATGAAGTATTTAGGGGTGAATGG + Intergenic
1006381910 6:33703725-33703747 CTGAAATATTATGGGGTGAAGGG - Intronic
1006972968 6:38066029-38066051 CATAAGAATTTTGGGGTGGAAGG + Intronic
1010431853 6:75786823-75786845 CTGAAGTGTTTAGGGGTAAAGGG - Intronic
1013226120 6:108120206-108120228 CTGAAGTAAATAGGGGTGGGGGG + Intronic
1013565228 6:111352366-111352388 CTGATGGAAATTGGGGTGGAAGG + Intronic
1013572833 6:111447091-111447113 CTGATATATTTTGGGATGGTAGG - Intronic
1016376451 6:143425694-143425716 CTGAAGCATTTCGGGGTAAAGGG + Intronic
1017800746 6:157893691-157893713 CTGAAATATTGTGGAGTGAAAGG + Intronic
1018023067 6:159780997-159781019 CTGAAGTATTTTGTGGAGGCTGG - Exonic
1018297273 6:162362423-162362445 CTGAGATATTTGGGGGTGGGAGG + Intronic
1018392073 6:163348213-163348235 GTGAAGGATTTGGGGATGGAGGG + Intergenic
1020276102 7:6625514-6625536 CTGAATTTTTGGGGGGTGGAGGG - Intergenic
1022649732 7:32263459-32263481 CTTAAGTATTTAGGGGTAAAAGG - Intronic
1023217171 7:37875339-37875361 CTGAAGTATTTAGAGGTGATTGG + Intronic
1023345291 7:39265367-39265389 CTGAGGGAAGTTGGGGTGGAGGG - Intronic
1023691694 7:42795793-42795815 CTGAAGTATTTTGTGGAGGCTGG + Intergenic
1024309083 7:47952568-47952590 CAGAAGCATATTGGGGTGAAGGG - Intronic
1024729926 7:52242678-52242700 CTGCAGTGTTTTGGGGTCTACGG + Intergenic
1025767041 7:64465171-64465193 CTGAAGGATTAGGGGGTGGGGGG - Intergenic
1026125705 7:67577611-67577633 CTTAAGAGTTTTGGGGTGGCAGG - Intergenic
1027822092 7:83059894-83059916 CTGAAGTAGTTTGTAGTGCAAGG + Intronic
1028468688 7:91180955-91180977 GTGAAGTAATTTGGGTAGGAAGG - Intronic
1029543623 7:101198893-101198915 CGGAACTCTGTTGGGGTGGAGGG - Intronic
1031863536 7:127011907-127011929 CTCAAGTTTTTTGGTGTGGAAGG - Intronic
1033105878 7:138522710-138522732 CTGAATTATTAAGGGGTTGAAGG + Intronic
1034540206 7:151753365-151753387 CTGAAATATTTAGGGGTAAAGGG + Intronic
1034717145 7:153254080-153254102 CTGAAGTGTTTTGGTGTGGAGGG + Intergenic
1036060612 8:5314962-5314984 GTGAAGTATTTTCAGTTGGAAGG + Intergenic
1037601562 8:20400564-20400586 CTCCAGTGGTTTGGGGTGGAGGG + Intergenic
1037625853 8:20606320-20606342 CTGAAGAATTTAGGGGTGATGGG - Intergenic
1037898571 8:22674326-22674348 GTGAAGCATTTGGGGGTGGGTGG - Intergenic
1038539846 8:28383443-28383465 TTGAACTTTTCTGGGGTGGAGGG - Intronic
1041541540 8:58990595-58990617 CTGTAGAATTTTGGTGTTGATGG - Intronic
1042869015 8:73380622-73380644 ATGCAGTATGTTGGGGTGGGAGG - Intergenic
1047681353 8:127257601-127257623 GTCAAGCATTTTGGGGAGGAAGG + Intergenic
1051788858 9:20776660-20776682 CAGAAGTATTTTTAAGTGGATGG - Intronic
1052808244 9:33032787-33032809 CTGAAGTATTTGTGGGTTAATGG + Intronic
1054712739 9:68527843-68527865 TTGAAGTGTTTTGGGCTGAAAGG - Intronic
1054780803 9:69164471-69164493 TTAAAGTATTTTGGGGGTGAAGG + Intronic
1055266998 9:74505353-74505375 CTGAAATATTTTGGGGAAGATGG - Intronic
1055685244 9:78766400-78766422 GTGAAGTAGTTTGGGGTTGTGGG - Intergenic
1055756378 9:79562950-79562972 CTGAAGTTTTGGGGGATGGAGGG - Intergenic
1056705437 9:88948741-88948763 TTGTTATATTTTGGGGTGGAGGG + Intergenic
1056967955 9:91179893-91179915 CAGAATTATTTGGGGGAGGAGGG + Intergenic
1057012382 9:91616467-91616489 CTGAAGTATTTGGGGGTGATGGG + Intronic
1057293503 9:93821935-93821957 CCAAAGTATTTTGGGGTCAAGGG - Intergenic
1058683288 9:107458559-107458581 CTGAAGTATTTAGGGGTGAAAGG - Intergenic
1059009557 9:110441866-110441888 CTGAAGCATTTTAAGATGGATGG - Intronic
1060714528 9:125911056-125911078 CTAAAGTATTTGGGGTTGGGAGG - Intronic
1061335988 9:129936472-129936494 CTCAGGTAGTTTGGGGAGGAGGG - Intronic
1061518385 9:131102903-131102925 CAGCAGAATTTTGGGGTGGGCGG - Intronic
1185917846 X:4056037-4056059 CTGAAATATTTAGGAGTAGAAGG - Intergenic
1186645333 X:11500758-11500780 ATCAAGTCTTTTGGGGGGGAAGG + Intronic
1187095372 X:16142472-16142494 CTGAAATACTTAGGGGTGAAAGG - Intronic
1187121181 X:16407895-16407917 CTGATGTATTTTGAGTTGGCTGG + Intergenic
1187175261 X:16890354-16890376 CTGAAGTATTTAGGGGGTAAAGG + Intergenic
1187231103 X:17424071-17424093 CTAATCTACTTTGGGGTGGAGGG + Intronic
1187603084 X:20854139-20854161 CTGAAGTATATAGGGGTAAAGGG - Intergenic
1187695836 X:21918969-21918991 CCTAAGTATTTTGGGGCGGGGGG + Intergenic
1188479952 X:30627358-30627380 CTGACTTATTTTGGGGAAGAGGG - Intergenic
1189002333 X:36959497-36959519 CTGAAATATTTAGGGGTACAGGG + Intergenic
1189161953 X:38818400-38818422 CTGAAGTATTTATGGGTACAGGG + Intergenic
1189763596 X:44346813-44346835 CTGAAGTATTTAGGAGTCAAGGG - Intergenic
1190070185 X:47273117-47273139 CTGGAGTGTTTTTGGGTAGAAGG + Intergenic
1190406591 X:50094029-50094051 CTGAAGTGTTTGGGGGTAGAGGG - Exonic
1190461455 X:50680574-50680596 CTGAAGTATTTAGAGGTAAAGGG - Intronic
1191055625 X:56237132-56237154 ATGAATTTTTTTGGGGGGGATGG - Intronic
1191081268 X:56512524-56512546 ATAAAGTATTTTGGGGAGTATGG - Intergenic
1191105458 X:56769408-56769430 CTTGAGTATTTTGGGGGAGAAGG + Intergenic
1191106451 X:56774810-56774832 CTTGAGTATTTTGGGGGAGAAGG + Intergenic
1191107444 X:56780212-56780234 CTTGAGTATTTTGGGGGAGAAGG + Intergenic
1192204160 X:69085229-69085251 CTGAAGAAAATTGGGGTGGAAGG + Intergenic
1192315698 X:70049774-70049796 CTGAAGGATTTTAGGGTTGCAGG - Intronic
1192421182 X:71032701-71032723 CTGAAGTATTTAGGAGTATAGGG + Intergenic
1192615258 X:72614178-72614200 CTGAATTATTTAGGGTTAGATGG + Intronic
1193063276 X:77229712-77229734 ATGAATTATTTTGGGCTGTATGG - Intergenic
1194579140 X:95649882-95649904 CTGAAGCATTTAGGGATGAAGGG + Intergenic
1194738964 X:97549527-97549549 CTTAAGTATTCAGGGGTGAAGGG - Intronic
1195513870 X:105749192-105749214 CTGAAATATTTAGGGGTAAAGGG + Intronic
1195865506 X:109428723-109428745 CTGAAGTATTTAGAGGTAAAAGG + Intronic
1197224719 X:123945549-123945571 CTGAAATATTTAGGGGTAAAAGG - Intergenic
1197668552 X:129250059-129250081 CTGAAGTATTAAGGGGTAAAGGG - Intergenic
1197927339 X:131660697-131660719 CTGAAGTATTTAGGGTTAAATGG - Intergenic
1200657924 Y:5926055-5926077 CTAAAGTATTTCTTGGTGGAAGG - Intergenic
1200834238 Y:7717523-7717545 CAAAAGTATTTTGGGGTTGAAGG + Intergenic
1201683021 Y:16669970-16669992 TTTAAGGATTTTGAGGTGGATGG + Intergenic