ID: 926103524

View in Genome Browser
Species Human (GRCh38)
Location 2:10136244-10136266
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926103517_926103524 8 Left 926103517 2:10136213-10136235 CCACACTGGAATCTCAATAAAGG No data
Right 926103524 2:10136244-10136266 GTTGAGGCCCAGATGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr