ID: 926104377

View in Genome Browser
Species Human (GRCh38)
Location 2:10141313-10141335
Sequence GGGAGGGGATGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6504
Summary {0: 1, 1: 6, 2: 80, 3: 767, 4: 5650}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926104377_926104393 8 Left 926104377 2:10141313-10141335 CCATCTTCCCTCCATCCCCTCCC 0: 1
1: 6
2: 80
3: 767
4: 5650
Right 926104393 2:10141344-10141366 CATGTCTCACTCTGAGCCTTAGG 0: 1
1: 0
2: 1
3: 22
4: 251
926104377_926104394 9 Left 926104377 2:10141313-10141335 CCATCTTCCCTCCATCCCCTCCC 0: 1
1: 6
2: 80
3: 767
4: 5650
Right 926104394 2:10141345-10141367 ATGTCTCACTCTGAGCCTTAGGG 0: 1
1: 0
2: 0
3: 9
4: 169
926104377_926104395 15 Left 926104377 2:10141313-10141335 CCATCTTCCCTCCATCCCCTCCC 0: 1
1: 6
2: 80
3: 767
4: 5650
Right 926104395 2:10141351-10141373 CACTCTGAGCCTTAGGGAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926104377 Original CRISPR GGGAGGGGATGGAGGGAAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr