ID: 926104831

View in Genome Browser
Species Human (GRCh38)
Location 2:10143572-10143594
Sequence CGGTAACGTGCAGGTTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926104828_926104831 4 Left 926104828 2:10143545-10143567 CCGCAGGGGAAGCTGCTGTGTCT 0: 1
1: 0
2: 4
3: 42
4: 350
Right 926104831 2:10143572-10143594 CGGTAACGTGCAGGTTGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 31
926104827_926104831 5 Left 926104827 2:10143544-10143566 CCCGCAGGGGAAGCTGCTGTGTC 0: 1
1: 0
2: 2
3: 42
4: 285
Right 926104831 2:10143572-10143594 CGGTAACGTGCAGGTTGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926104831 Original CRISPR CGGTAACGTGCAGGTTGCAC TGG Intronic
905521645 1:38605115-38605137 CGATCACATGCAGGTTGCAATGG - Intergenic
912410327 1:109476763-109476785 CTGCCACCTGCAGGTTGCACCGG + Exonic
1066506415 10:36049285-36049307 CAGTGTCGTGCAGGTTGCACAGG - Intergenic
1081809269 11:45906114-45906136 CGGGCACTTGCAGGTGGCACAGG - Exonic
1096833984 12:54336599-54336621 CGGTGACCTGCAGCTTCCACAGG - Intronic
1101045743 12:100803977-100803999 CGGTAATGTGCAGGATGTGCAGG + Intronic
1105783138 13:23721612-23721634 CTGTAATGTGCAAATTGCACAGG + Intergenic
1107508000 13:41054816-41054838 TAGTAACGTGCAGGTTGAACTGG - Intronic
1110992067 13:82054669-82054691 AGGTAACTTGCATGTTGCAAGGG - Intergenic
1139771660 16:69281977-69281999 CGGGAAGGTGGAGGTTGCAGTGG - Intronic
1146543672 17:33719372-33719394 GGGTATGGAGCAGGTTGCACAGG - Intronic
1147232539 17:39029752-39029774 GGGGAACGTTCAGGTTCCACAGG - Intergenic
1148180277 17:45600454-45600476 CGGGCACTTGCAGGTGGCACAGG + Intergenic
1148268623 17:46245440-46245462 CGGGCACTTGCAGGTGGCACAGG - Intergenic
1160910373 19:1471177-1471199 CCGTAACGTGCAGGCTCCGCTGG - Exonic
926104831 2:10143572-10143594 CGGTAACGTGCAGGTTGCACTGG + Intronic
935329721 2:101968059-101968081 AGGTAAGGTGCATGGTGCACAGG - Intergenic
1177457509 21:21361066-21361088 TGGTAACATACAGGTTCCACTGG - Intronic
1179796852 21:43789855-43789877 CGGCCACGTGGAGGTTCCACAGG - Intronic
954684751 3:52364434-52364456 CAGTAAAGTGCAGGGTGCCCGGG + Intronic
956876000 3:73463913-73463935 GGGTAACGTGCAGGATGTGCAGG - Intronic
960414253 3:117364797-117364819 AGGAAACGTGCAGAATGCACAGG - Intergenic
968936697 4:3614745-3614767 CTGTGACGTGCAGGCTGCCCAGG - Intergenic
988729984 5:33962630-33962652 GGGTTTCGTGCAGGTTGCAGGGG - Intronic
1008440505 6:51527010-51527032 CGGCACCATGCAGGTTGCAAAGG + Intergenic
1019497821 7:1348608-1348630 CGGTAATGAGCAGGATGCAGAGG + Intergenic
1021059741 7:16096636-16096658 GGGTAGAGTGCAGGTTGCCCAGG + Intronic
1023338298 7:39192978-39193000 CGGTAAAGTGCAAGAAGCACTGG - Intronic
1024775243 7:52777335-52777357 CTGTGAGGTGCAGGCTGCACTGG + Intergenic
1035740962 8:1928525-1928547 CGGGAACGTACAGCATGCACAGG - Exonic
1035748070 8:1975477-1975499 CGGTATTGTGCACGCTGCACAGG + Intronic
1038217730 8:25578136-25578158 CAGTAACGTGTAGGTGCCACTGG + Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1186510545 X:10126867-10126889 AGGTAACGTGCAGGGCGCCCAGG - Intronic