ID: 926108580

View in Genome Browser
Species Human (GRCh38)
Location 2:10167766-10167788
Sequence AGTTATCTTCAGATGAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926108580_926108584 8 Left 926108580 2:10167766-10167788 CCTGTCCTCATCTGAAGATAACT 0: 1
1: 0
2: 1
3: 40
4: 367
Right 926108584 2:10167797-10167819 CTGATTTCTCTTCCCACACAAGG 0: 1
1: 0
2: 1
3: 29
4: 272
926108580_926108586 17 Left 926108580 2:10167766-10167788 CCTGTCCTCATCTGAAGATAACT 0: 1
1: 0
2: 1
3: 40
4: 367
Right 926108586 2:10167806-10167828 CTTCCCACACAAGGCCATGGTGG 0: 1
1: 0
2: 0
3: 24
4: 200
926108580_926108585 14 Left 926108580 2:10167766-10167788 CCTGTCCTCATCTGAAGATAACT 0: 1
1: 0
2: 1
3: 40
4: 367
Right 926108585 2:10167803-10167825 TCTCTTCCCACACAAGGCCATGG 0: 1
1: 1
2: 2
3: 27
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926108580 Original CRISPR AGTTATCTTCAGATGAGGAC AGG (reversed) Intronic
900531878 1:3158021-3158043 TATTATCTTGAGATGAGGAGAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902425003 1:16313580-16313602 AGTTATAATCAAATGAGCACAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904372990 1:30062374-30062396 AGTTATCTACAGAAGAGGATAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909523953 1:76601371-76601393 AGTTATTTTCAGATGAATAAAGG + Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912911939 1:113770051-113770073 AGTTAATTTCTGATGAGTACTGG + Intronic
914989366 1:152485180-152485202 AGTTTGGCTCAGATGAGGACTGG - Intergenic
915772658 1:158445199-158445221 TGTACTCTTCAGATAAGGACCGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920928242 1:210363108-210363130 TGGTATCTTCAGAAGAGTACAGG - Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923559016 1:235024338-235024360 AGCTATCTTCACATGACCACGGG - Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064774306 10:18758506-18758528 AGTCAAGTTAAGATGAGGACTGG - Intergenic
1064796749 10:19020615-19020637 AATTAGGTTTAGATGAGGACAGG - Intergenic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066788941 10:39042097-39042119 AATTATCTTCAGATAAAAACTGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069639038 10:69943330-69943352 TGTTGGCCTCAGATGAGGACAGG - Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069851869 10:71410650-71410672 AGTTAACTTCAGAGGATGACGGG - Intronic
1070028412 10:72653928-72653950 AGTTATCTTAAGAGGAGCAATGG - Intergenic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1071168002 10:82829349-82829371 CTTTATCTGCAGATGAGGTCTGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071523146 10:86343200-86343222 AGGTAGCTTAAGATGAGAACTGG - Intronic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072671523 10:97433369-97433391 AGTTATGCTCAGATGAACACTGG - Exonic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074458956 10:113619720-113619742 AGTTGTCTTCAGAGTAGGCCTGG - Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1079718436 11:23779653-23779675 AAGTATCTTTATATGAGGACAGG - Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081398125 11:42611451-42611473 AGTTATCTCCTGATGGGGACTGG - Intergenic
1082300314 11:50496898-50496920 AGGTATCTTCAGATAAAAACTGG - Intergenic
1082307457 11:50598095-50598117 AAATATCTTCAGATGAAAACAGG + Intergenic
1082308569 11:50615876-50615898 AATTATCTTCAGATAAAAACTGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083821549 11:65174175-65174197 AGTTATGCTCAGATGAACACTGG + Intergenic
1084411138 11:69006440-69006462 AGTTAACATCAGGTGAGGTCAGG - Intronic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090631901 11:128656900-128656922 AGCTCAGTTCAGATGAGGACAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092653588 12:10661137-10661159 AGTAATCTTCAAATCAGAACAGG + Intronic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095074611 12:37902487-37902509 AAATATCTTCAGATGAAAACTGG - Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096426089 12:51504418-51504440 AGTGATATTCATATGAGTACAGG - Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100336864 12:93639951-93639973 AGTTATGCTCAGATGAACACTGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101361597 12:104032392-104032414 AGTTATGCTCAGATGAACACTGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102097003 12:110248925-110248947 TCTTATCTGCAGATGAGGCCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104583364 12:130027515-130027537 AGTTATCTACAGTTGGGAACGGG + Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1111510150 13:89250584-89250606 AGTTATGTTCAGCCCAGGACTGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113252037 13:108464061-108464083 AGAAATCTTCAGAGGAGGAAGGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115143396 14:30199360-30199382 AGTTATCTCCAGAAGATAACAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117980286 14:61336170-61336192 AGTTAACTTCAGAAAAGGGCTGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1119776376 14:77251657-77251679 AGTTGTTATCAGAGGAGGACTGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1122292692 14:100688104-100688126 AGTGAACGTGAGATGAGGACCGG - Intergenic
1123088022 14:105726998-105727020 AGTCATCTTCAGATGAGACTTGG + Intergenic
1123103169 14:105819235-105819257 AATGATCTTGAGATGAGGAGAGG - Intergenic
1126323913 15:47454501-47454523 AGCTATCTTGAGATGGGCACTGG + Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133622492 16:7539763-7539785 AGTGAACTTCAGATGAGGCTTGG + Intronic
1134420836 16:14087404-14087426 ATTTATCTTGAGTTGAGGAGAGG + Intronic
1136054027 16:27674641-27674663 AAGAATCTCCAGATGAGGACAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146798343 17:35798764-35798786 AGTAATCTTCAGAGGAAGAAGGG - Intronic
1147546851 17:41408428-41408450 GTTTATCTTCAGAGGAGCACAGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152479793 17:80543046-80543068 TGTTGCCTTCAGATGAGAACGGG + Intergenic
1152753655 17:82078025-82078047 AGTTGGCTTCAGCTGAGGAGAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156018239 18:32570300-32570322 AGTTAACTCAAGATGAGGACTGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157869745 18:51218980-51219002 AGTTATCTTGTGATGAGTAATGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160593959 18:79961747-79961769 CGTTATCTTCAGATGTTGACTGG - Intergenic
1164337646 19:24345698-24345720 AAATATCTTCAGATGAAAACTGG + Intergenic
1164352449 19:27367930-27367952 AAATATCTTCAGATAAGAACTGG - Intergenic
1164368756 19:27621148-27621170 AGATATCTTCAGATAAATACTGG + Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925051079 2:816166-816188 GGTTATGTTCTGATTAGGACAGG - Intergenic
925648856 2:6067373-6067395 AGGTGTGTTCAGATGGGGACAGG + Intergenic
926108580 2:10167766-10167788 AGTTATCTTCAGATGAGGACAGG - Intronic
927382830 2:22498981-22499003 AGTTCTCTGCTGCTGAGGACTGG - Intergenic
928435330 2:31251216-31251238 AGCTCTCTTCTGATGAGGGCAGG + Intronic
930446589 2:51481344-51481366 AGTTATCTGCCAATGAAGACAGG - Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931831165 2:66052863-66052885 AGTTAGCCTTAGATGAGGTCAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
935141395 2:100355972-100355994 AGTCATCTTCTGATGGGGAGGGG - Intergenic
935211299 2:100941262-100941284 AGTGATTTTAAGATGAGAACTGG + Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939268605 2:139909196-139909218 AATCATCTGCAGGTGAGGACAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939768876 2:146289707-146289729 AGTTATTATCAGATGAGATCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940351499 2:152694522-152694544 AGTTATTTTCACATGATTACCGG + Exonic
941286024 2:163613145-163613167 AGTTAGTTACAGAAGAGGACTGG + Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942931713 2:181501861-181501883 ACTCATCTTGAGTTGAGGACAGG + Intronic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943627220 2:190214573-190214595 AGTTTGGCTCAGATGAGGACTGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1170472339 20:16680839-16680861 AGTTAAGTTAAAATGAGGACAGG - Intergenic
1170485720 20:16813879-16813901 TGTTATCTTTAGGTGAGGAGGGG + Intergenic
1170807865 20:19649241-19649263 ACTTATCTCTAGATGAAGACCGG - Intronic
1172502696 20:35438159-35438181 AGTTATTTTCAGCTGCTGACTGG - Exonic
1175341977 20:58237998-58238020 ATTCATTTTCAGATGAAGACAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177470044 21:21548709-21548731 AGCTATCTTCAGATAATGCCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178270238 21:31182785-31182807 AGTGATCCTCAGGAGAGGACAGG + Intronic
1179205178 21:39270409-39270431 ACTTATCTTCCGAAGAGGAAAGG - Exonic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181830347 22:25555503-25555525 AATTATCTAAAGATGAGGAAAGG - Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951411954 3:22376339-22376361 AGTTATCCTGAGCTGATGACAGG + Intergenic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
954363312 3:50133748-50133770 AGTTACCTGCAGATGAGGACTGG - Intergenic
955004965 3:54959874-54959896 AGGTTTCTTCAGATGAAGTCTGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956069150 3:65429437-65429459 ACTCATCTTCAGATGACCACTGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
961388059 3:126535681-126535703 AGCTATCTCCAGATGAGAAGAGG - Intronic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964310090 3:155383253-155383275 AGGTATTTTCAGAGAAGGACAGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965919913 3:173900426-173900448 AATTATTTCCAGATGAAGACTGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
968028011 3:195458766-195458788 ATTTATCCTCAGAAAAGGACAGG + Intergenic
969991051 4:11262666-11262688 AGAAATATTCAGATGAGGCCAGG + Intergenic
971376173 4:26057446-26057468 TGTCTTCTTCAGATGAGGTCTGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972425632 4:38929964-38929986 AGTTATCATCAGGTTAGGGCAGG + Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973154807 4:46937214-46937236 AGCTATCTTCACATCAAGACAGG + Intronic
974040737 4:56855278-56855300 AGTTATTTCCAGAGGAGAACTGG - Intergenic
974270837 4:59649957-59649979 AATTATGTTTAGATGAGGTCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977270184 4:94908691-94908713 AGGTATCTGCAGCTGAAGACAGG + Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980263169 4:130480842-130480864 AAATAACTTCAGAAGAGGACAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG + Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982634301 4:157873150-157873172 AGATATCTTCAGAGAAGGAAAGG - Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
985056188 4:186037543-186037565 AGTTATATTCATAGGAGGACTGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987378636 5:17262301-17262323 AGCTTTCTACAGATGAGGATGGG - Intronic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987504385 5:18749824-18749846 AGTTAACTACAGAAGATGACAGG - Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989833637 5:45954325-45954347 AAATATCTTCAGATAAAGACTGG + Intergenic
989833645 5:45954497-45954519 AATTATCTTCAGATAAAAACTGG + Intergenic
989856190 5:46295696-46295718 TATTATCTTCAGATAAGAACAGG - Intergenic
990430485 5:55730144-55730166 AGTTACCTTCAGATGTTGGCTGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996168357 5:120255614-120255636 AGTTTTATTCAGGTGAAGACAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001089568 5:168727366-168727388 ACATATTTTCAGATGAGGATTGG + Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006771040 6:36553205-36553227 ATTTAAGTTCAAATGAGGACAGG + Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008371570 6:50737800-50737822 AATGATATTCAGAAGAGGACTGG - Intronic
1008374852 6:50779884-50779906 AGTTATCTCCAGAGGAAGAGTGG + Intergenic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013671617 6:112409211-112409233 ACTCATCTTCAGATGAGCACTGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024102473 7:46046674-46046696 AGTTTTCTTTAGATGATGATGGG + Intergenic
1024159164 7:46656756-46656778 AGTTTTCTGCAGATGACGATAGG + Intergenic
1024380677 7:48692433-48692455 AGATATCTTCATATAAGGACTGG - Intergenic
1025577140 7:62660725-62660747 AATTATCTTCAGATAAAAACTGG - Intergenic
1025577275 7:62663321-62663343 AAATATCTTCAGATGAAAACTGG - Intergenic
1025580854 7:62714651-62714673 AATTATCTTCAGATAAAAACTGG + Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1029103562 7:98155014-98155036 AGTGATTTTCAGATGACGCCTGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1031223287 7:119000874-119000896 AAGTATCTACATATGAGGACAGG - Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043176698 8:77030350-77030372 ATTTATCATGAGATGAAGACTGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046093978 8:109536710-109536732 AGTTTTCTTCAGAAGGGGCCTGG - Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053062405 9:35042670-35042692 ACTGATCTCCAAATGAGGACTGG + Intronic
1053872672 9:42508823-42508845 AGTTTTCTTCAGATGTGTCCTGG - Intergenic
1054269656 9:62957929-62957951 AGTTTTCTTCAGATGTGTCCTGG + Intergenic
1055775107 9:79759540-79759562 AGTTATCACCAGATCATGACAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058239796 9:102542463-102542485 AGTTATTTACAGATGATGTCAGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058424466 9:104864419-104864441 TGGTGTCTTCAGTTGAGGACTGG + Intronic
1058947368 9:109870214-109870236 AGTTATTTTGATATGAGGAAAGG + Intronic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187488658 X:19728831-19728853 AGTTATGTTCTGATGAAGATAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188250939 X:27893550-27893572 AGTGTTCTGCAGATCAGGACTGG - Intergenic
1188261254 X:28026878-28026900 ATTTATATTCTGATGAGGAGAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191631292 X:63324848-63324870 ATTTATCTTCAGATAATGACAGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192262787 X:69517398-69517420 AGATCTTTACAGATGAGGACAGG - Intronic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193135587 X:77968010-77968032 AGTTATGCTCAGATGAACACTGG + Intronic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194155338 X:90380963-90380985 AGTCATCTTCAGAGAATGACAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199119477 X:144034526-144034548 AATTATCAACAGATGAAGACTGG + Intergenic
1199427866 X:147723753-147723775 GCTTATCTTCATGTGAGGACAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200501688 Y:3957896-3957918 AGTCATCTTCAGAGGATGACAGG + Intergenic
1201694409 Y:16808889-16808911 AGTTGTCTTCAGAAGTGGGCTGG - Intergenic
1202126582 Y:21573853-21573875 GGTTATTGTCAGCTGAGGACAGG + Intergenic