ID: 926108691

View in Genome Browser
Species Human (GRCh38)
Location 2:10168451-10168473
Sequence TAAACCCCCTCTTCAAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926108691_926108697 22 Left 926108691 2:10168451-10168473 CCTCTTCTTGAAGAGGGGGTTTA 0: 1
1: 0
2: 0
3: 14
4: 158
Right 926108697 2:10168496-10168518 TTCTGCTTTTAGTCAGATAAGGG 0: 8
1: 20
2: 42
3: 107
4: 371
926108691_926108696 21 Left 926108691 2:10168451-10168473 CCTCTTCTTGAAGAGGGGGTTTA 0: 1
1: 0
2: 0
3: 14
4: 158
Right 926108696 2:10168495-10168517 TTTCTGCTTTTAGTCAGATAAGG 0: 11
1: 16
2: 31
3: 67
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926108691 Original CRISPR TAAACCCCCTCTTCAAGAAG AGG (reversed) Intronic
904153090 1:28459351-28459373 TAAATACCCTCTTCAAATAGAGG - Intronic
907094396 1:51763492-51763514 CAAAACCACTCTTGAAGAAGTGG + Intronic
908070993 1:60459998-60460020 AAAACACCCTCTTCAACAAATGG + Intergenic
908601140 1:65741333-65741355 TAAACGCCCACATCAAAAAGCGG - Intergenic
911838435 1:102650847-102650869 CAAACCACCCCATCAAGAAGTGG - Intergenic
912429734 1:109622750-109622772 TCAACCCCCTCTCCTAGCAGGGG - Intronic
914937702 1:151994451-151994473 TAAATCCCCTGTTCAACAAAGGG - Intergenic
915216872 1:154346286-154346308 TGAACCTTCTCTTCAACAAGCGG + Exonic
916669629 1:167002881-167002903 TAAATCTCCTCTTCCAGAATTGG + Intronic
919120800 1:193337947-193337969 GAAACCCCCTCAAAAAGAAGGGG - Intergenic
919508919 1:198435882-198435904 AAAACCCCATCTTCAATAAATGG - Intergenic
919588199 1:199465344-199465366 TAAAACCCCTATTTCAGAAGGGG - Intergenic
921018279 1:211212424-211212446 TGAACACTCTCTTCAAGAACAGG + Intergenic
924777949 1:247123862-247123884 TAAACCTCATCTGCAAGAAAAGG + Intronic
924783597 1:247173835-247173857 TAAACCTCATCTGCAAGAAAAGG - Intergenic
924787590 1:247212604-247212626 TAAACCTCATCTGCAAGAAAAGG - Intergenic
1064599584 10:16980004-16980026 TAAACAACCTCATCAAAAAGTGG + Intronic
1064804520 10:19115284-19115306 GACACCTCCTCTCCAAGAAGAGG - Intronic
1065717115 10:28581904-28581926 TAAACCCCCTTTTAAATAACAGG - Intronic
1066014740 10:31229506-31229528 TAAACAGCCTCGTCAAAAAGTGG - Intergenic
1066525633 10:36276067-36276089 AAAACCACCTCATCAAAAAGCGG + Intergenic
1070378817 10:75860880-75860902 CAAACCCCATGTTCAATAAGTGG - Intronic
1072856380 10:98951908-98951930 TAAACCCCATCTTATAGATGAGG + Intronic
1075087792 10:119424936-119424958 TAATCCCGATCTTCAAGCAGGGG - Intronic
1075257486 10:120937209-120937231 TTACCTCCATCTTCAAGAAGTGG - Intergenic
1076097639 10:127744942-127744964 TAAACCTCCTCATCCAGAACAGG + Intergenic
1077575665 11:3381281-3381303 TAAACCTCTTCTGCAAGAAAGGG - Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078452686 11:11452305-11452327 TCAACCCCATTTTCCAGAAGAGG - Intronic
1079102432 11:17549913-17549935 CACACCCCCACTTCATGAAGAGG - Intronic
1079192922 11:18296623-18296645 TAAACCAACTCTTCTAGTAGGGG + Intronic
1079483602 11:20910362-20910384 TACACCCTCACTTCAAGAGGGGG - Intronic
1080377973 11:31736638-31736660 TAAACAACCTCATCAAAAAGTGG + Intronic
1081955442 11:47088181-47088203 TACTCCCCCACTTCAAGAGGTGG - Intronic
1083964739 11:66036387-66036409 TATATCCCCTCTTGTAGAAGAGG - Intergenic
1084859133 11:72006785-72006807 CAAACCTCCCCTTCAAGATGTGG + Intronic
1086340138 11:85840628-85840650 AAAACTCCCTATTCAATAAGTGG + Intergenic
1086780816 11:90903128-90903150 TAAACCTCCACTTGAAGAACTGG + Intergenic
1088907190 11:114163672-114163694 TGAACCCCCTCTTCACACAGGGG - Intronic
1090752119 11:129756082-129756104 TAAACAACCTCATCAAAAAGTGG + Intergenic
1091777978 12:3197114-3197136 TAATCCCCATGTTAAAGAAGAGG + Intronic
1093223289 12:16449333-16449355 TAAACCCACTCATCACCAAGAGG + Intronic
1094412111 12:30177578-30177600 TAAACTCCCTCTGCAAAAATTGG - Intergenic
1100132844 12:91517809-91517831 AGAACCCCCTCTTCAATAAATGG + Intergenic
1106785819 13:33107219-33107241 AAAACCACCTCTTCGAGAATGGG - Intronic
1108151195 13:47536484-47536506 CAAACCACCTCATCAAAAAGTGG + Intergenic
1111722237 13:91960811-91960833 AAGACACCCTCTTCAAAAAGTGG + Intronic
1112103653 13:96217273-96217295 TAAACCCTCTCTTCAAGTTGGGG - Intronic
1116239621 14:42324171-42324193 TACACCTCCTCTTCAGGAAGTGG - Intergenic
1116284267 14:42951511-42951533 AGAATCCCCTATTCAAGAAGTGG - Intergenic
1116931862 14:50698658-50698680 AGAACTCCCTCTTCAATAAGTGG - Intergenic
1119461856 14:74811652-74811674 AAAACCCCCTCTTCTGGATGAGG - Exonic
1123838774 15:24224918-24224940 TAACCCCCCTCCACCAGAAGAGG + Intergenic
1125525331 15:40370584-40370606 TAAGACCCCTCCTCTAGAAGTGG + Exonic
1133926030 16:10193062-10193084 TAAACCTCATTTTCAAGATGAGG + Intergenic
1135762883 16:25151668-25151690 CAAACCCCATCTTCAAAAAGGGG - Intronic
1138418670 16:56885704-56885726 TAAACCTCCTCTACAAAGAGGGG - Intronic
1141189632 16:81815170-81815192 TAACCACCCTCTGCATGAAGAGG - Intronic
1146439094 17:32877531-32877553 TGAACCACCACTTCAAGAATGGG - Intergenic
1146740778 17:35281682-35281704 CAAGCTCCCTCTTCAAGAACAGG - Intergenic
1156083057 18:33363603-33363625 TAAACCCCTCATTCAAAAAGGGG - Intronic
1162839958 19:13349179-13349201 TTAACCCCATCTTCCAGATGAGG - Intronic
1164489783 19:28697747-28697769 AAAACTCCCTATTCAATAAGTGG + Intergenic
1165419424 19:35715683-35715705 GATACCCCCTCTTCACGAAGGGG + Intronic
924974767 2:162556-162578 TCATCCCCTTCTCCAAGAAGAGG - Intergenic
926108691 2:10168451-10168473 TAAACCCCCTCTTCAAGAAGAGG - Intronic
926438425 2:12861210-12861232 TAAACCCTCTTTTCACAAAGGGG - Intergenic
926642307 2:15250621-15250643 TAAACAACCTCATCAAAAAGTGG + Intronic
927052940 2:19348181-19348203 TAAACCACTGATTCAAGAAGAGG + Intergenic
929224483 2:39499094-39499116 TAAAGCACCTCTACAAGGAGGGG + Intergenic
931299831 2:60968024-60968046 TAAGCCCCATTTTCAACAAGAGG - Intronic
933188188 2:79302144-79302166 TAAACTCCCTCTTCAAGTCAAGG - Intronic
933756848 2:85646298-85646320 TAAACCCACAGTTCCAGAAGAGG - Intronic
935104340 2:100025800-100025822 AAGACCCCCTTTTCAACAAGTGG + Intronic
937328196 2:121004864-121004886 TAAACCACCTATCCCAGAAGGGG - Intergenic
938158943 2:128966656-128966678 CAAACCACCTCATCAAAAAGTGG + Intergenic
938612017 2:132957777-132957799 TAAGACCCCTATTCTAGAAGAGG + Intronic
941138894 2:161752289-161752311 TTAATCCTCTCTTGAAGAAGAGG + Intronic
941394596 2:164959093-164959115 GACATCCTCTCTTCAAGAAGTGG + Intergenic
941543886 2:166820975-166820997 TAAATCCCCTCTTCACATAGTGG - Intergenic
942610702 2:177739368-177739390 TAAAACCCCTCTTCTGGCAGTGG - Intronic
943221276 2:185109596-185109618 TGGACCCCCTGTTCAATAAGTGG + Intergenic
948360839 2:237419003-237419025 CATACCTCCTCTTCAATAAGAGG - Intergenic
1169862204 20:10164706-10164728 TAAACAACCTCATCAAAAAGTGG + Intergenic
1170906300 20:20517786-20517808 TTTTCCCCCTCTTCAAGATGTGG - Intronic
1171083142 20:22209267-22209289 CAAACACCCTCGTCAAAAAGTGG - Intergenic
1173620614 20:44433168-44433190 TCACTCCCCTCTTCAAGAAGGGG - Intergenic
1175729525 20:61344594-61344616 CAAACCGCCTCTTCACTAAGAGG + Intronic
1176963092 21:15181682-15181704 CAAACAACCTCATCAAGAAGTGG - Intergenic
1180896854 22:19341702-19341724 CAAACACCCTATTCAACAAGTGG + Intronic
951305215 3:21052077-21052099 TAAACTCCCTATTCAAGAAATGG + Intergenic
952517161 3:34116897-34116919 TAAACAACCTCATCAAAAAGTGG - Intergenic
953513050 3:43562712-43562734 AAAACACCCTCTTCAATAAATGG + Intronic
954031020 3:47819989-47820011 TAAACCACCACATCAAGAAGAGG - Intronic
958475361 3:94574098-94574120 TAAGCACCTTCTTCAAGAATTGG + Intergenic
958602590 3:96316509-96316531 TAAACAATCTCTTCAATAAGTGG - Intergenic
958952981 3:100436389-100436411 CAGACCCCCTCTTCACCAAGGGG - Intronic
959003113 3:100988163-100988185 TCAACCACCTCTTGGAGAAGTGG + Intronic
959045763 3:101471813-101471835 ACAACCCCCTCATCAAAAAGTGG + Intronic
959727674 3:109562356-109562378 TAAACCCCCTTTATAAGAAAGGG - Intergenic
965091887 3:164175045-164175067 CAAACAACCTCTTCAAAAAGTGG + Intergenic
968374836 4:31050-31072 CAAACAACCTCATCAAGAAGTGG + Intergenic
968383892 4:119698-119720 TAAACCTCATCTGCAAGAAAAGG + Intergenic
969976226 4:11104787-11104809 GAAACCGCCCCTTCAAAAAGTGG + Intergenic
971169493 4:24218734-24218756 TAAACCACCTCCTGAAGAGGAGG - Intergenic
974418324 4:61640045-61640067 TTACCTCCCTCTGCAAGAAGTGG + Intronic
975011806 4:69364674-69364696 AAAACAACCTCATCAAGAAGTGG - Intronic
975870353 4:78773665-78773687 TAGACCCCCTCTGAAAGACGAGG - Intergenic
978185537 4:105852937-105852959 TAAACAACCTCATCAAAAAGTGG - Intronic
979178653 4:117697397-117697419 TAAACACCCTATTCAACAAATGG + Intergenic
979431876 4:120642207-120642229 TAAACCACCTAATCCAGAAGAGG - Intergenic
979868195 4:125782095-125782117 TAACCCCGCTTTTCAATAAGGGG - Intergenic
981142638 4:141287401-141287423 AAAACACCCTCTTCAATAAGTGG - Intergenic
981457226 4:144966977-144966999 TAAACACCCTCTTCATTAATGGG - Intergenic
984032814 4:174625805-174625827 TAAACAACCCCTTCAAAAAGTGG - Intergenic
985460203 4:190097995-190098017 CAAACAACCTCATCAAGAAGTGG - Intergenic
989701425 5:44269905-44269927 TCAACCCCTGCTTAAAGAAGAGG + Intergenic
990136767 5:52654744-52654766 TGAACAACCTCTTGAAGAAGTGG + Intergenic
993405039 5:87500530-87500552 TACACCACCTATACAAGAAGTGG + Intergenic
995309037 5:110690294-110690316 TAAACAACCCCTTCAAAAAGTGG + Intronic
996903923 5:128576043-128576065 TAAACATCCTCTTCAAAAATTGG - Intronic
997311245 5:132885447-132885469 AAAACTCCCTCTTAAAAAAGGGG + Intronic
997891329 5:137679729-137679751 TAAACCCCTTCTTTCTGAAGTGG + Intronic
998513337 5:142731912-142731934 TAAGCCCCCTCTTTAACAAGGGG + Intergenic
999086014 5:148890618-148890640 AAAACAACCTCTTCAAAAAGTGG - Intergenic
999131779 5:149289098-149289120 TAAGCCCCTTCTTACAGAAGAGG + Intronic
999165845 5:149548842-149548864 AAAACTCCGTCTTAAAGAAGAGG + Intronic
999830560 5:155315072-155315094 TAAACTCCCTTCTCAAAAAGTGG - Intergenic
1003992459 6:11499503-11499525 TAAGGCCCCACTTCAACAAGGGG + Intergenic
1007469404 6:42078735-42078757 AAAACCTCTTCTTCCAGAAGGGG - Exonic
1009946472 6:70347153-70347175 TCCACCCCCTCTTCACCAAGTGG - Intergenic
1011534164 6:88357685-88357707 TAAACAACCTCATCAAAAAGTGG + Intergenic
1012765394 6:103361217-103361239 AAAACACCCTCTTCAATAAATGG + Intergenic
1013933395 6:115563803-115563825 AAAACACCCTATTCAAGAAGTGG + Intergenic
1017609205 6:156166773-156166795 AAAACCCCTTCTTAAAGAAGAGG + Intergenic
1023131651 7:37009473-37009495 CAAACACCCTCTTCCAGCAGTGG + Intronic
1023226513 7:37975265-37975287 TAAACCCACACTGCAAAAAGAGG - Intronic
1024989886 7:55224862-55224884 TAAAACCCCTCATCAGGAAAGGG + Intronic
1028504229 7:91553982-91554004 AAAACCGACTCTTCAAGAGGAGG + Intergenic
1028567464 7:92248384-92248406 AAAACCCACTCTTTGAGAAGTGG - Intronic
1030056144 7:105585045-105585067 AGAAGCCCCACTTCAAGAAGGGG + Intronic
1030808868 7:113950650-113950672 AAAACACCCTCATCAAAAAGTGG - Intronic
1034067183 7:148148265-148148287 TAAACTACCTATGCAAGAAGTGG + Intronic
1037304076 8:17486737-17486759 TGTACCCCCTCTTTAAAAAGGGG - Intergenic
1042215073 8:66423095-66423117 TAAAACCCTTATTCCAGAAGGGG + Intergenic
1043981400 8:86644521-86644543 TGACCCCCCTCTTCAAAAAAAGG - Intronic
1044143525 8:88684706-88684728 ATAACCCCCTCTTCAATAAGGGG - Intergenic
1044284139 8:90392065-90392087 TAAAACCCCCCTTCAAAAAGTGG + Intergenic
1044940420 8:97336096-97336118 TAGACCCTCTCTTTAAAAAGCGG - Intergenic
1047635730 8:126759971-126759993 TAGACCCACTCTTCACCAAGAGG + Intergenic
1050464306 9:5905259-5905281 TGGACCCCCTCTTCACCAAGGGG + Intronic
1054997841 9:71412412-71412434 CAAACAACCTCATCAAGAAGTGG + Intronic
1056681455 9:88722705-88722727 TAAACCACCTCTTAAAAAAATGG - Intergenic
1056690372 9:88803197-88803219 TAAAACCCTTGTTCAAGAAAGGG - Intergenic
1057437793 9:95058449-95058471 TAAACACCCTTTGCCAGAAGTGG - Intronic
1057734888 9:97647540-97647562 TAAACCACATCCACAAGAAGAGG + Exonic
1057793181 9:98137524-98137546 CAATCCCACTCTTCAGGAAGGGG + Intronic
1058111787 9:101038665-101038687 TCAACCCCCACATCAAGAAGAGG + Intronic
1058570436 9:106336403-106336425 TAAACCACCCCGTCAAAAAGTGG - Intergenic
1059404939 9:114093680-114093702 TGAACCCCATCTTACAGAAGAGG + Intronic
1059822054 9:117984271-117984293 TAAACCACCTCTTTGAGGAGGGG - Intergenic
1203574386 Un_KI270744v1:163101-163123 CAAACAACCTCATCAAGAAGTGG - Intergenic
1187743965 X:22387969-22387991 TTAACCCCCTAGTCATGAAGAGG - Intergenic
1187757603 X:22544902-22544924 TAAGCCACCTATTCAAGTAGAGG - Intergenic
1188348950 X:29103373-29103395 AAAACCATCTCTTCAATAAGTGG + Intronic
1193843925 X:86445049-86445071 TAAACCCCCGCAAAAAGAAGAGG - Intronic
1194104638 X:89753593-89753615 TGAACCTCCTCTTCTAGAACAGG - Intergenic
1194248513 X:91543809-91543831 AAAATTCCCTCTTCAATAAGTGG + Intergenic
1195593041 X:106654364-106654386 TAAACAACCCCATCAAGAAGTGG - Intronic
1197087028 X:122490748-122490770 CCAATCCACTCTTCAAGAAGGGG + Intergenic
1197438235 X:126458802-126458824 AATACCCCCACTTTAAGAAGTGG + Intergenic
1198374579 X:136026164-136026186 TACAGCCCCTGTTCACGAAGAGG - Intronic
1200456591 Y:3401372-3401394 TGAACCTCCTCTTCTAGAACAGG - Intergenic