ID: 926109080

View in Genome Browser
Species Human (GRCh38)
Location 2:10170682-10170704
Sequence CAGGTTGGAGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1948
Summary {0: 1, 1: 0, 2: 20, 3: 192, 4: 1735}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926109080_926109087 -4 Left 926109080 2:10170682-10170704 CCCTCCTCCTTCTCTCCAACCTG 0: 1
1: 0
2: 20
3: 192
4: 1735
Right 926109087 2:10170701-10170723 CCTGCTTTCTTGCTGCTGGAAGG 0: 1
1: 0
2: 8
3: 42
4: 369
926109080_926109091 7 Left 926109080 2:10170682-10170704 CCCTCCTCCTTCTCTCCAACCTG 0: 1
1: 0
2: 20
3: 192
4: 1735
Right 926109091 2:10170712-10170734 GCTGCTGGAAGGGGGTGTGCAGG 0: 1
1: 2
2: 2
3: 46
4: 411
926109080_926109092 22 Left 926109080 2:10170682-10170704 CCCTCCTCCTTCTCTCCAACCTG 0: 1
1: 0
2: 20
3: 192
4: 1735
Right 926109092 2:10170727-10170749 TGTGCAGGCTCCCGTGTGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 213
926109080_926109088 -3 Left 926109080 2:10170682-10170704 CCCTCCTCCTTCTCTCCAACCTG 0: 1
1: 0
2: 20
3: 192
4: 1735
Right 926109088 2:10170702-10170724 CTGCTTTCTTGCTGCTGGAAGGG 0: 1
1: 0
2: 1
3: 51
4: 514
926109080_926109085 -8 Left 926109080 2:10170682-10170704 CCCTCCTCCTTCTCTCCAACCTG 0: 1
1: 0
2: 20
3: 192
4: 1735
Right 926109085 2:10170697-10170719 CCAACCTGCTTTCTTGCTGCTGG 0: 1
1: 0
2: 2
3: 17
4: 182
926109080_926109090 -1 Left 926109080 2:10170682-10170704 CCCTCCTCCTTCTCTCCAACCTG 0: 1
1: 0
2: 20
3: 192
4: 1735
Right 926109090 2:10170704-10170726 GCTTTCTTGCTGCTGGAAGGGGG 0: 1
1: 0
2: 2
3: 19
4: 300
926109080_926109089 -2 Left 926109080 2:10170682-10170704 CCCTCCTCCTTCTCTCCAACCTG 0: 1
1: 0
2: 20
3: 192
4: 1735
Right 926109089 2:10170703-10170725 TGCTTTCTTGCTGCTGGAAGGGG 0: 1
1: 0
2: 2
3: 23
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926109080 Original CRISPR CAGGTTGGAGAGAAGGAGGA GGG (reversed) Intronic
900295817 1:1948965-1948987 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
900395698 1:2452426-2452448 CAGGAGGGAGAGCAGGAGGCAGG - Intronic
900471915 1:2859278-2859300 CAGGGAGGAAGGAAGGAGGAAGG + Intergenic
900499388 1:2993366-2993388 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
900569540 1:3351567-3351589 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
900803490 1:4752159-4752181 GAGGGAGGAGAGGAGGAGGAGGG + Intronic
900803500 1:4752193-4752215 GAGGAGGGAGAGGAGGAGGAGGG + Intronic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
900918548 1:5656138-5656160 AGGGATGGAGAGAAAGAGGAAGG + Intergenic
900954099 1:5876218-5876240 CAGCTGGGAGGGAGGGAGGAAGG + Intronic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901127443 1:6939569-6939591 CAGGCTGGAGACAGAGAGGACGG - Intronic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901296041 1:8161650-8161672 CAGGGTGGTGGGATGGAGGATGG - Intergenic
901672820 1:10866304-10866326 CAGGTTGGGGGGCAGGTGGAGGG - Intergenic
901681534 1:10915733-10915755 CAGGTGGGTCAGAAGCAGGAGGG + Intergenic
901936309 1:12629564-12629586 CAGGTTGGGGAGGAGGGTGAGGG + Intergenic
901938620 1:12645132-12645154 AAGGAAGGAGGGAAGGAGGAAGG - Intronic
902058581 1:13622609-13622631 CAGCTTGCAGAGAACCAGGAAGG - Intergenic
902374998 1:16026434-16026456 GGGGTTGGGGAGATGGAGGAGGG + Intronic
902398294 1:16144135-16144157 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
902542009 1:17162508-17162530 CAGGTTGGAGTGAGGCCGGAGGG + Intergenic
902546497 1:17193742-17193764 CAGGCTGGAGAGCAGGGGGTGGG + Intergenic
902747620 1:18483805-18483827 CAGGTGGGAAAGATGGAGGCAGG + Exonic
902833112 1:19030207-19030229 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
903151837 1:21415235-21415257 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
903165154 1:21515046-21515068 CAAGCTGGAGTGGAGGAGGAGGG - Intronic
903331723 1:22600093-22600115 GAGGAAGGAGAGAAGGAGGAAGG + Intronic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903346257 1:22686001-22686023 CAGGTTTGAGAGAAGGCAGTGGG - Intergenic
903545579 1:24121510-24121532 CACGTTGGAGGGCTGGAGGATGG + Exonic
903557380 1:24203475-24203497 CAGGAGGGAGGGAAGGAGGGAGG - Intergenic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
903692379 1:25183689-25183711 AAGGGTGGAGAGATGAAGGACGG - Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904087158 1:27917029-27917051 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
904335413 1:29794107-29794129 CAGGAGGGAGAGAGGGAGGGAGG - Intergenic
904864169 1:33563390-33563412 GAGGTGGGAGAGAAGGGGCAAGG + Intronic
904937320 1:34140909-34140931 CAGGTTGTAGAGGAGGGGAAAGG - Intronic
905052657 1:35065208-35065230 TAGGTTGTGGAGGAGGAGGAAGG - Intronic
905337679 1:37256720-37256742 AGAGATGGAGAGAAGGAGGATGG - Intergenic
905791643 1:40792664-40792686 CTGGTGGGAGAGACGGGGGACGG + Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
906449644 1:45934061-45934083 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
906493370 1:46285577-46285599 GTGGCTGGCGAGAAGGAGGATGG - Exonic
906710551 1:47926676-47926698 GGGGTTGGAGAGAATGGGGAGGG + Intronic
906745996 1:48222584-48222606 CAGTTGGGAGAAAAGGAGGCAGG + Intergenic
906747964 1:48234802-48234824 CAGGTTGGAGGTAAGCAGGGAGG + Intronic
906906813 1:49903351-49903373 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
906908780 1:49924289-49924311 GAGGATGGAGAGTGGGAGGAGGG + Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907056432 1:51373099-51373121 CAGGATGTAGAGAAGAAAGAAGG + Intronic
907264693 1:53250467-53250489 GAGGAAGGAAAGAAGGAGGAAGG + Intronic
907460941 1:54605155-54605177 CAGGTCCGAGAGCAGCAGGAAGG - Exonic
907594371 1:55705886-55705908 GAGGAGGGAGAAAAGGAGGAAGG - Intergenic
907656606 1:56349020-56349042 AAGGAGGGAGAAAAGGAGGAAGG + Intergenic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
907864407 1:58385692-58385714 CAGGATGCAAAGCAGGAGGAAGG + Intronic
907919157 1:58896789-58896811 CAGCTGGGAGGGAGGGAGGAAGG + Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908434928 1:64096380-64096402 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
908491027 1:64644246-64644268 AGGGTGGGAGAAAAGGAGGAAGG + Intronic
908634025 1:66142170-66142192 CAGGTTGAGGAGGAAGAGGAAGG + Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
908940250 1:69423720-69423742 GAGGTTGGAGAGGATGTGGAAGG - Intergenic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
909371506 1:74888080-74888102 AAGGTGGGAGGGTAGGAGGAGGG + Intergenic
909434016 1:75619226-75619248 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
909488028 1:76195912-76195934 GAGGTTGGTAAGAAGGAGAAAGG + Intronic
909543965 1:76823220-76823242 GAGGGTGGAGAATAGGAGGAGGG + Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
909767284 1:79372153-79372175 AAGGATGGAGGGAGGGAGGAAGG - Intergenic
909821780 1:80072799-80072821 CCTGTTTGAGAGAAGGAAGAAGG + Intergenic
910018353 1:82554391-82554413 GAGGGTGGAGAGCAGGAGAAGGG - Intergenic
910161223 1:84274903-84274925 GAGGTGGGAGGGAAGGAGGGAGG - Intergenic
910371159 1:86516502-86516524 CAGGTTGGAAAGATGGACAAAGG - Intergenic
910735039 1:90444356-90444378 AAGGAAGGAGAGAAAGAGGAAGG + Intergenic
910780114 1:90922729-90922751 AAGGGTGGAGGGTAGGAGGAGGG - Intronic
910964445 1:92794171-92794193 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
911005264 1:93214265-93214287 TAGTTTGGAGAGAAAGACGATGG + Intronic
911245099 1:95508327-95508349 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
911571531 1:99523351-99523373 CAGGGTGGAGGGTGGGAGGAAGG - Intergenic
912283608 1:108344457-108344479 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
912514082 1:110207262-110207284 CAGGTTTCAAAGAAGGAAGATGG + Intergenic
912703261 1:111894223-111894245 CGTGTTTGAGAGAAGGAGGGAGG - Intronic
912822197 1:112877002-112877024 CAGCTAGAAGAGAAGGAGGGTGG + Intergenic
913606999 1:120475891-120475913 GAGGGAGGAGAGAAGGAGGGAGG - Intergenic
913673109 1:121116553-121116575 AAGGATGGAGGGAAGGAGGCGGG - Intergenic
913703596 1:121397101-121397123 GCGGTGGGAGAGAAGAAGGAGGG + Intergenic
913988343 1:143585716-143585738 AAGGGAGGAGAGAAGGAGGGAGG + Intergenic
914209434 1:145564253-145564275 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
914268354 1:146056621-146056643 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
914368741 1:147004240-147004262 GAGGGAGGAGAGAAGGAGGGAGG - Intergenic
914584193 1:149045947-149045969 GAGGGAGGAGAGAAGGAGGGAGG + Intronic
915005727 1:152634050-152634072 GAGGTTGGAGGGTGGGAGGAGGG + Intergenic
915107467 1:153543329-153543351 AAGGTTGGAGAGAGGTGGGAGGG + Intergenic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915556871 1:156665619-156665641 CAGGTTGGAGACAAGAATTAGGG - Intergenic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915791656 1:158678679-158678701 CAAGTTGGAGCTAGGGAGGAGGG - Intronic
916047190 1:161008924-161008946 CTGGTGGGAGAGAGGGAGGTGGG - Intronic
916078630 1:161218175-161218197 AAGTTTGGAGGGAAGGGGGATGG + Intronic
916434096 1:164760444-164760466 AAAGAAGGAGAGAAGGAGGAAGG - Intronic
916452096 1:164930527-164930549 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
916512120 1:165481816-165481838 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
916714551 1:167438382-167438404 CAGAATGGAGCCAAGGAGGAAGG + Intronic
916832656 1:168508949-168508971 CAGGAAGGAGAGGAAGAGGATGG - Intergenic
916961568 1:169894267-169894289 CAGGGCGGAGAAAAGGAGTACGG + Intronic
916964165 1:169918110-169918132 CAGGAGGGAGGGAAGGAGAAAGG - Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917051077 1:170924222-170924244 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
917249221 1:173038978-173039000 CAGGGTGGAGAAAAGGAGGTAGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917258237 1:173139631-173139653 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
917620121 1:176786924-176786946 GAGGGTGGAGAGGAAGAGGAGGG + Intronic
917839401 1:178965211-178965233 AAGGAAGGAGAGAAGGAAGAAGG - Intergenic
918148943 1:181781610-181781632 CAGGCTGGGGAGGTGGAGGAGGG + Intronic
918241997 1:182628887-182628909 AAGGTAGGAGAGGAGGAGGGAGG - Intergenic
918508280 1:185281698-185281720 CAGGGTGCAGAGAAGAAAGACGG + Intronic
918626522 1:186661895-186661917 CAGGTGGGGGGGAAGGGGGAGGG - Intergenic
918725680 1:187919680-187919702 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
918786066 1:188765535-188765557 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
918802008 1:188984792-188984814 AGGGTGGGAGAGAGGGAGGAAGG - Intergenic
919015222 1:192024894-192024916 GAGGGTGGAGAGAGGAAGGAGGG - Intergenic
919085780 1:192918757-192918779 GATGTTGGGGAGGAGGAGGAAGG + Intergenic
919995525 1:202745174-202745196 GAGGGTGGAGGGCAGGAGGAGGG + Intronic
920063130 1:203242216-203242238 GAGGTTGCAGAGAAAAAGGAGGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920122449 1:203668881-203668903 TAGATTGGGGAGAAGGAGGTAGG + Intronic
920454127 1:206084973-206084995 CGGGTTGGAGAGATGGAGAAAGG + Intronic
920610921 1:207437150-207437172 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921298821 1:213729915-213729937 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
921771885 1:219050405-219050427 AAGAAGGGAGAGAAGGAGGAAGG + Intergenic
921812815 1:219533670-219533692 CATATTGGAGTAAAGGAGGAAGG - Intergenic
921933583 1:220775669-220775691 GAGGGTGGAGAGTAGGAAGAGGG - Intronic
921940180 1:220830938-220830960 CAAGCTGGAGAGAGGGAGGCTGG - Intergenic
922213240 1:223501140-223501162 GAGGAGGGAGAGGAGGAGGAGGG - Intergenic
922527913 1:226320264-226320286 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
922764319 1:228149562-228149584 TGGGTGGGAGAGAAGGAGGCAGG + Intergenic
922819279 1:228472837-228472859 GAGGCTGCAGAGGAGGAGGAAGG - Intergenic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
922868270 1:228879464-228879486 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923155775 1:231278235-231278257 AGGGTTGGAGTGACGGAGGAAGG + Intergenic
923260826 1:232266310-232266332 CTGCTTGGAGAGAAGGTGCAAGG + Intergenic
923549734 1:234954036-234954058 CAGAAAGGAGGGAAGGAGGACGG + Intergenic
923862713 1:237907657-237907679 CAGGGTGGAGAGAAAGGAGAGGG + Intergenic
923935701 1:238757314-238757336 AAGGACGGAGAGAGGGAGGAAGG + Intergenic
924016765 1:239734810-239734832 CAAGATGGAGAGAAGTAGGTGGG + Intronic
924039668 1:239971929-239971951 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
924044193 1:240011152-240011174 CAGTCTGGAGGGGAGGAGGAGGG - Intergenic
924201112 1:241659538-241659560 GAGGTTGGGGAGAAAAAGGAAGG - Intronic
924217094 1:241833931-241833953 AAGGAAGGAGGGAAGGAGGAAGG - Intergenic
924388844 1:243528465-243528487 GAGGGTGGAGGGCAGGAGGAAGG - Intronic
924682656 1:246253261-246253283 GAGGTTGGAGGGAGGGAGCAAGG - Intronic
924737511 1:246771587-246771609 GAGGTTGGAGGGTGGGAGGAGGG - Intergenic
1062948595 10:1478905-1478927 CAGGTGGGAGAGAACCAAGATGG + Intronic
1063074724 10:2703250-2703272 CAGGCTGGAAAGAATCAGGAAGG - Intergenic
1063194406 10:3727742-3727764 CAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1063473428 10:6307565-6307587 GGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1063525235 10:6778778-6778800 AAGGAAGGAGAGAGGGAGGAAGG + Intergenic
1063561807 10:7135191-7135213 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1063694545 10:8320584-8320606 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1063711414 10:8482713-8482735 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1063732049 10:8708795-8708817 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1063768645 10:9172293-9172315 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1063907041 10:10791947-10791969 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
1063907063 10:10792032-10792054 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1063953948 10:11248421-11248443 AAGGATGGAGAGGAGGAGGGTGG - Intronic
1064003518 10:11682645-11682667 GAGGAGGGAGAGGAGGAGGAGGG - Intergenic
1064003523 10:11682660-11682682 GAGGAGGGAGAGGAGGAGGAGGG - Intergenic
1064553929 10:16529386-16529408 CAGGGTGGAGAGATAGGGGAAGG - Intergenic
1064564160 10:16623173-16623195 CAGGTGGGAGAGAGGGAGCAAGG - Intronic
1064652100 10:17519652-17519674 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1064906742 10:20355381-20355403 GAGGGTGGAGCGTAGGAGGAGGG + Intergenic
1064975508 10:21110641-21110663 TAGGTAGGAGAGAAGATGGATGG - Intronic
1065059830 10:21888775-21888797 GAGGTTGGAGGGTGGGAGGAGGG + Intronic
1065155117 10:22861547-22861569 CAGGTTTGAGAGAGGCAGGTGGG - Intergenic
1065221584 10:23501431-23501453 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1065275050 10:24077330-24077352 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065477534 10:26156835-26156857 GAGGGTGGAGAGTACGAGGAGGG - Intronic
1065827688 10:29586891-29586913 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
1065841253 10:29703368-29703390 CAGGTGGTGGAGAAGGAGAAAGG - Intronic
1065862681 10:29885097-29885119 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1065987102 10:30965756-30965778 GAGGAAGGAGAGAGGGAGGAGGG + Intronic
1066106961 10:32164942-32164964 CAAGATGGAATGAAGGAGGATGG - Intergenic
1066156386 10:32682625-32682647 GAGGTTGTAGAGAAAAAGGAAGG - Intronic
1066258403 10:33704298-33704320 CAGGAAGGAGAAAAGCAGGAGGG - Intergenic
1066462695 10:35625437-35625459 GAGGATGGAGGGTAGGAGGAAGG - Intergenic
1066954143 10:42149500-42149522 CCGATGGGAGAGAAGAAGGAGGG - Intergenic
1067224432 10:44366435-44366457 GAAGGTGGAGAGTAGGAGGAGGG - Intergenic
1067461617 10:46462387-46462409 CAGGTTGGCGATAAGCAGGTTGG + Exonic
1067575156 10:47404167-47404189 CAGGCTGGGGAGCTGGAGGAAGG + Intergenic
1067625577 10:47922214-47922236 CAGGTTGGCGATAAGCAGGTTGG - Intergenic
1067627712 10:47937608-47937630 GAGTATGGAGAGTAGGAGGAGGG - Intergenic
1068101380 10:52558526-52558548 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068238686 10:54274137-54274159 GAGGGTGGAGAGTTGGAGGAGGG + Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068360619 10:55972384-55972406 CAGGGTGGAGAGAAGGGGTGGGG - Intergenic
1068361917 10:55986752-55986774 GAGGGTGGAGTGTAGGAGGAAGG - Intergenic
1068493902 10:57760002-57760024 GAGGATGGAGGGCAGGAGGAGGG + Intergenic
1068525218 10:58120994-58121016 CAGGATGGAGGGTGGGAGGAGGG + Intergenic
1068573683 10:58659558-58659580 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1068832603 10:61514530-61514552 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1068900213 10:62259879-62259901 CAGGTAGGTGAGCAGGAGGAAGG - Intronic
1068936088 10:62637049-62637071 TAAGTTGGAGAGAAGGAAGGGGG - Intronic
1069060960 10:63894115-63894137 AGGGTAGGAGAGGAGGAGGAAGG - Intergenic
1069195447 10:65545598-65545620 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1069323154 10:67199002-67199024 AAGGAAGGAGAGAAAGAGGAGGG + Intronic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069604578 10:69731486-69731508 CAGGATGGAGGGAGGGAGGGAGG - Intergenic
1069934153 10:71903738-71903760 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1069964381 10:72101985-72102007 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1069965872 10:72115736-72115758 CAGGTTGGAGAGAATAAATAGGG + Intronic
1070044553 10:72819288-72819310 CAGGTAGAAGAGAAAGAAGAGGG + Intronic
1070054164 10:72918553-72918575 TAGGTGGGAGAGAAGGCGGATGG + Intronic
1070279409 10:75037849-75037871 CAGGACGGTGAGGAGGAGGATGG - Exonic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070662189 10:78315001-78315023 CAGGTTGAACAGTAGAAGGAAGG - Intergenic
1070777930 10:79120882-79120904 CAGGTGGGAGAGCGGGAGCAGGG - Intronic
1070900940 10:80028562-80028584 AAGGTTGGAGAGAAGTAGAAGGG - Intergenic
1070902676 10:80044329-80044351 AAGGTTGGAGAGAAGTAGAAGGG - Intergenic
1071167774 10:82826757-82826779 GAGGTGGGAGGGTAGGAGGAGGG + Intronic
1071201738 10:83227182-83227204 TAGGTTGTAGAGAAAGAGGCAGG - Intergenic
1071444887 10:85736257-85736279 AAGGAAGGAGAGAAGGAGGGAGG + Intronic
1071468508 10:85962014-85962036 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1071489368 10:86125681-86125703 GAGGCGGGAGAGATGGAGGAGGG - Intronic
1071566449 10:86673748-86673770 CAGGTGGCAGATAAGTAGGAAGG - Intronic
1071622547 10:87134877-87134899 CTGGCTGGAGAGGAGGAGCAGGG + Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1071971897 10:90916061-90916083 CGGGTGGGGGAGAAGGAGGAGGG + Intronic
1072446436 10:95502796-95502818 CAAGTGGTAGAGAAGGAGAAAGG - Intronic
1072446707 10:95505020-95505042 CAAGTGGTAGAGAAGGAGAAAGG + Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072635822 10:97177175-97177197 CAGGTTGGAGAGAGAGATGGGGG - Intronic
1072770268 10:98132092-98132114 CAGGTGGGAGAGAAGGGGAAAGG + Intergenic
1072929287 10:99646815-99646837 AAGGTGGGAGGGTAGGAGGAGGG - Intergenic
1073119205 10:101111310-101111332 CAGGTTTGAGAGAAGGTGGGAGG + Intronic
1073189674 10:101642499-101642521 TAGCTTGGAGAGGAGCAGGAAGG - Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073624204 10:105079714-105079736 GAGGGTGGAGAGTGGGAGGAAGG - Intronic
1073678447 10:105676467-105676489 GAGGTTGGAGGGTAGGAGGAGGG - Intergenic
1073948944 10:108784847-108784869 CAGGGTGGAGAGGAAGACGATGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1073992118 10:109273775-109273797 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1074042553 10:109806126-109806148 GAGAGTGGAGAGTAGGAGGAGGG + Intergenic
1074189865 10:111126296-111126318 CATGGTGGAGGGAAGGAGCATGG - Intergenic
1074326452 10:112455487-112455509 AAGGAAGGAGAGAAGGAGGGAGG - Intronic
1074612419 10:115034969-115034991 CAGGTGGGAGTGGAGAAGGATGG - Intergenic
1074648696 10:115493257-115493279 GAGGATGGAGAGTAAGAGGAGGG - Intronic
1075015340 10:118906611-118906633 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075465728 10:122648873-122648895 CAGGTGGGATAACAGGAGGATGG - Intergenic
1075544294 10:123342870-123342892 GAGGCTGGAAAGAAGGAGGCAGG + Intergenic
1075623609 10:123946239-123946261 CATGATGGAGACCAGGAGGAGGG + Intergenic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1075762539 10:124867470-124867492 TAGGTGGTAGAGAAGGCGGACGG - Intergenic
1075840549 10:125498717-125498739 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1076076387 10:127537190-127537212 CAGGAAGGAGGGAAGCAGGAAGG + Intergenic
1076171945 10:128326937-128326959 CAGCTTGGAAGGAAGGAGGGTGG - Intergenic
1076258257 10:129045649-129045671 AAGGTTGGATGCAAGGAGGAAGG - Intergenic
1076385229 10:130050896-130050918 CATGTTGGAGACAAGGAAGTCGG - Intergenic
1076449686 10:130548372-130548394 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1076512402 10:131022042-131022064 CATGGTGGAGAGAAGGTGGCTGG + Intergenic
1076558702 10:131346980-131347002 AAGGAAGGAGAGAAGGAAGAAGG - Intergenic
1076558714 10:131347027-131347049 AAGGAAGGAGAGAAGGAAGAAGG - Intergenic
1076563492 10:131382471-131382493 CAGGATGGTGAGAGGGAGGGAGG - Intergenic
1076980931 11:204328-204350 GAGGCTGGGGACAAGGAGGATGG + Exonic
1077174154 11:1181120-1181142 AAGGCTGGAGACAAGGAAGAAGG - Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077431794 11:2519251-2519273 CATGTTGGAGAGAAGGGAGCTGG - Intronic
1078108188 11:8371814-8371836 AGGGTGGGAGGGAAGGAGGAAGG - Intergenic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078351257 11:10595838-10595860 GAGGGTGGAAAGTAGGAGGAGGG - Intronic
1078385737 11:10890923-10890945 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1078386578 11:10898355-10898377 AGGGCTGGAGAGGAGGAGGAGGG + Intergenic
1078532850 11:12150380-12150402 CAGGTTGGAGAGCAGTGGTACGG - Intronic
1078604793 11:12765633-12765655 CAAGTTGGAGAGGAGGAGGGCGG - Intronic
1078694281 11:13614420-13614442 GAGGTTGGAGGGTAGGAGGAGGG - Intergenic
1079260184 11:18871164-18871186 CAGGTTGGTGAGACAGAGAAAGG + Intergenic
1079509348 11:21192894-21192916 CAGTGTCGAGAGAAAGAGGAAGG + Intronic
1079621674 11:22563122-22563144 GAAGTTGGAGAGTGGGAGGAAGG - Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080083432 11:28249869-28249891 GAGGGTGGAGGGTAGGAGGAAGG - Intronic
1080117324 11:28635507-28635529 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1080257022 11:30301886-30301908 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1080414860 11:32060213-32060235 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1080466692 11:32504094-32504116 AAGGAAGGAAAGAAGGAGGAAGG + Intergenic
1080544372 11:33301339-33301361 AAGGTGGGAGAGAAGGAGTTTGG - Intronic
1080721410 11:34852764-34852786 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1080910771 11:36595830-36595852 AAGGTTGGAGAGGATGAGAAGGG + Intronic
1081024677 11:37996151-37996173 GAGGGTGGAGAGTGGGAGGAAGG - Intergenic
1081089667 11:38847633-38847655 AAGGTGGGAGGGCAGGAGGAGGG - Intergenic
1081238714 11:40678288-40678310 TAGATGGGGGAGAAGGAGGAGGG - Intronic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081409130 11:42735022-42735044 GAGGGAGGAGAGAAGGAGGAGGG + Intergenic
1081425508 11:42922036-42922058 CAGGGTGGAGGGTTGGAGGAGGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081748439 11:45489374-45489396 CAGGTGGGAGGGAGGCAGGAAGG - Intergenic
1081753871 11:45531103-45531125 CAGGCTGGAGTGAGAGAGGAGGG + Intergenic
1081810937 11:45913851-45913873 CAGGTAGTAGAGCAGCAGGATGG + Exonic
1081866233 11:46362088-46362110 TGGGTTGGAGGGAAGGAGGTGGG - Intronic
1081993081 11:47347915-47347937 AAGGGTGGAGAGATGGGGGAAGG + Intronic
1082217998 11:49598027-49598049 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1082677877 11:56130909-56130931 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1082873557 11:57965964-57965986 GATGGTGGAGAGTAGGAGGAGGG - Intergenic
1082884993 11:58071909-58071931 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1083000474 11:59286594-59286616 CAGTTTGTAGACAAGGAGTAAGG - Intergenic
1083226806 11:61290465-61290487 CAGGCTGGAGTGAAGTAGCATGG - Intronic
1083370853 11:62179288-62179310 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1083388518 11:62330907-62330929 TAGGTGGGAGAGAATGTGGATGG - Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1083855358 11:65390540-65390562 GGGGGTGGAGAGAAGGATGAGGG - Intronic
1084304296 11:68271764-68271786 GAGGTTGGGGGGCAGGAGGAGGG - Intronic
1084592282 11:70097691-70097713 AAGGTTGGAGAGAAGGCGGATGG + Intronic
1084667426 11:70583960-70583982 GAGGTTAGAGGGAAGCAGGAGGG - Intronic
1084859528 11:72009217-72009239 GAGGTTGAAGGGCAGGAGGAAGG + Intronic
1085026464 11:73239415-73239437 CAGCATGGAGAGGAGGAAGAGGG + Intergenic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085409616 11:76283400-76283422 CAGGTGGGAGGGGAGGAGAAGGG + Intergenic
1085569526 11:77547282-77547304 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1086017741 11:82187443-82187465 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1086154417 11:83649750-83649772 GAGATTGGAGGGTAGGAGGAAGG + Intronic
1086254811 11:84862994-84863016 TTGGTGGGAGAGAAGCAGGACGG - Intronic
1086271617 11:85074091-85074113 GAGTGTGGAGAGTAGGAGGAAGG + Intronic
1086568648 11:88257335-88257357 GAGGGCGGAGAGTAGGAGGATGG - Intergenic
1086616145 11:88822800-88822822 GGGGAGGGAGAGAAGGAGGAAGG - Intronic
1086631574 11:89026161-89026183 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1087102701 11:94380671-94380693 CAGGATGTAGAGCAGGATGAAGG + Exonic
1087136832 11:94729650-94729672 CAGATTTGAGGGATGGAGGAGGG - Intronic
1087208930 11:95426434-95426456 AAGGTTTGAAAAAAGGAGGAAGG - Intergenic
1087296001 11:96374753-96374775 GAGGGTGGAGAGTAGGAGGAGGG - Intronic
1087417768 11:97879873-97879895 GAGGTTGGAGGGCAGGAGGAGGG - Intergenic
1087514424 11:99140349-99140371 AAGGATGGAGGGTAGGAGGAGGG - Intronic
1087959070 11:104325669-104325691 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
1087973222 11:104511737-104511759 AAGGTAGGAGGGAAGGAGGTAGG + Intergenic
1088016001 11:105060945-105060967 GAGGAAGGAGTGAAGGAGGAGGG - Intronic
1088365213 11:109033123-109033145 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
1088497538 11:110446657-110446679 CAGGTTGGGAAGAAAGAGGAAGG - Intronic
1088700827 11:112409700-112409722 CCAGCTGGAGAGAAGGAGAAGGG + Intergenic
1088811917 11:113397891-113397913 AAGGTTGGAGAGAGGGAAGGAGG + Intronic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1089071067 11:115700138-115700160 GAGGTTGGAGAAAGGAAGGAGGG + Intergenic
1089196342 11:116695971-116695993 AAGAAAGGAGAGAAGGAGGAAGG - Intergenic
1089420435 11:118329107-118329129 CAGGGTGGAGGGTGGGAGGAGGG + Intergenic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089743797 11:120603049-120603071 AAGGTAGGAGAGAAGGAGGAAGG + Intronic
1090123184 11:124054935-124054957 GAGGTTGGAGAAAGTGAGGACGG - Intergenic
1090202267 11:124865380-124865402 GGGGGTGGAGAGAAGGACGAGGG + Exonic
1090390965 11:126386942-126386964 CAGTTTGGCAAGTAGGAGGAGGG + Intronic
1090580403 11:128152885-128152907 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090580420 11:128152929-128152951 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090742674 11:129679737-129679759 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1090752567 11:129760326-129760348 CAGGTTGGAGGGAAGCTGGGAGG - Intergenic
1091458241 12:624127-624149 TAGGTTGTAGAGTAAGAGGATGG - Intronic
1091660742 12:2381416-2381438 CAGGTTGTAGAGACAGATGATGG + Intronic
1091666211 12:2420242-2420264 AAGGATGGAGGGAAAGAGGAGGG - Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091729668 12:2871048-2871070 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1091796993 12:3303306-3303328 CAGTTGGGAGATTAGGAGGAAGG - Intergenic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1091976158 12:4827271-4827293 AAGGAAGGAGGGAAGGAGGAGGG - Intronic
1091993127 12:4973018-4973040 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993138 12:4973059-4973081 AAGGTAGGAGAGCAGGAGAATGG - Intergenic
1091993148 12:4973100-4973122 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993159 12:4973141-4973163 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993170 12:4973182-4973204 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993180 12:4973223-4973245 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993191 12:4973264-4973286 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993201 12:4973305-4973327 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993211 12:4973346-4973368 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993222 12:4973387-4973409 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993233 12:4973428-4973450 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993243 12:4973469-4973491 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993254 12:4973510-4973532 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993265 12:4973551-4973573 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993276 12:4973592-4973614 AAGGTAGGAGAGCAGGAGAATGG - Intergenic
1091993286 12:4973633-4973655 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993297 12:4973674-4973696 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993308 12:4973715-4973737 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993319 12:4973756-4973778 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993340 12:4973838-4973860 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993350 12:4973879-4973901 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993360 12:4973920-4973942 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1091993370 12:4973961-4973983 AAGGTAGGAGAGGAGGAGAATGG - Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092621737 12:10279136-10279158 GAGGGTGGAGAGTAGAAGGAGGG - Intergenic
1092657669 12:10704120-10704142 GAGATTGGAGAGATGAAGGATGG - Exonic
1092982148 12:13807429-13807451 CAGGGAGGTGAGAAGGAGAAGGG - Intronic
1093019641 12:14191462-14191484 GAGTTTGGAGGGAGGGAGGAGGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093167175 12:15817503-15817525 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1093219958 12:16408217-16408239 GAGGTTGGAGGGTGGGAGGAGGG + Intronic
1093447632 12:19278796-19278818 CGGGGTGGAGAGAGGGAGAAAGG - Intronic
1093491657 12:19711531-19711553 GAGGTTGGAGAGGAGGATGAAGG + Intronic
1093586346 12:20841718-20841740 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1093675392 12:21933224-21933246 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1094088215 12:26617705-26617727 AAGGAAGGAGGGAAGGAGGAAGG + Intronic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094232949 12:28128688-28128710 TAGGTTTGAGACAAGGTGGATGG - Intergenic
1094448198 12:30555782-30555804 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1094633504 12:32201457-32201479 AATATTGGAGGGAAGGAGGATGG + Intronic
1094700821 12:32869102-32869124 CAGGTTGGTAGGCAGGAGGAGGG - Intronic
1095288680 12:40448686-40448708 AAGGAAGGAAAGAAGGAGGAAGG - Intronic
1095312314 12:40714367-40714389 TATGTTGGAGAGATGGGGGAAGG - Intronic
1095618661 12:44223191-44223213 CAGGGTGGAGGGTAGGAAGAGGG - Intronic
1095722844 12:45419741-45419763 CTGGTTGGAAGGAAGGAGAAAGG - Intronic
1095865636 12:46969133-46969155 CAGGTTGGAGTGATAAAGGAGGG - Intergenic
1095947711 12:47763298-47763320 TGGGATGGAGAGAGGGAGGATGG + Intronic
1095970047 12:47895394-47895416 TGGGAGGGAGAGAAGGAGGAGGG + Intronic
1096016480 12:48280747-48280769 CAGATACCAGAGAAGGAGGAAGG - Intergenic
1096197063 12:49655603-49655625 AAGGAGGGAAAGAAGGAGGAAGG + Intronic
1096324518 12:50647471-50647493 CAGGGTGGAGAGGAAAAGGAGGG - Intronic
1096523750 12:52198639-52198661 CTGGGTGGAGAGGAGCAGGAAGG + Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096982706 12:55737566-55737588 CAGATTGGGGATAAGCAGGAGGG + Intergenic
1097100774 12:56587580-56587602 CAGGCTGGAGAGAAATGGGATGG - Exonic
1097319957 12:58214434-58214456 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097338140 12:58407650-58407672 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1097407827 12:59212607-59212629 CAGGTTTGAGAAAGGGAAGAAGG + Intergenic
1097653159 12:62328724-62328746 CAGTTTTGACAGAAAGAGGAAGG + Intronic
1097930364 12:65177257-65177279 AGGGTTGGAGGGAAGGAGTAGGG + Intronic
1097974531 12:65670424-65670446 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1098230351 12:68366719-68366741 AAGGTATGAGAGAAGAAGGAAGG - Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098253866 12:68596419-68596441 CTTGTTTGAGAGAAGGAGCATGG + Intergenic
1098701321 12:73631222-73631244 GAGGTGGAAGAGAAGGAGGAGGG + Intergenic
1099036233 12:77590511-77590533 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1099617170 12:84950802-84950824 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1099685230 12:85877632-85877654 GAGGGTGGAGTGGAGGAGGAAGG - Intronic
1099991658 12:89728882-89728904 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1100110787 12:91239695-91239717 CAGGTTGGAGAGAAACAGAAGGG - Intergenic
1100420043 12:94423969-94423991 CAGGCTGGAGAGAAATGGGATGG + Intronic
1100444223 12:94646248-94646270 TAGGTTAGAGAGATGGGGGAGGG + Intronic
1101291125 12:103370728-103370750 GAGGGTGGAGTGGAGGAGGAGGG + Intronic
1101327554 12:103729198-103729220 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1101400646 12:104383833-104383855 GAGGTTGGAGAGATGTAAGAAGG - Intergenic
1101497638 12:105270515-105270537 TAGGAAGGTGAGAAGGAGGAAGG + Intronic
1101727091 12:107396796-107396818 CTGCCTGGAGGGAAGGAGGAAGG - Intronic
1101925623 12:108969236-108969258 AAGGAGGGAGGGAAGGAGGAGGG - Intronic
1101952440 12:109187143-109187165 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
1102052858 12:109875712-109875734 CCAATTGGAGATAAGGAGGAAGG + Intronic
1102501151 12:113353538-113353560 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1102517526 12:113459876-113459898 CAGGTTGGGGAGAGAGGGGAGGG - Intergenic
1102598762 12:114012961-114012983 AAGGAGGGAGAGACGGAGGAGGG + Intergenic
1102598767 12:114012976-114012998 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1102703138 12:114857563-114857585 GAGGATGGAGGGCAGGAGGAGGG - Intergenic
1102764721 12:115422918-115422940 AAGGGAGGAGAGAAGGAGGAAGG + Intergenic
1102781208 12:115566383-115566405 GAGAGTGGAGAGGAGGAGGAGGG + Intergenic
1103074116 12:117968626-117968648 GAGGAGGGAGAGGAGGAGGAGGG + Intronic
1103076938 12:117991132-117991154 GAGGAGGGAGAGAACGAGGAGGG + Intergenic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103234949 12:119364147-119364169 AAGGAAGGAGAGAAGAAGGAAGG - Intronic
1103389577 12:120562139-120562161 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1103789302 12:123458249-123458271 CACGCCGGAGAGAAGGAAGAGGG + Intronic
1103948484 12:124539778-124539800 CAGGGTGGAGAGCAGGGTGACGG - Intronic
1103954356 12:124567936-124567958 GGGGCTGGAGAGGAGGAGGAGGG - Intergenic
1104064711 12:125297196-125297218 CAGGGTGGATGGGAGGAGGAGGG + Intronic
1104298038 12:127536392-127536414 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1104305349 12:127605532-127605554 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104653625 12:130556795-130556817 CAGTGTGGAGAGGAGCAGGAAGG + Intronic
1104862747 12:131932963-131932985 CAGGTGCGAGAGAGTGAGGAGGG + Intronic
1104900047 12:132184737-132184759 CAGGGTGGAGAGAAGCAGGCTGG - Intergenic
1105273948 13:18904052-18904074 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1105274055 13:18904574-18904596 AAGGGTGGCGAGTAGGAGGAAGG - Intergenic
1105303919 13:19156290-19156312 CAGGATGAAGAGCAGGTGGAAGG - Intergenic
1106001635 13:25729058-25729080 GAGGAAGGAGAGAAGGAGAAAGG - Intronic
1106041657 13:26099287-26099309 TACGTTGGAGAGATGGAAGAAGG + Intergenic
1106068988 13:26388851-26388873 TATGTTGGTGAGGAGGAGGAGGG - Intronic
1106125029 13:26894237-26894259 AAGGGAGGAGGGAAGGAGGATGG + Intergenic
1106426897 13:29639921-29639943 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1106625462 13:31416640-31416662 TAGGTAGAAGAGGAGGAGGAGGG - Intergenic
1106828953 13:33557199-33557221 AAGGAGGGAGAGAAGGAAGAGGG - Intergenic
1106986414 13:35357440-35357462 CAGGGTGGAGGGTAGGAGGAGGG - Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107263974 13:38528710-38528732 AAGGAAGGAGAGAAGGAGGGAGG - Intergenic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107509051 13:41062880-41062902 CAGGTTGATGAAAAGGAAGAAGG - Intronic
1107533764 13:41308866-41308888 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1107573439 13:41688822-41688844 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107788458 13:43977641-43977663 GAAATGGGAGAGAAGGAGGAAGG - Intergenic
1107892930 13:44930196-44930218 CAGGTTAGAAAGTGGGAGGAGGG - Intergenic
1107993896 13:45842156-45842178 TATGTTGGAGGGAAGGGGGAAGG - Intronic
1108047179 13:46394307-46394329 CAGGTAGGAGATAAGGGAGAGGG - Intronic
1108307354 13:49151716-49151738 CAGGTTGGGGGGATGGGGGAGGG - Intronic
1108395938 13:49991712-49991734 CAGGGTGGAGATGAGGAGCATGG - Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108450469 13:50557571-50557593 TAGGTTGAAGAGAAAGATGAGGG - Intronic
1108529262 13:51313728-51313750 CATGTTGTATAGAAGGAGAAGGG + Intergenic
1108556637 13:51599990-51600012 GAAGTAGGGGAGAAGGAGGAAGG - Intronic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109642862 13:65213098-65213120 AAGGATGGAAAGAGGGAGGAAGG + Intergenic
1109955776 13:69563805-69563827 GAGGTTGGAGTGTAGGGGGAGGG + Intergenic
1110149589 13:72234759-72234781 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
1110215661 13:73021847-73021869 AAAGAGGGAGAGAAGGAGGACGG + Intergenic
1110396681 13:75037856-75037878 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1110438181 13:75498175-75498197 AAGGAGGGAGAGAAGGAGGGAGG - Intergenic
1110493557 13:76137700-76137722 AGGGTAGGAGAGTAGGAGGAGGG - Intergenic
1110523324 13:76506240-76506262 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1110788968 13:79566497-79566519 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1111150063 13:84241329-84241351 CAAGTGGGATAGAATGAGGAAGG - Intergenic
1111272510 13:85904947-85904969 CAAGGTGGAGAGTAGGAAGAGGG + Intergenic
1111435143 13:88196829-88196851 GAGGTTGAAGAGTGGGAGGAGGG - Intergenic
1112499854 13:99934457-99934479 GAGGAAGGAGAGAAAGAGGATGG + Intergenic
1112630696 13:101158446-101158468 GAGGTGGCAGAGAAGGAGAAAGG + Intronic
1113127662 13:106998104-106998126 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1113206025 13:107917028-107917050 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1114201812 14:20528123-20528145 CAGGAAGGAGAGGAGGATGAAGG - Intergenic
1114220176 14:20689341-20689363 CAGGTTGAAGGGAAGAAGGAAGG + Intronic
1114466104 14:22923978-22924000 CAGGTTGGGGTGTAGGTGGAGGG - Intronic
1114538995 14:23441002-23441024 GAGGTTGGAGAGAAGAGGAAAGG + Intergenic
1114549708 14:23525741-23525763 GAGGTTGGGGTGGAGGAGGAGGG + Exonic
1114598474 14:23934469-23934491 CAGGTTGGAGGGATGGATGATGG - Intergenic
1114613782 14:24057877-24057899 CAGGTGGGAGAGGAGGGGGAAGG + Exonic
1114632110 14:24165745-24165767 CATGATGGAGAGAGGTAGGAGGG - Intronic
1114662212 14:24354252-24354274 GAGGGAGGAGGGAAGGAGGAAGG - Intergenic
1115044223 14:28970921-28970943 GAGATTGGAGGGTAGGAGGAGGG - Intergenic
1115713629 14:36077409-36077431 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1115752428 14:36505895-36505917 CAGTGTGGAGAGAAGGAGAGGGG - Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116051112 14:39804382-39804404 GAGGATGGAGTCAAGGAGGAGGG + Intergenic
1116361484 14:44004110-44004132 GAGGGTGGAGGGACGGAGGAAGG + Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116575370 14:46567798-46567820 AAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1116817720 14:49599154-49599176 CAGGGTGGAGATGAGCAGGAAGG - Exonic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117342164 14:54801862-54801884 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1117478179 14:56118337-56118359 CGGGAGGGAGGGAAGGAGGAGGG - Intronic
1117604684 14:57415797-57415819 CAGTTTGGAGGGAGGGAGGGAGG - Exonic
1117983279 14:61363029-61363051 CGGGTGAGAGAGAAGGAGGAAGG + Intronic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118591739 14:67407003-67407025 CCTTTTGGAGAGAAGGACGAGGG + Intronic
1118598825 14:67457127-67457149 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1118660633 14:68005920-68005942 CAGGTGGAAGAGAGAGAGGAGGG + Intronic
1118665915 14:68069428-68069450 AAGGGTGGAGAGTGGGAGGATGG - Intronic
1118893581 14:69928205-69928227 CAGGCTGGAAAGCAGGAGGTTGG + Intronic
1119543923 14:75458312-75458334 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1119714261 14:76847537-76847559 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1120277950 14:82401179-82401201 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1120517857 14:85491420-85491442 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1120521194 14:85530081-85530103 TAGGAGGGAGAGGAGGAGGAGGG + Intergenic
1120895422 14:89527072-89527094 AAGGGAGGAGAGGAGGAGGAAGG + Intronic
1120901164 14:89576778-89576800 CAGTTGGGAGAGACGGAGGAGGG - Intronic
1120960458 14:90120057-90120079 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1121439891 14:93941973-93941995 GAGGTTGGACAGAAGGTGGGTGG + Intronic
1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG + Intergenic
1121504002 14:94462356-94462378 CATGTTGGAGAGACAGAGCAGGG - Intergenic
1121507868 14:94490332-94490354 CTAGTTGGAGGGCAGGAGGATGG - Intronic
1121556157 14:94839364-94839386 CTGATGGGAGGGAAGGAGGAAGG - Intergenic
1121837816 14:97107679-97107701 GAGGGTGGAGTGAGGGAGGAGGG + Intergenic
1121882585 14:97514316-97514338 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1121989934 14:98547035-98547057 TGGGTGGGAGAAAAGGAGGAAGG + Intergenic
1122002085 14:98667018-98667040 AAGGAAGGAGAGAAGGAGGGAGG - Intergenic
1122319516 14:100845394-100845416 CAGGCCGGCGAGGAGGAGGAGGG - Intergenic
1122388108 14:101362610-101362632 CAGGTCGGGGAGAAGGTGGCCGG - Intergenic
1122401096 14:101467866-101467888 GAGGATGGAGAGAAGAGGGATGG + Intergenic
1123045929 14:105514584-105514606 GAGGGTGGAGAGTTGGAGGAGGG + Intergenic
1123113134 14:105882242-105882264 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1123115480 14:105892392-105892414 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1123724354 15:23087309-23087331 CAGTTTGCAGAAAAGGAGGCAGG + Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1124101390 15:26697487-26697509 CAGGGTGGAGGGAAGGAGACAGG - Intronic
1124142925 15:27093206-27093228 CAGGTTGGTGAGGTGGAGGCAGG + Intronic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1124594720 15:31083030-31083052 CTGGACGGAGACAAGGAGGAAGG + Intronic
1125037962 15:35149065-35149087 AAGGGAGGAGAGAAGGGGGATGG - Intergenic
1125132158 15:36295557-36295579 CAAGTTTGAGACAAGGAGAATGG + Intergenic
1125873788 15:43126153-43126175 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1126046561 15:44646824-44646846 GAGGGTGGAGGGTAGGAGGAAGG + Intronic
1126213292 15:46125274-46125296 CAGGATGGAGGGTGGGAGGAGGG + Intergenic
1126233924 15:46359742-46359764 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1126332771 15:47551331-47551353 CAGGTTGCAGAGTTGGGGGAAGG + Intronic
1126502479 15:49361389-49361411 GAGGGAGGAGGGAAGGAGGAGGG - Intronic
1126871769 15:52996853-52996875 AGGGTAGGAGAGAAGGAGCAAGG + Intergenic
1127022858 15:54769426-54769448 GAGGGTGGAGGGAAGGAGGAGGG + Intergenic
1127137553 15:55940476-55940498 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1127556076 15:60088975-60088997 CAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1128037885 15:64542746-64542768 GGGGATGGAGAGAAGGAGGGTGG - Intronic
1128243048 15:66114640-66114662 AAGCTTGGAGGGAGGGAGGAAGG + Intronic
1128290829 15:66477097-66477119 GGGGTTGGAGAGGAGGAGAAGGG - Intronic
1128297611 15:66537860-66537882 GAGGTCTGAGAGAAGGAAGAGGG - Intronic
1128311121 15:66632242-66632264 GGGGAAGGAGAGAAGGAGGAGGG + Intronic
1128726630 15:69992705-69992727 CAGGCTGGAGTGAGTGAGGAGGG - Intergenic
1129065461 15:72900282-72900304 TAGGTGGGAGAGAAGGTGGATGG + Intergenic
1129118766 15:73382161-73382183 CTGGTTGGAGGGAAGGCTGAGGG - Intergenic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1129876177 15:78977182-78977204 GAAGTTGGAGAGAAAGAGGAAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130324460 15:82868431-82868453 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1130427411 15:83815066-83815088 GAGGATGGAGAGGAGGAGAAGGG - Intronic
1130560219 15:84952157-84952179 CAGGTGGGAGGGGAGCAGGATGG - Intergenic
1130717676 15:86351788-86351810 CAGCTTGTAGAGAAGGCAGAAGG - Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1131140248 15:89971537-89971559 CAGGTGGGGGAGAGGGAGAATGG - Intergenic
1131179048 15:90227958-90227980 CAGGTTGGAGAGGAGCGGGCAGG - Exonic
1131296753 15:91156031-91156053 TTGGTTGGAGAGAAGCAAGAAGG + Intronic
1131341671 15:91608371-91608393 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1131344965 15:91637886-91637908 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1131418776 15:92285787-92285809 TAGATGGGAGAGAAGGTGGATGG - Intergenic
1131549150 15:93341762-93341784 CTGGTTGGAGTGGAGGAGGAAGG - Intergenic
1131600779 15:93846679-93846701 GAGGTTGCAGAGAAAAAGGAAGG + Intergenic
1131649882 15:94387156-94387178 AAGGAAGGAGAGAGGGAGGAAGG - Intronic
1131727180 15:95239414-95239436 CAGGAGGGGGAGAAGAAGGAAGG + Intergenic
1132169926 15:99640500-99640522 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132529729 16:440497-440519 CAGGTAGGAGAAAAGGGGGAAGG - Intronic
1132590099 16:722860-722882 CTGGTTGGAATGAAGGATGATGG - Intronic
1132977095 16:2716332-2716354 CAGAAAGGAGAGGAGGAGGAAGG - Intronic
1133002386 16:2857941-2857963 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
1133551161 16:6855814-6855836 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1133725238 16:8531030-8531052 CAGGACGGAGGGAAGAAGGAAGG + Intergenic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1134034169 16:11016931-11016953 CAGATGGGAGGGAAGGGGGATGG + Intronic
1134287966 16:12879084-12879106 AAGGAGGGAGAGAAGAAGGAAGG - Intergenic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134382092 16:13737351-13737373 GAGGTGGGAGAGAAGGAGGTGGG - Intergenic
1134394959 16:13854232-13854254 AGGGAAGGAGAGAAGGAGGAGGG + Intergenic
1134649585 16:15898158-15898180 GAGGTTGAGGAGGAGGAGGAGGG - Intergenic
1134834831 16:17352375-17352397 GAGGTAGGAGAGAAGGAGAGAGG - Intronic
1135180079 16:20265279-20265301 GAGGGTGGAGAGGGGGAGGAGGG - Intergenic
1135300133 16:21319659-21319681 CAGGCTGGGGAGACAGAGGATGG - Intergenic
1135529086 16:23237251-23237273 AAGGTAGGAAAGAAGGAGAAGGG - Intergenic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1136268022 16:29132159-29132181 GAGGATGGAGGGAGGGAGGAAGG + Intergenic
1137684067 16:50373782-50373804 AAGCTGGGAGAGAAGCAGGACGG + Intergenic
1137858122 16:51817341-51817363 GAGGATGGAGGGAAGGAGGATGG - Intergenic
1137869078 16:51932207-51932229 CAGGTTGGAGATGGGGTGGAAGG - Intergenic
1137904209 16:52302759-52302781 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1138435109 16:56994218-56994240 AAGGAAGGAGAGAAGGTGGAGGG + Intronic
1138446651 16:57068496-57068518 GAGGTGGGAAAGAAGGAGGGAGG - Intronic
1138458811 16:57135973-57135995 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
1138747854 16:59384484-59384506 CAGTTTGGGGACAAGGAGAAAGG + Intergenic
1138860304 16:60747845-60747867 CACGTTGTAGAGAAAGTGGAGGG + Intergenic
1139210102 16:65068363-65068385 CAGGTGGGTGAGAAGAATGAAGG + Intronic
1139255111 16:65533669-65533691 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1139303108 16:65961978-65962000 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139794086 16:69468020-69468042 CAGGTTGGAGAGCAGTGGCATGG + Intergenic
1139802589 16:69535620-69535642 TAGGATAGAGGGAAGGAGGAGGG + Intergenic
1139837763 16:69853454-69853476 AAGGTTGGAAAGCAGAAGGAAGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140219978 16:73036633-73036655 CCGGCAGGAGAGAGGGAGGAGGG + Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140600808 16:76472802-76472824 GAGGTTGGAGGGTGGGAGGAGGG + Intronic
1140765752 16:78155215-78155237 AAGAAAGGAGAGAAGGAGGAAGG + Intronic
1140906694 16:79415352-79415374 CAGGCAGGCAAGAAGGAGGAAGG + Intergenic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1141121584 16:81362719-81362741 GAGGTTGGAGCGAATGAGGCAGG - Intronic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141170215 16:81686219-81686241 CAGGTGGGAGGAAAGGAGGAAGG + Intronic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141427142 16:83951887-83951909 AAGCAGGGAGAGAAGGAGGAAGG - Intronic
1141447527 16:84071282-84071304 CAGGTGGGAGAAAAGCAGAAAGG + Intronic
1141597801 16:85107944-85107966 CAGCCTGCAGAAAAGGAGGAGGG + Exonic
1141678708 16:85531454-85531476 CGGGTAGGAGAGAGGGAGGAAGG + Intergenic
1141881713 16:86864575-86864597 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1142114016 16:88347152-88347174 CAGCTTGGTGGGAAGGAGGTAGG - Intergenic
1142239950 16:88940600-88940622 CAGGAGGGAGAGGAGCAGGAGGG + Intronic
1142395473 16:89828973-89828995 AAGGAGGGAGAGAAGGAGGGAGG - Intronic
1142581988 17:948880-948902 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142581996 17:948899-948921 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582004 17:948918-948940 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582012 17:948937-948959 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142993475 17:3747230-3747252 CAAGTCAGAGAGAAAGAGGAGGG + Intronic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143305941 17:5946797-5946819 AAGGGTGGAGAGGAGAAGGATGG + Intronic
1143710544 17:8731750-8731772 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1143737365 17:8922158-8922180 AGGGTGGGAGAGAAGGAGGGAGG + Intronic
1143867887 17:9937355-9937377 CAGGCTGGAGAGATGGAAGCCGG + Intronic
1143938259 17:10510027-10510049 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1143991162 17:10963443-10963465 GGGGCTGGAGAGAAGGAGCATGG + Intergenic
1144183345 17:12772924-12772946 GAGGCAGGAGAGAAAGAGGAGGG + Intergenic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144247770 17:13384392-13384414 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1144409020 17:14981873-14981895 GAGTTTGTAGAGAAGCAGGACGG + Intergenic
1144607301 17:16678250-16678272 CTTGTTGGAGAGTGGGAGGAAGG - Intergenic
1144695668 17:17302434-17302456 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1144767225 17:17739427-17739449 CAGGAGGGAGAGAAAGAAGAGGG + Intronic
1145063917 17:19749172-19749194 CCAGGTGGAGAGAAGCAGGAGGG - Intergenic
1145115210 17:20203908-20203930 CAGATGGCAGAGAAGGAAGAAGG - Intronic
1145201111 17:20945580-20945602 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1145773159 17:27508046-27508068 CAGGTTGGGGAGCAGGAGACTGG - Intronic
1145786435 17:27596978-27597000 CAGGATGGAGAGGAGGAGCGTGG + Intronic
1145935594 17:28712905-28712927 CAGGATGAAGAGGAGGAGAAAGG + Intergenic
1145936049 17:28715485-28715507 CAGGTTGAAGACAATGATGATGG + Exonic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146399631 17:32492963-32492985 AAGGCTGGAGGGCAGGAGGAGGG - Exonic
1146508711 17:33427545-33427567 GAGGATGGAGAGTTGGAGGATGG - Intronic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1146532177 17:33617498-33617520 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1146670799 17:34736317-34736339 GAGGAGGGAGAGGAGGAGGAGGG + Intergenic
1146817666 17:35956135-35956157 AAGGGTGGAGAGTAGGAAGAGGG - Intergenic
1146821192 17:35984663-35984685 GGGGTTGAAGAAAAGGAGGAAGG - Intronic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1146916759 17:36682905-36682927 CAGTTGGGAGGGAAGGAGGAAGG - Intergenic
1147193362 17:38749396-38749418 CAGGAGGGAGAGAACGAGGAGGG + Exonic
1147303760 17:39549514-39549536 AAGAATGGAGAGAGGGAGGAAGG - Intronic
1147308374 17:39579070-39579092 CAGATGGGTGAGGAGGAGGAAGG - Intergenic
1147388505 17:40095586-40095608 CAGGTGGGAGGGTAGGAGGAGGG + Exonic
1147447581 17:40484209-40484231 ATGGTGGGAGAGAAGGAGGAGGG - Intronic
1147492132 17:40879399-40879421 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1147575120 17:41594564-41594586 GAGGATGGAGAGTAAGAGGAGGG + Intergenic
1147575133 17:41594612-41594634 GAGGAGGGAGAGCAGGAGGAAGG + Intergenic
1147697709 17:42368890-42368912 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1148287839 17:46411576-46411598 CAGGTTGGCCAGAAGTGGGATGG + Intergenic
1148310008 17:46629156-46629178 CAGGTTGGCCAGAAGTGGGATGG + Intronic
1148645536 17:49217929-49217951 TGGGTTGGAGGGAAAGAGGAGGG - Intronic
1148736149 17:49865967-49865989 CAGGAGGGAGAGAAGGCGGCAGG + Intergenic
1148798952 17:50211098-50211120 GAGGAGGGAGAGAAGGAGGGGGG - Intergenic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1148853444 17:50565822-50565844 CAGGAGGGAGGAAAGGAGGAGGG + Intronic
1148967106 17:51445304-51445326 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1148971618 17:51488224-51488246 CATGTTAGAGAGACGGAGGGCGG + Intergenic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149325329 17:55524066-55524088 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1149381339 17:56097089-56097111 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1149485188 17:57037013-57037035 CTGGGTGGAGAAAAGGAGGCTGG + Intergenic
1149490093 17:57078367-57078389 CAGGTTTCAGAGAGGGAGCATGG - Intergenic
1149677148 17:58476141-58476163 GAGGAAGGAGAGAAGGATGAAGG - Intronic
1149996182 17:61407146-61407168 CAGGTTGGGAGGAAGGAGGGAGG - Intronic
1150136285 17:62697055-62697077 CAGGCTGGAGGGAGGGAGGGCGG + Intergenic
1150198583 17:63328188-63328210 GAGGGTGGAAAGTAGGAGGAAGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150549772 17:66198565-66198587 CAGGATGGAGACAAGAAAGAAGG + Intergenic
1150552957 17:66227881-66227903 CAGGTTGGAGAGAAATGAGAAGG - Intronic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1150598389 17:66627439-66627461 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1150629797 17:66871398-66871420 TTAATTGGAGAGAAGGAGGAAGG - Intronic
1150984815 17:70184433-70184455 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151142469 17:72007049-72007071 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1151155480 17:72121158-72121180 CGAATTGGAGAGGAGGAGGAGGG - Exonic
1151355367 17:73555009-73555031 CAGGCTGGGAGGAAGGAGGATGG + Intronic
1151677977 17:75609628-75609650 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151699895 17:75737519-75737541 CAGTCTGGAGAGGAGGAGGCAGG - Exonic
1151879425 17:76886246-76886268 GAGGTTTGAGAGCAGGTGGAGGG + Intronic
1151938078 17:77275826-77275848 CTGGTGCGAGGGAAGGAGGAAGG - Intergenic
1152071168 17:78134455-78134477 CAGGTAGGAGAGCAGGCGGCAGG - Exonic
1152261570 17:79270054-79270076 GAGGGTGGCAAGAAGGAGGAAGG - Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152698261 17:81806842-81806864 CAGGCGGGGGACAAGGAGGAAGG - Intronic
1153160522 18:2199858-2199880 CAAGTTGGAGAGAACCATGAAGG + Intergenic
1153329152 18:3855280-3855302 GAGGGTGGAGGGAGGGAGGAAGG + Intronic
1153447096 18:5186221-5186243 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1154339907 18:13494093-13494115 GAGTTTGGGGAGAAGGAGCAGGG + Intronic
1154395673 18:13986290-13986312 AAGGTTGCAGAGAAAAAGGAAGG + Intergenic
1154465614 18:14641105-14641127 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1155244479 18:23894364-23894386 CAACTTGGAAAGGAGGAGGAGGG - Intronic
1155334227 18:24748676-24748698 GAGGGAGGAGGGAAGGAGGAAGG - Intergenic
1155334236 18:24748699-24748721 GAGGGAGGAGGGAAGGAGGAAGG - Intergenic
1155334245 18:24748722-24748744 GAGGGAGGAGGGAAGGAGGAAGG - Intergenic
1155342814 18:24830174-24830196 CAGGTTGGGGTGGAGGAGGAGGG - Intergenic
1155445215 18:25904250-25904272 CAGGTTGAAGATAAGGAGATAGG + Intergenic
1155445262 18:25904836-25904858 CAGGTTGAAGATAAGGAGATAGG - Intergenic
1155880842 18:31146229-31146251 AAGGTGGGAGGGAAGGAGGAGGG - Intronic
1156076459 18:33284254-33284276 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1156199871 18:34818461-34818483 TAGGGTGGAGAGTGGGAGGAAGG - Intronic
1156257251 18:35410097-35410119 CAGGGTGGAGCTAAGGAGGGTGG - Intergenic
1156389946 18:36640996-36641018 CATGTTGCAGAGAAGAAGGATGG - Intronic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1156843818 18:41639513-41639535 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156896238 18:42249564-42249586 AAGGTTGGAGGGTGGGAGGAGGG - Intergenic
1156985054 18:43341301-43341323 TAGGATGGAGAGAGGGAGAAGGG + Intergenic
1157052531 18:44183989-44184011 GAGGTTGGAGGGAGGGAGGAGGG + Intergenic
1157888337 18:51390127-51390149 AAGGGTGGAGAGAAGAAGGCAGG - Intergenic
1157975981 18:52327438-52327460 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1158048211 18:53182815-53182837 AAGGATGGCGGGAAGGAGGAAGG - Intronic
1158174816 18:54643192-54643214 GAGGTTGGAGGTTAGGAGGAGGG - Intergenic
1158525494 18:58209321-58209343 GAGGAGGGAGAGGAGGAGGAGGG - Intronic
1158861916 18:61600881-61600903 CAGGTTAGAGAGGGGGTGGAAGG + Intergenic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1159465426 18:68776660-68776682 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1159518036 18:69483032-69483054 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
1159532207 18:69669244-69669266 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1159919725 18:74216525-74216547 GAGGTTGGAGAGATGGGGAAGGG - Intergenic
1160108173 18:75999203-75999225 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1160373016 18:78390331-78390353 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1160408079 18:78656496-78656518 CATGTGGGAGCGAGGGAGGAGGG - Intergenic
1160590192 18:79940230-79940252 GGGGGTGGAGAGCAGGAGGAGGG + Intronic
1160819840 19:1052686-1052708 TAGGAGGGAGAGGAGGAGGAGGG + Intronic
1160975539 19:1790567-1790589 GAGCTTGGAGGGAAGGGGGAGGG - Intronic
1160991389 19:1861744-1861766 GAGGGTGGAGAGCAGGAGGGCGG - Intronic
1161185974 19:2921060-2921082 CAGGTTGGAATGCAGGAGGCTGG - Intergenic
1161207086 19:3046954-3046976 AAGGTGGGGGAGAAGGAGGGAGG - Intronic
1161208286 19:3053600-3053622 CAGGCTGCAGGGGAGGAGGAGGG + Exonic
1161208962 19:3056501-3056523 CAGGTGGGAGGGAAAGAGGAGGG + Intronic
1161329214 19:3678417-3678439 AAGGATGGAGGGATGGAGGATGG + Intronic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1161329222 19:3678447-3678469 GAGGATGGAGGGATGGAGGATGG + Intronic
1161329228 19:3678462-3678484 GAGGATGGAGGGATGGAGGAGGG + Intronic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1161395371 19:4042608-4042630 CTGGTTGGAGGACAGGAGGAAGG + Intergenic
1161407356 19:4097995-4098017 CTGGCTGGAGAGGAGGAGGTGGG + Intronic
1161414749 19:4139716-4139738 CAAGGGGGAGAGAAGGAGGAGGG + Intergenic
1161415740 19:4145465-4145487 GAGGTGGGGAAGAAGGAGGAGGG + Intergenic
1161615768 19:5269417-5269439 CAGATGGCAGAGGAGGAGGAAGG + Intronic
1161664214 19:5565143-5565165 CAAGGGGGAGAGAGGGAGGAAGG - Intergenic
1161746111 19:6061169-6061191 CAGGTAGGAGATAGGGAGGCAGG - Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162085614 19:8247254-8247276 CAAGGGGGAGAGAGGGAGGAGGG - Intronic
1162087968 19:8259951-8259973 CAGGTGGGAGCCATGGAGGATGG - Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1162964404 19:14149159-14149181 CAGGCTGGAGAGGAGGGGGCCGG + Exonic
1163045983 19:14642573-14642595 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1163059436 19:14748121-14748143 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1163160884 19:15463669-15463691 AAGGTAGGAGAGTAGGAGGCAGG + Intronic
1163273404 19:16267623-16267645 CAGGTTGGATGGGAGGAGGAGGG + Intergenic
1163276369 19:16286762-16286784 CAGGATGGAGAGAGGCAGGCAGG - Intergenic
1163326371 19:16605994-16606016 CAGTTTTGAGTGAAGGAAGAAGG - Intronic
1163389309 19:17020698-17020720 AAGGGTGGAGAGAAAGAAGAGGG + Intronic
1163453982 19:17395210-17395232 GAGGAGGGAGAGTAGGAGGAAGG - Intergenic
1163685105 19:18708169-18708191 CAGGAGGCAGGGAAGGAGGAAGG + Intronic
1163703193 19:18797121-18797143 CAGGGAGGAGGGAAGAAGGAAGG - Intergenic
1164417247 19:28057514-28057536 TGGGTTGGACACAAGGAGGATGG + Intergenic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164794393 19:31014557-31014579 GAGGTGAGAGGGAAGGAGGAAGG + Intergenic
1164816897 19:31211322-31211344 CAGGTTGCAGAGATGAGGGAGGG + Intergenic
1164931204 19:32177589-32177611 CAGGCAGGAGGGAGGGAGGAAGG + Intergenic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165661926 19:37588554-37588576 GAGCACGGAGAGAAGGAGGAGGG + Intronic
1166009148 19:39928182-39928204 CAGACTGGAGATAAGGAGGCGGG + Exonic
1166143447 19:40818556-40818578 CAGATTGGAGGGATGGGGGAAGG + Intronic
1166184106 19:41128222-41128244 CAGATTGGAGGGATGGGGGAAGG - Exonic
1166554087 19:43686596-43686618 CAGGCAGGAGAGAAGGAAGCAGG - Intergenic
1166763017 19:45236118-45236140 GAGGTTGGAGAGGTGGGGGAGGG + Intronic
1166781271 19:45344929-45344951 TAGGTTGGGGGGAATGAGGATGG - Intronic
1167011840 19:46813709-46813731 GAGGTGAGAGAGAAGGAGGCGGG - Intergenic
1167126175 19:47550279-47550301 CAGGAAGGAAGGAAGGAGGAAGG + Intronic
1167691308 19:50985104-50985126 GAGGGTGGAGAGTGGGAGGAAGG - Intergenic
1167801846 19:51748173-51748195 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1167842552 19:52133866-52133888 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
1168083365 19:54026965-54026987 TAGGTTGGAGAGGAGGAGAAAGG - Intergenic
1168109203 19:54182063-54182085 AAGGACGGAGGGAAGGAGGAAGG + Intronic
1168179477 19:54651059-54651081 GAGGGTGGAGAGGAGGGGGATGG - Intronic
1168181619 19:54665860-54665882 GAGGAGGGAGAGAAGCAGGATGG - Exonic
1168317843 19:55491758-55491780 AAGGAAGGAGAGAAGGAGGGAGG - Intronic
1168357848 19:55713587-55713609 GAGGAGGGAGAGGAGGAGGAGGG - Intronic
1202708889 1_KI270714v1_random:5635-5657 GAGGGAGGAGAGAAGGAGGGAGG - Intergenic
925004851 2:434173-434195 AAGGATGCAGCGAAGGAGGAAGG - Intergenic
925012093 2:493834-493856 GAGGTTGGAGGGTGGGAGGAGGG - Intergenic
925017586 2:543642-543664 CAGGCTGGAGGGTAGGAGGCAGG + Intergenic
925082992 2:1084464-1084486 CATGTTGGGGAGCAGGAGGGCGG - Intronic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
925372358 2:3356025-3356047 CATGTTGGGGTGAAGGAGGAAGG + Intronic
925501979 2:4515075-4515097 TAGGTGGGAGAGAAGGCGGATGG + Intergenic
925606793 2:5667853-5667875 AAGGAGGGAGAGAAGGAGGGAGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926008822 2:9392838-9392860 AAGGGAGGAGAGACGGAGGAAGG + Intronic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926663716 2:15496654-15496676 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
926996726 2:18743151-18743173 TAGGCAGGAGAGAAGGAGCAGGG + Intergenic
927075431 2:19572159-19572181 AAGGTGGGAGGGAAGGAGAATGG + Intergenic
927128231 2:20033475-20033497 GAGGGTGGAGAGAGGGAGGTGGG + Intronic
927151408 2:20198514-20198536 CAAGCTGGAGAGAAGGGGCAGGG + Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
927714256 2:25342047-25342069 CCGGAGGGAGGGAAGGAGGAAGG - Intronic
927788680 2:25992723-25992745 GAGGATGGAGAGGAGGAGGTAGG - Intergenic
928166161 2:28973499-28973521 CAGGAAGGAGGGAAGGAGGGAGG - Intronic
928168569 2:28988677-28988699 GAGGTTGGAGAGTAGCTGGAGGG - Intronic
928754206 2:34504216-34504238 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
929210299 2:39349612-39349634 GCGGTTGGAGAGACAGAGGAGGG + Intronic
929217958 2:39436489-39436511 CAGGTTGGCGTGAAGCAGGCAGG + Intronic
929887568 2:45892506-45892528 CAAGCTGGAGTGAGGGAGGAGGG + Intronic
930213028 2:48662909-48662931 GAGGGTGGAGTGTAGGAGGAGGG + Intronic
930365619 2:50435802-50435824 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
930572725 2:53107422-53107444 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
930669881 2:54137424-54137446 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
930762800 2:55053960-55053982 AAGACTGGAGAGAAGGAGAAGGG + Intronic
930926538 2:56824665-56824687 GAGGCTGGAGGGTAGGAGGAAGG + Intergenic
930958723 2:57233267-57233289 CAGCTAGGAGAGAATGAGTAAGG - Intergenic
931014671 2:57962563-57962585 GAGGATGGAGGGAGGGAGGAGGG - Intronic
931316608 2:61139036-61139058 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
931470410 2:62533544-62533566 CCGATAGGTGAGAAGGAGGAAGG - Intergenic
931471438 2:62541688-62541710 CAGACAGGAGAGAAGGAGAAGGG + Intergenic
931701696 2:64914272-64914294 CAGGTGGGAGAGAAGGAAGAAGG - Intergenic
931878398 2:66539873-66539895 CAGGTAGGAGTGGAGGAGCAGGG + Intronic
931891929 2:66682742-66682764 CAGGTGGGAGAGTGGGAGAATGG - Intergenic
931902772 2:66807584-66807606 GAGGTGGGGGAGATGGAGGAGGG + Intergenic
931920053 2:67005434-67005456 AAGGTGGGAGGGAAGGATGAAGG + Intergenic
932090520 2:68801863-68801885 CCAGGTGGAGAGTAGGAGGAAGG + Intronic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
932130244 2:69181001-69181023 CAGGCTGGAGCTCAGGAGGAGGG + Intronic
932279796 2:70480811-70480833 CACCTTGGAGAGAGGGAGGGGGG - Intronic
932374603 2:71224680-71224702 CAGGGTGCAGAGAAGCACGATGG - Intronic
932394071 2:71427204-71427226 GAAGTTGGAGAGGAGGAAGATGG + Exonic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932566744 2:72915784-72915806 GAGGGTGGGGAAAAGGAGGAGGG + Intergenic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
932901243 2:75702883-75702905 TGGGTAGGAGGGAAGGAGGAAGG - Intronic
933018250 2:77159372-77159394 TTGGTTGGGGAGAGGGAGGAGGG + Intronic
933101577 2:78265644-78265666 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933257738 2:80099814-80099836 CGGGGTGGAGAGATGGAAGATGG + Intronic
933319489 2:80755926-80755948 AAGGGTGGAGTGAGGGAGGAGGG - Intergenic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
934033786 2:88071570-88071592 CAAGTTGGAGTTCAGGAGGAAGG - Intronic
934050872 2:88209756-88209778 AGGGTGGGAGAGAAGGAGAAGGG - Intergenic
934263651 2:91498371-91498393 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
934474292 2:94582965-94582987 CAGGTTGGTGAGACAGAGAAAGG + Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935198937 2:100839013-100839035 GGGGTGGGAGAGACGGAGGAAGG - Intronic
935599384 2:104907114-104907136 CATGTTAGAGAGATGGGGGAAGG - Intergenic
935626659 2:105177269-105177291 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
935788610 2:106570986-106571008 AAGGAGGGAGAAAAGGAGGAAGG - Intergenic
937225145 2:120364354-120364376 GAGGTGGGAGAGTGGGAGGAGGG - Intergenic
937239392 2:120450592-120450614 CAGGTGGGAGGGAGGGAAGATGG - Intergenic
937311340 2:120905218-120905240 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
937458916 2:122068613-122068635 CAGGTTAGAGAGTTGGAAGATGG - Intergenic
937650953 2:124318766-124318788 GAGGTAGGAGAGGAGGGGGAAGG - Intronic
937721465 2:125101757-125101779 GAGGTTACAGAGAAGAAGGATGG - Intergenic
937946058 2:127338475-127338497 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938395018 2:130939046-130939068 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
938814959 2:134892688-134892710 CAAGTAGGAGTGAAGAAGGATGG + Intronic
938866701 2:135429383-135429405 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
939162652 2:138608065-138608087 GAGATTGGAGGGGAGGAGGAAGG - Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939849275 2:147284549-147284571 CAGGTGGCAGAGCAGGAGAATGG - Intergenic
940004680 2:148999672-148999694 GAGGTTGGAGGGAAGGAAGAGGG + Intronic
940115484 2:150204076-150204098 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
940546611 2:155096787-155096809 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
940635271 2:156291692-156291714 GATGGTGGAGAGAAGGAGGTTGG - Intergenic
940723698 2:157309965-157309987 CAGGAGGGAGGGAAGGAGAAAGG + Intronic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
940807525 2:158204937-158204959 CAGTCTGGAGAGGAGTAGGAGGG + Intronic
941178280 2:162227494-162227516 AAGGTGGGAGAGATGGAGAATGG - Intronic
941282287 2:163567934-163567956 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941390989 2:164914498-164914520 CAGGTTGGAGACAAAAAGAAAGG + Intronic
941539791 2:166768053-166768075 CAGGGTGGAGTGTGGGAGGAGGG - Intergenic
941693041 2:168521486-168521508 CAGGTGGAAGAAGAGGAGGAGGG + Intronic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
941993632 2:171580663-171580685 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
942406061 2:175656559-175656581 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
942414191 2:175741237-175741259 AAGGAAGGAGGGAAGGAGGAGGG + Intergenic
942451280 2:176109180-176109202 CAGGCTGGTGGGAAGGAGGGTGG - Exonic
942523982 2:176833354-176833376 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
942552395 2:177132927-177132949 TAGGGTGGAGAGGAGTAGGAGGG - Intergenic
942570914 2:177313413-177313435 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
942995800 2:182258256-182258278 CAGTTTGGAGAACAGGAGGAAGG + Intronic
943058821 2:183016786-183016808 GAGGTTGGAGGGAGGGAGGAAGG + Intronic
943177245 2:184492386-184492408 AAGGGTGGAGGGAAGGAGGTTGG + Intergenic
943456079 2:188108847-188108869 GAGGTTGGAGAGTAGGAGGAGGG + Intergenic
943702736 2:191004135-191004157 CAGGGTGGAGGGAAGCAGGGAGG - Intronic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
943865698 2:192922657-192922679 CAGCTAGGAGAGAATGAGTAAGG - Intergenic
943984028 2:194595771-194595793 CAGGTTGGAGAAAATGGGGATGG - Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944174656 2:196816542-196816564 AAGGAAGGAGAGAGGGAGGAGGG + Intergenic
944177636 2:196850642-196850664 AAGGAAGGAGGGAAGGAGGAAGG + Intronic
944229771 2:197380911-197380933 TAGGTGGGAGAGAAGGAGGACGG + Intergenic
944989755 2:205221952-205221974 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
945043297 2:205760604-205760626 GAGATGGGAGAGAAGGAGAAAGG + Intronic
945642211 2:212444104-212444126 CAGGCTGGGGAAGAGGAGGAGGG - Intronic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946153994 2:217794894-217794916 ATGCTTGGAGAGAAGGAGGTAGG + Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
946598285 2:221331015-221331037 CAGATTGGAGAGTGGGAGGAAGG + Intergenic
946645074 2:221824541-221824563 CAGCTTGGTGAGAAGAAGGTGGG + Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947077715 2:226363915-226363937 GAGGAAGGAGGGAAGGAGGAAGG + Intergenic
947159116 2:227194009-227194031 AAGGAAGGAGAGAAGAAGGAAGG + Intronic
947594637 2:231403300-231403322 GAGGTTCCAGACAAGGAGGAAGG + Intergenic
947829135 2:233126370-233126392 CAAGTGAGAGAGTAGGAGGAGGG - Intronic
948034662 2:234848209-234848231 CAGGTTGGGGAAAAGGAGGAGGG + Intergenic
948268865 2:236658394-236658416 AAGGAGGGAGAGAAGGAGGGAGG - Intergenic
948320042 2:237061699-237061721 CAAGATGGGGAGATGGAGGAAGG + Intergenic
948343699 2:237277531-237277553 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
948534440 2:238635542-238635564 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948857908 2:240738835-240738857 CAGACAGGAGAGAAGGAAGAGGG - Intronic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
1168820868 20:773005-773027 CAGGTTGGAGGGGAGGAGACAGG + Intergenic
1169118288 20:3081310-3081332 CAGGAGGGAGTGCAGGAGGAGGG - Intergenic
1169204072 20:3730376-3730398 CATGCTGGAGAGGAGCAGGAGGG + Intergenic
1169789157 20:9391599-9391621 CAAGTTCGAGGGAAGAAGGAAGG - Intronic
1169867236 20:10215266-10215288 CAGTATGGTGAGAAGGAAGAAGG - Intergenic
1169934226 20:10865719-10865741 CAGGTTGAAGAGGAGTAGGAGGG + Intergenic
1170101494 20:12705385-12705407 AAGGAAGGAGAGAAGGAAGAAGG - Intergenic
1170376116 20:15701809-15701831 CTGGTTGGGGAGAAAGAGAAGGG - Intronic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1170757325 20:19215592-19215614 AAGGAAGGAGAGAGGGAGGAAGG - Intronic
1170796637 20:19553026-19553048 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171202663 20:23254627-23254649 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1171778036 20:29389066-29389088 GATGAAGGAGAGAAGGAGGAGGG - Intergenic
1171862464 20:30413165-30413187 CAGGAAGGAGGGAAGGAAGAAGG + Intergenic
1171872063 20:30536452-30536474 TAGGGTGGAGGGAAGGGGGAGGG - Intergenic
1171936919 20:31283527-31283549 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG + Intergenic
1172476080 20:35238790-35238812 CCGGTTGGAGAGATGGAGAGTGG - Intronic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172681959 20:36723265-36723287 CAAGTTGGAGAGAGGTAGGCAGG + Intronic
1172778492 20:37422037-37422059 AAGGGTGGAGAAGAGGAGGAAGG - Intergenic
1172785969 20:37469240-37469262 CAGGAAGGAGAGAGGCAGGAAGG - Intergenic
1172800871 20:37575173-37575195 TAAGATGGAGAGAGGGAGGAGGG + Intergenic
1172939109 20:38642617-38642639 GAGGTGGGAGGGAAGGAGGGAGG - Intronic
1172966542 20:38839484-38839506 GAGGAAGGAGAGAGGGAGGAAGG - Intronic
1172984993 20:38978441-38978463 TAGGTGGGAGAGAAGGCGGATGG + Intronic
1173001823 20:39110449-39110471 GAGGTGGGAGAGAAGGAAGAGGG - Intergenic
1173048760 20:39538503-39538525 CAGGTGCAAGAGAAAGAGGAAGG - Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173300054 20:41794478-41794500 AAGGTTGGGGAGAAGGAAGGAGG - Intergenic
1173338213 20:42130453-42130475 GAGATTGGAGAGAAGGAGAAAGG - Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1173761986 20:45570034-45570056 GAGGTTGGAGGGTAGGAGGAAGG + Intronic
1173878263 20:46390544-46390566 CAGCTTGCAGAAAAGGAGGCAGG - Intronic
1174079492 20:47960874-47960896 CAGGTTGCAGGGATGCAGGAAGG - Intergenic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174763503 20:53229768-53229790 AAGGAGGGAGAGAGGGAGGAGGG + Intronic
1174948995 20:55022975-55022997 GAGGGTGGAGAGTCGGAGGAGGG - Intergenic
1175059626 20:56230355-56230377 GAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1175273984 20:57754876-57754898 AAGGAAGGAGAGAAGGAAGAGGG - Intergenic
1175282348 20:57812454-57812476 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1175293685 20:57894701-57894723 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1175432445 20:58915599-58915621 GAGGAAGGAGAGAAGGAGGGAGG - Intergenic
1175541431 20:59750532-59750554 TGGGTTGGAGGAAAGGAGGAAGG + Intronic
1175637349 20:60596879-60596901 CAGCTAGGAGAGCACGAGGAAGG - Intergenic
1175766071 20:61594007-61594029 GAGGTGGGAGAGAGGGAGGAGGG + Intronic
1175935021 20:62510341-62510363 AGGGTTGGAGAGGTGGAGGATGG - Intergenic
1175947767 20:62566658-62566680 CAGGTAGGAGGGAAGGTTGAGGG - Intronic
1176068764 20:63215527-63215549 CGGGCTGGAGTGGAGGAGGACGG - Intronic
1176808825 21:13516768-13516790 AAGGGTGGCGAGTAGGAGGAAGG + Intergenic
1176808943 21:13517377-13517399 GAGGGTGGCGAGAGGGAGGAGGG + Intergenic
1176998227 21:15580685-15580707 CAGGTTGCATAGAAAGAGAAAGG + Intergenic
1177506845 21:22030333-22030355 GAGGTTGTAGAGAAATAGGAAGG + Intergenic
1177567496 21:22843894-22843916 CAGGTTCCAGAGATGAAGGAGGG + Intergenic
1177904508 21:26959123-26959145 CAAGTTGGAGACAGGGAGCAGGG + Intronic
1178163945 21:29950273-29950295 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1178416136 21:32406648-32406670 GAGGGTGGAGAGAGGGAGTAGGG + Intergenic
1179009215 21:37541644-37541666 AAGGTTGAAGAGAAATAGGAAGG - Intergenic
1179052609 21:37901010-37901032 CAGGAAGGAGAGAAGGAAGGGGG - Intronic
1179136099 21:38681353-38681375 CAGGATCGAGAGAAGGGGGGAGG - Intergenic
1179141139 21:38726530-38726552 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1179292328 21:40029564-40029586 GAGGGTGGAGAGTAGGAGGCGGG + Intronic
1179524465 21:41966823-41966845 GAGGTTAGAGAAAAGGAGGCTGG - Intergenic
1179623687 21:42635031-42635053 ATGGATGGAGAGAAGGATGATGG - Intergenic
1179623701 21:42635141-42635163 ATGGATGGAGAGAAGGATGATGG - Intergenic
1179623755 21:42635581-42635603 ATGGATGGAGAGAAGGATGATGG - Intergenic
1179711995 21:43268810-43268832 CGGGTTGGGGAGAGGGAAGACGG + Intergenic
1179884984 21:44309996-44310018 CTGGTTGGGGAGAAGGCGGAGGG + Intronic
1180023330 21:45143244-45143266 GAGTTTGGAGAGCAGGGGGAAGG - Intronic
1180059101 21:45375533-45375555 CAGGCTGGGGGGATGGAGGAGGG + Intergenic
1180655652 22:17418753-17418775 TCTGTTGGAGAGAGGGAGGACGG + Intronic
1180713472 22:17855890-17855912 CAGGCTGCAGAGAATGATGAAGG + Intronic
1180923818 22:19538274-19538296 GAGGGGGGAGGGAAGGAGGAAGG + Intergenic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182294237 22:29303736-29303758 CTCATGGGAGAGAAGGAGGAAGG + Intergenic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1182516560 22:30862255-30862277 CAGGTTGGAGGGCAGCAGCAGGG + Intronic
1182904398 22:33922388-33922410 GAGGCTGGAGGGAAGGGGGATGG - Intronic
1183151929 22:36044526-36044548 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1183248546 22:36712032-36712054 CAGGATGGGGAGAGGGCGGAGGG + Intergenic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1183539667 22:38422857-38422879 CAGGATGGAGAGAATGAAGAGGG - Intergenic
1183698796 22:39438158-39438180 AGGGATGGAGGGAAGGAGGAAGG - Intergenic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1183843423 22:40519519-40519541 CAGTTTGGACACAAGGAGGTTGG - Intronic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184318084 22:43714331-43714353 AAGGAAGGATAGAAGGAGGAAGG + Intronic
1184334838 22:43847076-43847098 CAGGCTGGAGAGAAGGGCCACGG - Intronic
1184413429 22:44338617-44338639 CAGTTGGGAGAGCAGGAGCAGGG - Intergenic
1184451630 22:44586064-44586086 CAGGATGGAGGGAGGGAGAATGG - Intergenic
1184609502 22:45593786-45593808 AAGGAAGGAGAGAAGGAAGAAGG - Intronic
1184676355 22:46045335-46045357 TTGGCTGGAGGGAAGGAGGAGGG + Intergenic
1184822619 22:46921230-46921252 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
1184899019 22:47432678-47432700 AAGGAAGGAGAGGAGGAGGAGGG + Intergenic
1184967961 22:47995377-47995399 AGGGTTGGAGAGAGGGAGGGAGG + Intergenic
1184984064 22:48117450-48117472 AAGGAAGGAGAGAAGAAGGAAGG + Intergenic
1185001909 22:48251350-48251372 AAGGAAGGAGAGAGGGAGGAAGG - Intergenic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949401102 3:3665959-3665981 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
949432427 3:3991880-3991902 AAGGAGGGAGAGAAGGAGGGAGG + Intronic
949759106 3:7448514-7448536 CAGTTGGGAGAGGAGGAGTAGGG + Intronic
950037779 3:9899533-9899555 CAGCAGGGAGGGAAGGAGGAAGG - Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950606898 3:14089751-14089773 GACGTGGAAGAGAAGGAGGATGG + Intergenic
950728950 3:14939418-14939440 CAGGATGGAGGGAGGTAGGAGGG + Intergenic
950896329 3:16454978-16455000 CATGGTGGAGAGGAGGAGGCTGG - Intronic
950947693 3:16966914-16966936 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
951760975 3:26147178-26147200 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
952486109 3:33811557-33811579 CAGGTCGGAAAGAATGAGAAAGG + Intronic
952560500 3:34587249-34587271 GAGGGTGGAGAGTAGAAGGAGGG - Intergenic
952721863 3:36541981-36542003 TATGTTAGAGAGAGGGAGGAAGG + Intronic
952819185 3:37471247-37471269 CTTGTTGGAGAGAAGGAGGGAGG - Intronic
953104017 3:39857240-39857262 CAGGAGGGAGGGAGGGAGGAAGG + Intronic
953312001 3:41889535-41889557 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
953367186 3:42354835-42354857 GAGGTGGGAGAGAAGGAGGAGGG - Intergenic
953382149 3:42480122-42480144 CAGGTTTGAGTGTAGGAGCATGG + Intergenic
953664751 3:44917730-44917752 CAACATGGAGAGAAGAAGGAGGG + Intronic
953721759 3:45362245-45362267 CAGCCTGGAGATAAAGAGGAGGG - Intergenic
953745214 3:45568782-45568804 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
953770086 3:45772881-45772903 CAGGTTGAAGGGAGGGTGGAAGG - Intronic
953984416 3:47430470-47430492 CAGGTAGGAGAGGAGCAGGAGGG + Intronic
954421382 3:50420823-50420845 CAGGCTGGGGGCAAGGAGGAAGG - Intronic
954503482 3:51044429-51044451 GAGGATGGAGGGTAGGAGGAGGG + Intronic
954553563 3:51501653-51501675 CACATTTAAGAGAAGGAGGATGG - Intergenic
954748480 3:52800458-52800480 CAGGCTGGAGCGGAGGAGGCCGG - Intronic
955033121 3:55240210-55240232 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
955059027 3:55481311-55481333 CAGGTTGGGGAGAGGACGGAGGG - Intronic
955257997 3:57354343-57354365 AAAGGTGGAGAGTAGGAGGACGG + Intronic
955285377 3:57635877-57635899 TAGGTTGAAGAGGAAGAGGAGGG - Intronic
955488492 3:59459112-59459134 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955758272 3:62249396-62249418 CAGGGTGGAGGGAAGGGGGTGGG + Intronic
955833578 3:63029787-63029809 AAGGAAGGAGAGTAGGAGGAGGG - Intergenic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
955874603 3:63476242-63476264 AAGGAGGGAGAGAAGAAGGAAGG + Intronic
955874646 3:63476375-63476397 AAGGAGGGAGAGAAGAAGGAAGG + Intronic
955901844 3:63764345-63764367 AAGGAAGGAGAGAGGGAGGAAGG + Intergenic
956053906 3:65278272-65278294 CAGGAGGGTGAGAAGTAGGAAGG - Intergenic
956112596 3:65884733-65884755 GGGGATGGAGAGATGGAGGAAGG - Intronic
956186633 3:66568831-66568853 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
956289661 3:67648182-67648204 CAGGTTGCAGAGAAAGAACATGG + Intronic
956530487 3:70212345-70212367 CAGTTTGGGGAGAAGAATGAGGG - Intergenic
956603266 3:71046106-71046128 AAGGTGGGAGGGAAGGAGGAAGG - Intronic
956624322 3:71251949-71251971 CAGCTTGGGGAGTAGGAGGTGGG - Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956796346 3:72722130-72722152 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
956847927 3:73200979-73201001 CAGGCTGAAGGGAATGAGGAGGG - Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957442799 3:80272485-80272507 CATGTTGGAGTGAAGAGGGAGGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958069497 3:88591889-88591911 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958473914 3:94556243-94556265 GATGTAGGAGGGAAGGAGGAAGG + Intergenic
958822622 3:98993041-98993063 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
959083301 3:101825145-101825167 GAGGGTGGAGGGTAGGAGGAGGG - Exonic
959113161 3:102145754-102145776 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
959268749 3:104177321-104177343 GAGAGTGGAGAGCAGGAGGAGGG - Intergenic
959340487 3:105123538-105123560 AAGGTGGGAGAGAAGGAAGGAGG + Intergenic
959366562 3:105466977-105466999 CAGGTAGAAGAGAAAGAGAAGGG + Intronic
959368771 3:105496438-105496460 AAGGATGGAGGGAAAGAGGAAGG + Intronic
959383992 3:105678530-105678552 GAGGTGGGAGAGATGGAGGGAGG + Exonic
959941838 3:112088165-112088187 CAGGATGGAGTGAAGGTGAAGGG + Intronic
959976224 3:112462837-112462859 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
959991978 3:112640039-112640061 TTGGTTAGAGAGAAGGAGGGAGG + Intronic
960071479 3:113435920-113435942 AAGGATGGAGAGAGAGAGGAAGG - Intronic
960172557 3:114479095-114479117 CAGGATGGGGGGAAGAAGGAAGG + Intronic
960311380 3:116120408-116120430 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
960315749 3:116174609-116174631 CTGGTTGAAGTGAAGGAGAAGGG - Intronic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
960550857 3:118974695-118974717 AAGTTTGGAGAAAAGGAGGAAGG - Intronic
960616330 3:119599355-119599377 CACCTTGGAGAGAAGGTGGGAGG + Intronic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
961216052 3:125161537-125161559 CAGGTTTGAGAGAAAGACCAGGG - Intronic
961340112 3:126212243-126212265 AAGGAAGGAGAGAAGAAGGAGGG + Intergenic
961345295 3:126260141-126260163 GAGGTAGGAGAGGAAGAGGAAGG - Intergenic
961496305 3:127294292-127294314 CAACTGGGAGATAAGGAGGATGG + Intergenic
961740761 3:129031964-129031986 CTGGGTGGAGAGGAAGAGGAGGG + Intronic
961850603 3:129813643-129813665 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
962564989 3:136648759-136648781 AAGATTAGAGAGAAAGAGGAAGG - Intronic
962671890 3:137716707-137716729 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
962681541 3:137805453-137805475 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
962854163 3:139329280-139329302 CAGGAAGGAGAGAGGGTGGAGGG + Intronic
962909437 3:139834692-139834714 CTGGTTTGAGAGAATAAGGAAGG - Intergenic
962968326 3:140374867-140374889 AAGGTTTGAGAGAAGGAAGTTGG + Intronic
963096290 3:141544989-141545011 GAGGGTGGAGAGTAGGAGGAGGG + Intronic
963400967 3:144798437-144798459 GAGGTTGGAGGGTAGGAGGAAGG - Intergenic
963466523 3:145688946-145688968 CAAGTTAGAGAGAATGATGAGGG + Intergenic
963632097 3:147746242-147746264 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
963791574 3:149588197-149588219 CAGGCTGGAGAAAAGATGGAAGG - Intronic
964011850 3:151901114-151901136 GAAATTGGAGAGCAGGAGGAAGG - Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
964903855 3:161693985-161694007 AAGGAAGGAGGGAAGGAGGAAGG - Intergenic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
965171795 3:165275062-165275084 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
965182389 3:165420796-165420818 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
965312350 3:167145821-167145843 GAGGTTGGAGGGTGGGAGGATGG - Intergenic
965355411 3:167667245-167667267 AAGGAGGGAGAGAAGGAGGGAGG + Intergenic
965888378 3:173477915-173477937 CAGGTTGTGGAGAAATAGGAAGG + Intronic
966208854 3:177432533-177432555 CAAGTTGGGGAGAAGGTTGATGG - Intergenic
966830763 3:184006420-184006442 TAGGAAGGAGAGCAGGAGGAAGG - Intronic
966855679 3:184192598-184192620 AAGGTTGGAGAGAATGGGGCTGG + Exonic
967350699 3:188511106-188511128 CAGGTAGGAAGGAAGGAGGAAGG - Intronic
967359444 3:188612888-188612910 CAGGATGGGGAAAAGGAGAAAGG + Intronic
967433637 3:189418991-189419013 CAGGTGGGAGAGAAGCTGAAGGG - Intergenic
967556943 3:190871005-190871027 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
967582273 3:191173110-191173132 CAGGGTGGAAGGTAGGAGGAGGG - Intergenic
967726926 3:192870718-192870740 AAGGAAGGAGAGAAGAAGGAAGG + Intronic
967744999 3:193045389-193045411 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
968073277 3:195801507-195801529 CAGGCAGGAGAGAAGGAGAAAGG - Intronic
968250874 3:197212086-197212108 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
968359970 3:198139842-198139864 GAGGAGGGAGAGGAGGAGGAGGG + Intergenic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
969205909 4:5645402-5645424 GAGGGTGGAGAGTGGGAGGAAGG - Intronic
969220600 4:5756152-5756174 CAGGTTAGAAAGAAGGATGTTGG - Intronic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969507056 4:7594602-7594624 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
969551269 4:7869211-7869233 ATGGATGGAGGGAAGGAGGAAGG + Intronic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969855564 4:9996473-9996495 CAGGATGGAGGGTGGGAGGAGGG + Intronic
969991512 4:11268789-11268811 CAGGATGGAAAGAAGGGGTAGGG - Intergenic
970010426 4:11452899-11452921 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
970125081 4:12800014-12800036 GAGGTTGGAGGGTGGGAGGAGGG + Intergenic
970209920 4:13698516-13698538 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970410591 4:15803794-15803816 GAGGAGGGAGGGAAGGAGGAAGG - Intronic
970434852 4:16023471-16023493 CAGTGTGGAGAGAATGAGGGAGG - Intronic
970726031 4:19045819-19045841 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
971035875 4:22692428-22692450 AAGGTGGAAGAGAAGGAGGGAGG + Intergenic
971056490 4:22919222-22919244 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
971394347 4:26214675-26214697 GAGGGAGGAGAGAGGGAGGAAGG + Intronic
971421937 4:26481708-26481730 GAGGTGGGGGAGGAGGAGGAAGG - Exonic
971580653 4:28335120-28335142 CAGGTGAGAGAGAAGGCCGAAGG - Intergenic
971703200 4:30007259-30007281 CAGGGAGGAGAGTGGGAGGAGGG + Intergenic
971843169 4:31881027-31881049 AAGGAGGGAGGGAAGGAGGAGGG - Intergenic
971865169 4:32160513-32160535 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
972068188 4:34979463-34979485 GAAGTGGGAGAGAGGGAGGAAGG + Intergenic
972111971 4:35573887-35573909 TAGGTTGGAGGGTGGGAGGAGGG - Intergenic
972473598 4:39430541-39430563 CAGGTTGGAGACAAGGAAAGAGG + Intronic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
972579839 4:40385486-40385508 AAGGAGGGAGAGAAGGAAGAAGG + Intergenic
972822101 4:42713512-42713534 GAGATTGGAGAGGTGGAGGAAGG - Intergenic
972910415 4:43809499-43809521 CAAGTTGGTGAGGAGGTGGAGGG - Intergenic
973091029 4:46136802-46136824 AAGGTTGGAGGGTGGGAGGAGGG + Intergenic
973184977 4:47315885-47315907 GAAGGTGGAGGGAAGGAGGAAGG + Intronic
973563341 4:52159078-52159100 AAGGAGGGAGAGAAGAAGGAAGG - Intergenic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
973895650 4:55410071-55410093 CTGGTGGGAGGCAAGGAGGAGGG - Intronic
974093675 4:57339024-57339046 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
974738720 4:65976695-65976717 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
975116796 4:70688879-70688901 CAGAGTGGAGACGAGGAGGATGG + Exonic
975277934 4:72524245-72524267 CAGGTAGGAGAAAGGTAGGAAGG + Intronic
975362350 4:73485675-73485697 GAGGTGGAAGAGAAGGAGGGGGG + Intronic
975803663 4:78089901-78089923 AAGGATGGAGGGTAGGAGGAGGG - Intronic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
975969415 4:80015784-80015806 AAGGTGGGAGAGAAGAAAGAAGG + Intronic
976108449 4:81644524-81644546 CATGTAGGAAAAAAGGAGGAAGG - Intronic
976116216 4:81730395-81730417 GAGGTTGTAGAGAAAAAGGAAGG + Intronic
976126384 4:81837750-81837772 CAGGGTGGAGGGAATGGGGAAGG - Intronic
976132299 4:81897551-81897573 AAGGGGGGAGAGGAGGAGGAAGG - Intronic
976143059 4:82013114-82013136 CAGGTGGGAGAGAAGCCAGATGG + Intronic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976193569 4:82512176-82512198 CAAGTGGGAGAGAAGTAGGGTGG - Intronic
976509221 4:85888766-85888788 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
976567206 4:86564680-86564702 AAGGTGGTAGAAAAGGAGGAAGG - Intronic
976825318 4:89254375-89254397 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
977738470 4:100446732-100446754 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
978025079 4:103863606-103863628 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
978320636 4:107490808-107490830 GAGGCTGGAGGGTAGGAGGAAGG + Intergenic
978693795 4:111550447-111550469 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
978830706 4:113080870-113080892 CAGAATGGAGAGGAAGAGGATGG + Intronic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
979007069 4:115312811-115312833 AAGGTTGCAGAGAAAGAGGAAGG + Intergenic
979154609 4:117368480-117368502 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
979174444 4:117645604-117645626 TAGTGTTGAGAGAAGGAGGAAGG - Intergenic
979208476 4:118071403-118071425 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
979223925 4:118263901-118263923 CAGCTTGGTGTCAAGGAGGAAGG - Intergenic
979466475 4:121044919-121044941 CAGGTTGGAGTGCAGTAGCACGG - Intronic
979511751 4:121562184-121562206 AAGGGTGGAGGGTAGGAGGAGGG - Intergenic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
981027958 4:140095387-140095409 CAAGTGGGAGAGAAAGATGAAGG - Intronic
981241712 4:142484753-142484775 AAGGGTGGAGAGTAGGAGGAGGG - Intronic
981347519 4:143693996-143694018 GAGGGTGGAGGGTAGGAGGAAGG + Intronic
981396452 4:144255571-144255593 AAGGATGGAGAGGAGAAGGATGG - Intergenic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981721297 4:147804145-147804167 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
982086002 4:151836753-151836775 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
982154994 4:152510518-152510540 AAGGGAGGAGAGAAAGAGGAGGG + Intronic
982183631 4:152774079-152774101 CAGGAGGGAGAGAGGAAGGAAGG - Intronic
982851737 4:160326019-160326041 GAGGTTGGAGAGTGGGAGGAGGG - Intergenic
982912849 4:161166318-161166340 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
983043583 4:162958820-162958842 CAGGTTGCAGAGCAGCAGTAGGG + Intergenic
983145385 4:164207818-164207840 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
983155643 4:164344223-164344245 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983447152 4:167867594-167867616 AAGGTTGGAGGGACGGAGGAAGG + Intergenic
983522074 4:168719721-168719743 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
983552558 4:169032417-169032439 AAGAAGGGAGAGAAGGAGGAAGG - Intergenic
983745865 4:171199430-171199452 GAGGGTGGAGAGAGGGAGAAGGG - Intergenic
983753218 4:171302132-171302154 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
983764662 4:171463697-171463719 CAGGGTGGAGGGTAGGGGGAGGG + Intergenic
983858666 4:172677360-172677382 CAGCTTCGAGAGAAGTAGCAGGG - Intronic
984009881 4:174357953-174357975 CAATTTGGAGAGAAAAAGGAAGG - Intergenic
984288203 4:177760933-177760955 CAAGTAGGAGAGAAGAAGCAGGG + Intronic
984381956 4:179005707-179005729 AAGGTGGGAGAGAAAGAAGAAGG + Intergenic
984488828 4:180406439-180406461 ATGGTCAGAGAGAAGGAGGAAGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984712231 4:182895506-182895528 CAGGTTCGAGAGAGGGAGGAAGG - Intronic
984716106 4:182926729-182926751 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
984803312 4:183733845-183733867 AAGGAAGGAGGGAAGGAGGAAGG - Intergenic
985092399 4:186377810-186377832 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985245439 4:187975795-187975817 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
985285753 4:188335131-188335153 CAGCCTGGAGAGCAGGAGGGAGG + Intergenic
985399444 4:189579974-189579996 CAGGTTGGAGAGCAGGCCCAGGG - Intergenic
985446529 4:190023825-190023847 AGGGAGGGAGAGAAGGAGGAGGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985631031 5:1014169-1014191 CAAGTAGGAAGGAAGGAGGACGG - Intronic
985639080 5:1054807-1054829 CAGGCTGGAGAGAAGATAGAAGG - Intronic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
985873940 5:2581098-2581120 CAGGAGGGAGGGAGGGAGGAAGG - Intergenic
986011288 5:3718070-3718092 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
986264520 5:6180899-6180921 CAAGATGGAGGGAAAGAGGAGGG - Intergenic
986313342 5:6571040-6571062 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986313369 5:6571118-6571140 GAGGAAGGAGAGAAGGAGGGAGG + Intergenic
986313406 5:6571223-6571245 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986313430 5:6571293-6571315 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986313440 5:6571324-6571346 GAGGAAGGAGAGAAGGAGGGAGG + Intergenic
986313451 5:6571359-6571381 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986313461 5:6571390-6571412 GAGGAAGGAGAGAAGGAGGGAGG + Intergenic
986313511 5:6571530-6571552 GAGGGAGGAGAGAAGGAGGGAGG + Intergenic
986316016 5:6586804-6586826 CAGTTTGGAAGGAAGGAGGTGGG - Intergenic
986421552 5:7589536-7589558 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
986481836 5:8197282-8197304 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
986520926 5:8617290-8617312 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
986673527 5:10164184-10164206 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
986683993 5:10259848-10259870 CAGGTTGCTGAGAATGAGAAGGG + Intronic
986879040 5:12147657-12147679 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
986879048 5:12147681-12147703 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
986936884 5:12900128-12900150 GAGGATGGAGAGAGGGAGGGAGG + Intergenic
987485715 5:18523128-18523150 CAGATTGGAAGGCAGGAGGAGGG - Intergenic
987549014 5:19353820-19353842 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
987722774 5:21659743-21659765 GAAGGTGGAGAGTAGGAGGAGGG + Intergenic
987842943 5:23244507-23244529 CATGTGGCAGAGCAGGAGGAAGG + Intergenic
988162573 5:27539975-27539997 GAGGTTGGAGAGTAAGGGGAGGG + Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988340852 5:29969156-29969178 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
988553137 5:32215053-32215075 CAGATTGGAGAGAAACAGGAAGG + Intergenic
988848449 5:35154501-35154523 GAGGTTGCAGAGAAAAAGGAAGG + Intronic
988893354 5:35644683-35644705 CAGGATGGAGAAAAGGAGCAGGG - Intronic
988914249 5:35876354-35876376 CAGATTGGAGAGAAAATGGAGGG - Exonic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989289799 5:39750016-39750038 GAGGTTGGAGGGTGGGAGGATGG - Intergenic
989467315 5:41772205-41772227 TTGGTTGGGGAGAAGGGGGAGGG + Intronic
989967219 5:50478598-50478620 CAGGTTTTATAGAAGGGGGAAGG + Intergenic
990316173 5:54585245-54585267 CAGGCTGGAGTGCAGGAGCATGG - Intergenic
990322334 5:54642144-54642166 AAGGTCTGAGAGAAGGAGGCTGG + Intergenic
990468053 5:56087922-56087944 CGAGTTGGAGAGGAGGTGGATGG + Intergenic
990638520 5:57756676-57756698 AAGGTTGGAGGGGTGGAGGAAGG + Intergenic
990773939 5:59284163-59284185 CAGATTGCAGAGCAGCAGGATGG - Intronic
990826870 5:59909979-59910001 CACGTTGCAGAGAAGTACGATGG - Intronic
990871352 5:60433920-60433942 GAGGGTGGAGGGTAGGAGGAAGG + Intronic
990873537 5:60459859-60459881 GAGGAAGGAGAGAAGGATGAAGG - Intronic
991092899 5:62710085-62710107 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
991958909 5:72022096-72022118 GAGGGTGGAGAGTGGGAGGATGG - Intergenic
991989604 5:72324515-72324537 CAGGTTGGAGAAATGGAGGAGGG - Intronic
992073532 5:73170576-73170598 CTGATTGGAGGGCAGGAGGAGGG + Intergenic
992552588 5:77873361-77873383 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
992757277 5:79919726-79919748 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
992765533 5:79995595-79995617 GATGCTGGAGAGAAGAAGGATGG + Intronic
993252062 5:85540177-85540199 GAGGTGGGAGTGCAGGAGGAAGG + Intergenic
993325986 5:86537177-86537199 GAGGGTGGAGAGTGGGAGGATGG + Intergenic
993374541 5:87134871-87134893 GAGGTTGGAGGGTGGGAGGAGGG + Intergenic
993622386 5:90184016-90184038 CATGAAGGAAAGAAGGAGGAAGG + Intergenic
993714903 5:91266224-91266246 GAGGTTGGAGGGAGGTAGGAGGG + Intergenic
993910985 5:93683736-93683758 TAGGTAGGAGAGAAGGCGGACGG + Intronic
994030471 5:95136158-95136180 AAGGTTGAAGAGAGGGAGAAGGG - Intronic
994037765 5:95222211-95222233 CAGTGTGGAGAGAAGAAGGCAGG - Intronic
994126988 5:96179138-96179160 CAGATTGGAGAGACCAAGGATGG - Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
995124843 5:108569812-108569834 CAGCTAGGAGAGAATGAGTAAGG + Intergenic
995324531 5:110875370-110875392 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
995516576 5:112960157-112960179 GAGGTTGGAGTGAGGGTGGAGGG + Intergenic
995609196 5:113890928-113890950 CAGGGTGTAGAGAAGGATCAAGG - Intergenic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
995928679 5:117408256-117408278 CAGGGTGGAGAGTGGAAGGAGGG - Intergenic
995931415 5:117450800-117450822 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
996165739 5:120220719-120220741 GAGGTGGGGGAGAAGGAGGTGGG - Intergenic
996953807 5:129159719-129159741 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
997181735 5:131836041-131836063 AAGGGTGGAGAGTGGGAGGAGGG - Intronic
997368723 5:133342321-133342343 CAGGTTGCAGAGAAGGGGCAGGG + Intronic
998146667 5:139733196-139733218 CAGGTCCGAGGCAAGGAGGACGG + Intergenic
998387421 5:141765769-141765791 GAGATTGGAGAGCAGGAGGATGG - Intergenic
998458030 5:142288851-142288873 AAGGTTGTGGAGAAGGAGGGAGG - Intergenic
998532740 5:142900592-142900614 AAGGTGGGAGAGTAGGGGGAGGG + Intronic
998619624 5:143779908-143779930 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
998647792 5:144082676-144082698 GAAGTTGGAGAGTGGGAGGAGGG + Intergenic
999071105 5:148744988-148745010 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
999132550 5:149295600-149295622 GAGAATGGAGAGAAAGAGGAAGG + Intronic
999409727 5:151340210-151340232 GAGGAGGGAGAGGAGGAGGAAGG + Intronic
999536558 5:152523737-152523759 CCGGTTGGAGAGGAGCAGGAGGG + Intergenic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999593671 5:153177858-153177880 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1000021519 5:157322911-157322933 TAGATAGGAGAGAAGGAAGAGGG - Intronic
1000137549 5:158367513-158367535 AAGGTTGGAGAGAAGGTGACTGG - Intergenic
1000147573 5:158468296-158468318 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1000406238 5:160891366-160891388 AAGGTCAGAGAGAATGAGGAAGG - Intergenic
1000614683 5:163413933-163413955 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000974612 5:167751106-167751128 CAGGGTGGAGAGAGGAAGCAGGG + Intronic
1001208611 5:169788983-169789005 GAGGGTGGAGAGTAGAAGGAGGG - Intronic
1001320458 5:170676227-170676249 CAGGTGGGAGGGAGGGAGGAAGG + Intronic
1001392123 5:171387908-171387930 TAGGTAGGAGAGAAGGCGGACGG - Exonic
1001547866 5:172581631-172581653 GAGGCTGGAGGGAAGGAGGGAGG - Intergenic
1001632671 5:173187553-173187575 GGGGTTGGAGGGAAGGATGAGGG + Intergenic
1001664941 5:173424759-173424781 CAGGCTGGTGAGAAGGAAGATGG - Intergenic
1001708922 5:173762382-173762404 AAGGTTGGAGAGAAGTGGGTAGG + Intergenic
1001740066 5:174045784-174045806 CAATTTGAAGAGGAGGAGGACGG - Exonic
1001776094 5:174330147-174330169 CTGGTGGGAGATTAGGAGGATGG + Intergenic
1002079459 5:176728739-176728761 CGGGATGGAGAGAAGAAGGCAGG + Intergenic
1002320950 5:178375583-178375605 AAGGTGGGAGAGAAGTAAGACGG - Intronic
1002930561 6:1631664-1631686 TGGATTGGGGAGAAGGAGGAAGG - Intronic
1003179921 6:3782631-3782653 TGGGTTGGAGAGAAGGAGCAGGG + Intergenic
1003476711 6:6490369-6490391 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1003941777 6:11035434-11035456 AAGGATGGATAGAAGGAGCATGG - Intronic
1004576142 6:16897064-16897086 AAGCTTGGAGAGGAGAAGGAGGG + Intergenic
1004586819 6:17010711-17010733 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1004945669 6:20609921-20609943 GAGGATGGAGGGCAGGAGGAGGG - Intronic
1005072211 6:21872203-21872225 CAGGAGGGAGAGAAGGCAGAGGG + Intergenic
1005083457 6:21980603-21980625 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083557 6:21981131-21981153 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005851073 6:29822852-29822874 AAGGTTGCAGAGAAATAGGAAGG + Intergenic
1006012461 6:31054257-31054279 AAAGTTTGAGAGAAGGAGGGAGG + Intergenic
1006096991 6:31662322-31662344 GAGGGAGGAGAGAAGGAGGGAGG - Exonic
1006511692 6:34525149-34525171 CGGGTGGGTGAGAGGGAGGACGG - Intronic
1006731572 6:36240018-36240040 AAGGTTGGAGATAAGAAGGCAGG + Intergenic
1006822314 6:36907073-36907095 GAAGTTGGGGAGAGGGAGGAAGG - Intronic
1006827743 6:36948626-36948648 GAGGAAGGAGGGAAGGAGGAAGG - Intronic
1006832919 6:36979648-36979670 CTGGAAGGAGAGGAGGAGGAGGG + Intronic
1007275841 6:40673050-40673072 AGGGATGGAGAGAAGGAGAAAGG - Intergenic
1007339434 6:41181153-41181175 GAGGATGGAGAGAAGAAGGGTGG - Intergenic
1007373500 6:41441960-41441982 CAGGAAGGAGGGAAGGAGGGGGG + Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007411697 6:41666865-41666887 TAGGTGGGAGAGAAGGCAGATGG - Intergenic
1007638472 6:43316046-43316068 CAGATTGGAGTGGAGGAGGTAGG - Intronic
1007797710 6:44363726-44363748 AAGGATGGAGAGAGGGAGGGAGG - Intronic
1007981720 6:46166208-46166230 GAGGAGGGAGGGAAGGAGGAAGG - Intronic
1008083962 6:47224169-47224191 GAGGTTGGAGGGTGGGAGGAGGG + Intergenic
1008373438 6:50763410-50763432 AAAGTTGGAGGGGAGGAGGAAGG - Intronic
1008453150 6:51676038-51676060 CTGGTGGCAGAGGAGGAGGAAGG + Intronic
1008475212 6:51928858-51928880 CAGGATGGAGAGAAAGACAATGG - Intronic
1008492525 6:52101279-52101301 CAGGTTTGGAAGACGGAGGAGGG - Intergenic
1008673971 6:53799850-53799872 CAAAATGGAGAGAAGAAGGAAGG - Intronic
1008759413 6:54835572-54835594 CAGGTTGGAGGTAGGAAGGATGG + Intergenic
1008930361 6:56932516-56932538 AGGGTGGGAGAGAAGGAGGAGGG + Intronic
1009330111 6:62408703-62408725 GAGGATGGAGGGGAGGAGGAGGG + Intergenic
1009419717 6:63451597-63451619 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1009538426 6:64922153-64922175 GAGGTGGGAGAGAGGGAGAATGG - Intronic
1009747792 6:67841501-67841523 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1009892639 6:69706179-69706201 TAGGTGGGAGAGAAGGCAGATGG + Intronic
1009990027 6:70831409-70831431 CAGGTTGGAGGGTGGAAGGAGGG - Intronic
1010168166 6:72941523-72941545 AAGGAAGGAGGGAAGGAGGAAGG - Intronic
1010196881 6:73248435-73248457 CAGGAGGGAGAGAGGAAGGAGGG - Intronic
1010256772 6:73767198-73767220 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1010295287 6:74188895-74188917 GAGGTTGGAAGGTAGGAGGAAGG - Intergenic
1010330131 6:74613965-74613987 GAAGGTGGAGAGAAGAAGGAGGG - Intergenic
1010330356 6:74616456-74616478 AAGGATGGAGAGTGGGAGGATGG - Intergenic
1010531340 6:76971217-76971239 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1010704410 6:79090177-79090199 AAGGAAGGAGGGAAGGAGGAAGG - Intergenic
1011057288 6:83218726-83218748 TACGTTGGAGAAAAGAAGGAAGG - Intronic
1011062379 6:83285512-83285534 CATGCTGTAGAGAAGGAAGAAGG + Intronic
1011314140 6:86012656-86012678 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1011787617 6:90864511-90864533 TAGGGTGCAGAGAAGGTGGATGG + Intergenic
1011922825 6:92602522-92602544 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1012130520 6:95485529-95485551 CAGGTTGGAGTGCAGCAGCATGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1012529247 6:100214404-100214426 GAGGGGGGAGAGTAGGAGGAGGG + Intergenic
1012583151 6:100892770-100892792 CAGCTGGGAGAGAAGGCGGGTGG - Intergenic
1012697673 6:102408632-102408654 AAGGAAGGAGAGAGGGAGGAGGG - Intergenic
1012850147 6:104436914-104436936 GAGGGTGGAGAGTGGGAGGAAGG + Intergenic
1012883698 6:104820701-104820723 AAGGTTGCAGAGAAAAAGGAAGG + Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013425868 6:110012127-110012149 GAGGTGGGAGAGAGGGAGCAAGG - Intergenic
1013435282 6:110098842-110098864 CAGGTTTGAGAGAGGGAGGTAGG + Intergenic
1013881059 6:114901462-114901484 AAGGTTGGAGAGTGGGAGGAGGG - Intergenic
1014029616 6:116685427-116685449 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1014327008 6:120010184-120010206 GAGATAGGAGAGAAGGAGGCAGG + Intergenic
1015098209 6:129442670-129442692 GAGGGTGGAGAGCAGGAGGAGGG - Intronic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015552719 6:134428792-134428814 CAGGTTGTGGAGAAGGAGACTGG + Intergenic
1015632998 6:135249647-135249669 CACGATGGAGATAAGAAGGAAGG - Intergenic
1016003555 6:139066911-139066933 GAAAATGGAGAGAAGGAGGAAGG - Intergenic
1016389498 6:143560927-143560949 TAGGTAGGAGAGTTGGAGGAGGG + Intronic
1016616878 6:146060391-146060413 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1016622290 6:146125693-146125715 CAGAATGGAGAAAAGGAGGGGGG - Intronic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017122395 6:151037003-151037025 CAGGTTGGTGAGATAGAGAAAGG - Exonic
1017137515 6:151161374-151161396 CACTTTGGAGAGAAGGAACAGGG - Intergenic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017634874 6:156434025-156434047 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1017674839 6:156802086-156802108 TGGGTAGGAGAGAAGGAGAAAGG - Intronic
1017788340 6:157774426-157774448 GAGGTTGAAGATAAGGAGGGGGG + Intronic
1017819053 6:158036622-158036644 GAGGATGGAGGGTAGGAGGAGGG + Intronic
1017869843 6:158478091-158478113 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1018238888 6:161753420-161753442 CAGGTTGGAAAGAGAGAAGAAGG + Intronic
1018597305 6:165495371-165495393 CAGGAAGGAGAAAAAGAGGAAGG + Intronic
1018718544 6:166554647-166554669 CAGGCTGCAGTGGAGGAGGATGG - Intronic
1018732620 6:166663722-166663744 GAAGTTGGGGAGGAGGAGGAGGG + Intronic
1018833112 6:167461252-167461274 CAGGTTGGTGTGAAGGAGAGAGG + Intergenic
1019327608 7:446008-446030 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1019778375 7:2925684-2925706 CAGGATGGGGAGAAGTAGGGAGG - Intronic
1019817174 7:3209883-3209905 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1020029133 7:4920674-4920696 GAGGGAGGAGAGAGGGAGGAGGG - Intronic
1020059859 7:5144037-5144059 CAGGTTGGAGAGGAAGAAGGGGG + Intergenic
1020080090 7:5282410-5282432 AAGGGAGGAGAGCAGGAGGAGGG + Intronic
1020116379 7:5478631-5478653 GGGGTTGGAGGGAGGGAGGAGGG - Intronic
1020273802 7:6613057-6613079 CAGGTCAGAGAGGAGAAGGAGGG + Intergenic
1020731139 7:11882442-11882464 AAGGATGGAGAGAAGGAGAAGGG - Intergenic
1020986333 7:15139505-15139527 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1021121196 7:16797560-16797582 TGGGGAGGAGAGAAGGAGGATGG + Intronic
1021146345 7:17093805-17093827 CAGCTTGGGGAGAAGGGGTAGGG - Intergenic
1021336518 7:19409451-19409473 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1021407483 7:20289105-20289127 AAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1021432496 7:20576457-20576479 CAGGTTGAAAAAATGGAGGAAGG - Intergenic
1021492973 7:21239939-21239961 CAGGTTAGTGAGAGGGAGGTTGG - Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1021825164 7:24543567-24543589 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1022014918 7:26341335-26341357 AAGGTAAGAGAGAAGGAGAATGG + Intronic
1022043001 7:26598112-26598134 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022216061 7:28262787-28262809 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1022431424 7:30326278-30326300 GAGGGTGGAGAGTAGGAGGAAGG - Intronic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1022466102 7:30654049-30654071 CAGGAGGTAGAGAAGGTGGAGGG - Intronic
1022590360 7:31655416-31655438 CAGTTTGGAGAGAAGGTGGCTGG - Intronic
1022756678 7:33300229-33300251 GAGACTGGAGAGAGGGAGGAAGG - Intronic
1022764423 7:33394400-33394422 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1022814040 7:33896889-33896911 GAGGTTGGAGGGTGGGAGGAGGG + Intergenic
1023044634 7:36200123-36200145 GAGGATGGAGAGTGGGAGGAGGG - Intronic
1023111665 7:36818918-36818940 CAGGTGGGAGAGAAGGCAGACGG - Intergenic
1023217720 7:37882524-37882546 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1023260413 7:38353089-38353111 AAGGACGGAGGGAAGGAGGAAGG + Intergenic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1023565705 7:41522006-41522028 AGGGAGGGAGAGAAGGAGGAAGG + Intergenic
1023619502 7:42055467-42055489 CAGCTAGCAGAGAGGGAGGAGGG - Intronic
1023785265 7:43701248-43701270 GAGGATGGAGAGTGGGAGGAGGG - Intronic
1023838267 7:44080927-44080949 GAGTTGGGAGAGAAGGAGGAGGG + Intronic
1023939809 7:44762131-44762153 CAGGGTGGAGAGCAGGACGTGGG + Intronic
1024058702 7:45682650-45682672 TAGGACGGCGAGAAGGAGGATGG - Intronic
1024168259 7:46756739-46756761 GAGAAGGGAGAGAAGGAGGAAGG + Intronic
1024217736 7:47262230-47262252 AAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1024373900 7:48617283-48617305 AGGGATGGAGAGGAGGAGGAAGG - Intronic
1024507014 7:50170379-50170401 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1024874029 7:54000393-54000415 CAGGTTGGTGAGATGGGGGAGGG - Intergenic
1024885139 7:54132825-54132847 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1025198831 7:56949806-56949828 AAGGGAGGAGAGCAGGAGGAGGG - Intergenic
1025673115 7:63627127-63627149 AAGGGAGGAGAGCAGGAGGAGGG + Intergenic
1025847830 7:65216726-65216748 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1026023738 7:66729467-66729489 GAGGATGGAGAGCAGGAGGAAGG - Intronic
1026112099 7:67466447-67466469 AAGGAAGGAGAGAAGAAGGAGGG - Intergenic
1026159026 7:67852654-67852676 AAGGAGGGAGAAAAGGAGGAGGG + Intergenic
1026237569 7:68541081-68541103 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1026303976 7:69124191-69124213 CAGGCTGGAGTGAAGTAGCAAGG + Intergenic
1026330471 7:69347915-69347937 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
1026389004 7:69880721-69880743 GAGGTGGGAGAGAAAGAGGAAGG - Intronic
1026451407 7:70532687-70532709 CATGTTGGAGAGAAGGAAGAAGG - Intronic
1026589134 7:71680635-71680657 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1026602925 7:71791550-71791572 GAGGATGGAGGGTAGGAGGAGGG + Intronic
1026804062 7:73418564-73418586 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1026808622 7:73443861-73443883 AAGTTTGGTAAGAAGGAGGAGGG + Intronic
1027267299 7:76501436-76501458 CAGCTTGGAGAGGAGGAGCCTGG - Intronic
1027319110 7:77001301-77001323 CAGCTTGGAGAGGAGGAGCCTGG - Intergenic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1028168228 7:87564013-87564035 GAGGGTGGAGAGTGGGAGGAGGG + Intronic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1028696405 7:93717825-93717847 AAAGATGGAGAGAGGGAGGAAGG + Intronic
1028814893 7:95132571-95132593 CAGTTTGGTGAGCAGGAGGGAGG + Intronic
1028985714 7:97006731-97006753 CAGCCTGGAGGGAAGGAGCAAGG - Intronic
1029195147 7:98800274-98800296 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1029204886 7:98863656-98863678 AAGGAAGGAGGGAAGGAGGAAGG - Intronic
1029501954 7:100936830-100936852 GAGGTAGAAGAGAAGGAGCAGGG - Intergenic
1029592217 7:101514718-101514740 CGGGCAGGAGAGAAGGAGAAAGG + Intronic
1029628291 7:101734115-101734137 CAGATGGGTGAGAAGGGGGATGG - Intergenic
1029891219 7:103932386-103932408 GAGGATGGAGAGTGGGAGGAGGG + Intronic
1029901394 7:104044065-104044087 GAGGGTGGAGGGAAGGAAGAGGG + Intergenic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030855497 7:114550449-114550471 AAGGTGGGAGAGAGGGAGGTTGG - Intronic
1030862903 7:114658815-114658837 CAGGTGGGGGAGAAGGGAGAAGG - Intronic
1030942489 7:115671296-115671318 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1031023875 7:116659262-116659284 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1031081785 7:117265135-117265157 GAGGCAGGAGAGAGGGAGGAGGG - Intergenic
1031294891 7:119989130-119989152 GAGGTTGGAGGGTAGGAGGAAGG + Intergenic
1031445817 7:121852315-121852337 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031741966 7:125444053-125444075 AAGATAGGAGAGAAAGAGGAAGG + Intergenic
1031857129 7:126936660-126936682 CAAGTGGGAGAGAAAGTGGAGGG - Intronic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032361204 7:131256798-131256820 AAGGGTGGAGGGAGGGAGGAGGG + Intronic
1032462504 7:132122405-132122427 CAGGGTGGAGGCAAGGGGGAGGG - Intergenic
1032478416 7:132227619-132227641 GCGGGGGGAGAGAAGGAGGAGGG + Intronic
1032523505 7:132562942-132562964 GAGGAGGGAGAGGAGGAGGAGGG - Intronic
1032523510 7:132562957-132562979 GAGGAGGGAGAGGAGGAGGAGGG - Intronic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1032554126 7:132813779-132813801 CAGGTGGTGGAGAAAGAGGAGGG + Intronic
1032616816 7:133481830-133481852 CAGAAAGGAGTGAAGGAGGAGGG + Intronic
1032625381 7:133586228-133586250 GAGGGTGGAGGAAAGGAGGAAGG - Intronic
1032634366 7:133690445-133690467 CAGGAAGGAGAGAAAGAAGAAGG - Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1032996115 7:137448556-137448578 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
1033199308 7:139354899-139354921 CAGGTTGGAGTGCAGTAGTAAGG + Intronic
1033227415 7:139572856-139572878 GAGGAGGGAGAGAAGGAGGGAGG - Exonic
1033414094 7:141147240-141147262 CAGGAGGGAGGGAAGGAGAAAGG - Intronic
1033597172 7:142866374-142866396 CAGGCTGGAGATCAGGAGTAGGG - Intronic
1033620263 7:143056135-143056157 TAGGATGGAGGGAGGGAGGAGGG + Intergenic
1033648801 7:143324364-143324386 CAGGTGGAAGAGAGGGAGGTGGG - Intronic
1033885597 7:145941159-145941181 CAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1034207912 7:149333972-149333994 TAGGTAGGAGAGAAGGTGGATGG - Intergenic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034460550 7:151195707-151195729 CAGGTGGGAGAGGAGCAGGCAGG + Intronic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034884998 7:154792596-154792618 CAGGATGGAGAGCAGGGGGGAGG + Intronic
1034995146 7:155572211-155572233 GAGGAAGGAGGGAAGGAGGAAGG + Intergenic
1035237678 7:157509233-157509255 GAGGGGGGAGAGAAGGAGAAGGG + Intergenic
1036036987 8:5030367-5030389 CAGATAGGAGAGAAGGTTGAAGG + Intergenic
1036165185 8:6426081-6426103 CGGGTGGAAGAGAACGAGGAAGG - Intronic
1036197568 8:6733754-6733776 CAGCTGGGAGAGAAGTGGGATGG - Intronic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1036579565 8:10061402-10061424 TAGGTTGGAGAGAAAAAGGATGG - Intronic
1036707169 8:11054707-11054729 CTGGTGGGTGGGAAGGAGGAAGG + Intronic
1037112089 8:15175535-15175557 GAGGATGGAGGGTAGGAGGAAGG + Intronic
1037374675 8:18214829-18214851 CAGGTTGGAGGGTGGGAGGAGGG - Intronic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037558741 8:20053520-20053542 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1037921910 8:22812892-22812914 CAGGGTGGAGACAAGGAAAAAGG - Intronic
1037935303 8:22911469-22911491 AGGGGTGGAGAGAAGGAGGTGGG - Intronic
1038311119 8:26447011-26447033 CGGGTTGGAGGGAAGGAGAAGGG + Intronic
1038575995 8:28703401-28703423 CAGTTTGGAGAGAAGTAAGTCGG + Intronic
1038904189 8:31879700-31879722 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1038920853 8:32082352-32082374 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1039099025 8:33920925-33920947 AAGGTTGGGGAGAGGCAGGAGGG + Intergenic
1039321607 8:36438088-36438110 GAGGTAGGAGAGAGGAAGGAAGG + Intergenic
1039382943 8:37102856-37102878 GGGGTTGGGGAGAGGGAGGATGG - Intergenic
1039427725 8:37500662-37500684 CAGGTGGGAGAGGAGGAGGCAGG - Intergenic
1039428532 8:37506536-37506558 AAGGTAGGAGGGAGGGAGGAAGG + Intergenic
1039644188 8:39262612-39262634 AGGGATGGAGGGAAGGAGGAAGG - Intronic
1039674153 8:39641480-39641502 GAGGATGGAGGGTAGGAGGAGGG - Intronic
1039757838 8:40542148-40542170 TAGGTTGCTGAGAAGGAGAATGG + Intronic
1040024645 8:42770565-42770587 AAGGGTGCAGAGCAGGAGGATGG + Intronic
1041221389 8:55655149-55655171 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG + Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1041628174 8:60055012-60055034 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1041944124 8:63423022-63423044 GATGATGGAGAGTAGGAGGAAGG - Intergenic
1042292627 8:67185219-67185241 TAGGTGGGAAAGAAGGTGGACGG - Intronic
1042492190 8:69412234-69412256 GAGGATGGAGGGTAGGAGGAGGG + Intergenic
1042502716 8:69526851-69526873 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1042655314 8:71089339-71089361 CAGGTGGGAGAGGAGGAGTCAGG - Intergenic
1042701421 8:71618961-71618983 GAGGCTGAAGAGAAAGAGGAGGG - Intergenic
1042715244 8:71765378-71765400 CAGGAAGGAGAGAGGAAGGAAGG - Intergenic
1043037736 8:75218953-75218975 AAGGATGGAGGGAAGGAGGGAGG + Intergenic
1043358471 8:79441465-79441487 CAGATCGGAGAGAAAGAAGAGGG + Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044186398 8:89256884-89256906 GAGGTGAGAGAGAGGGAGGAGGG + Intergenic
1044237094 8:89843541-89843563 GAGGTTGGAGGGTGGGAGGAGGG - Intergenic
1044428608 8:92082889-92082911 GAGGAGGGAGAGAAGGAGGAGGG + Intronic
1044428611 8:92082904-92082926 GAGGAGGGAGAGAAGGAAGAGGG + Intronic
1044557930 8:93584850-93584872 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1044702447 8:94976715-94976737 GAGGTTGGGGAGAAGGAAAAGGG + Intronic
1044808296 8:96031224-96031246 CTGGCTGGAGAGAAGGGGTAGGG - Intergenic
1044900298 8:96936973-96936995 GAGGGAGGAGAGAGGGAGGAAGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045545914 8:103128149-103128171 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1045649442 8:104328529-104328551 CAGGTTGGGCAGAAAGAGGGAGG + Intergenic
1045726362 8:105178477-105178499 GAGGTTGTATAGAAGGAGAAAGG - Intronic
1045959174 8:107946950-107946972 AAGGTTGGAGAGAAGGCAGCAGG + Intronic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1046072029 8:109267267-109267289 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1046505786 8:115136431-115136453 GAGGTTGGAGGGTGGGAGGAGGG - Intergenic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1046722070 8:117631632-117631654 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1046756940 8:117981898-117981920 AAGGAGGGAGAGAAGGAGGGAGG + Intronic
1046902193 8:119535634-119535656 GAGGCTGGAGAAAAGGGGGAGGG - Intergenic
1046959616 8:120096515-120096537 GAAGGTGGAGAGTAGGAGGAGGG - Intronic
1047018377 8:120747673-120747695 GAGGGTGGAGAGTGGGAGGAAGG + Intronic
1047138013 8:122103442-122103464 TAGGTTGGAGACAGGAAGGAAGG + Intergenic
1047175074 8:122532852-122532874 CAGGGTGGTGAGAACAAGGAGGG + Intergenic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1047433284 8:124812028-124812050 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1047762649 8:127965598-127965620 CAGAGTGGAGAGAACAAGGAAGG - Intergenic
1047927638 8:129696996-129697018 GAGGTGGGAGAGAGGGAGGGAGG + Intergenic
1047928600 8:129704409-129704431 AAGGGAGGAGAGAAGGAGGTAGG - Intergenic
1048107859 8:131430963-131430985 GAGGTTGGAGGGTGGGAGGAGGG - Intergenic
1048144722 8:131830114-131830136 AAGGGGGGAGAGAAGTAGGAAGG + Intergenic
1048260096 8:132937981-132938003 CCGGGTGGAGTGGAGGAGGAGGG + Intronic
1048366423 8:133742649-133742671 AAGGTAGGAGAGAAGGAAGGAGG + Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048453581 8:134556005-134556027 AAGGTGGGAGGGAAGGAGGGAGG + Intronic
1048534166 8:135276905-135276927 GAAGGTGGAGGGAAGGAGGAAGG - Intergenic
1048537584 8:135311997-135312019 CAGGTGAGAGAGAAGAATGAAGG + Intergenic
1048537800 8:135313793-135313815 CAGGTGAGAGAGAAGAATGAAGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1049253574 8:141602322-141602344 GAGGAGGGAGAGGAGGAGGAGGG + Intergenic
1049271081 8:141696643-141696665 CAGGCTGGAAGGAAGGTGGAGGG - Intergenic
1049282400 8:141756797-141756819 CCTGTTGGAGTGAAGGAGCATGG + Intergenic
1049354852 8:142182555-142182577 CAGGTGGGGGAGAAACAGGAAGG - Intergenic
1049356681 8:142192655-142192677 CAGGAAGGAGGGAAGGAGGAGGG + Intergenic
1049356694 8:142192693-142192715 CAGGAGGGAGGGAAGGAAGAGGG + Intergenic
1049370261 8:142261021-142261043 CAGGGAGGAGAGAAAGAGGAGGG + Intronic
1049419347 8:142510128-142510150 GGGGGTGGAGAGGAGGAGGAGGG + Intronic
1049427901 8:142545478-142545500 CAGGTGGGCGGGAAGGAGGTGGG - Intergenic
1049506352 8:143001787-143001809 GAGGTTGGAGGGTAGGAGGAGGG - Intergenic
1049529498 8:143147306-143147328 GAGTTTGGAGAGAAGGGGGATGG + Intergenic
1049529502 8:143147331-143147353 GAGTTTGGAGAGAAGGAGGATGG + Intergenic
1049529508 8:143147356-143147378 GTGTTTGGAGAGAAGGGGGATGG + Intergenic
1049529514 8:143147381-143147403 GAGTTTGGAGAGAAGGGGGATGG + Intergenic
1049529520 8:143147406-143147428 GTGTTTGGAGAGAAGGGGGATGG + Intergenic
1049745228 8:144260454-144260476 GAGGTGGGAGACAGGGAGGAGGG - Intronic
1050070780 9:1811068-1811090 GAGGGTGGAGAGCGGGAGGAGGG + Intergenic
1050318728 9:4429293-4429315 GAGGCTGGAGAGAGGGAGGTAGG - Intergenic
1050336000 9:4590586-4590608 CTGGTTGGAGAAAATGAGAAAGG + Intronic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050517617 9:6461372-6461394 GGGGGAGGAGAGAAGGAGGAGGG - Intronic
1050684000 9:8146920-8146942 CAGGAAGAAGAGAAGTAGGAAGG - Intergenic
1050753684 9:8973207-8973229 GAGGGAGGAGAGAAGGAGGAGGG - Intronic
1050912201 9:11085605-11085627 GAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1051014924 9:12463061-12463083 GAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1051018349 9:12508983-12509005 CAGGAAGGAGAGAGAGAGGACGG - Intergenic
1051309974 9:15759106-15759128 AAGGCTGGAGAGAGGGAGGGAGG - Intronic
1051585714 9:18724809-18724831 AAGGTTGGAGAGAAGGGATAAGG - Intronic
1051671628 9:19516300-19516322 CATGATGAAGAGAAGGACGATGG + Exonic
1052336764 9:27328219-27328241 CAGGTTAGGAAGAAGAAGGAGGG + Exonic
1052784275 9:32814127-32814149 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1052894125 9:33731601-33731623 CAGGTTGGAGGGAAGCTGGGAGG - Intergenic
1053070726 9:35100282-35100304 CAGGTTTGAGAGAGGGAGAAAGG - Intronic
1053076993 9:35141660-35141682 GGGGATCGAGAGAAGGAGGATGG + Intergenic
1053198806 9:36138986-36139008 ATGGATGGAGAGAAGGTGGAGGG + Intronic
1053387746 9:37707978-37708000 CAGGGTGGAGAGGAGCAGGTGGG + Intronic
1053543866 9:39002578-39002600 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1053558445 9:39162814-39162836 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1053808296 9:41826075-41826097 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1054138669 9:61456127-61456149 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
1054454018 9:65420378-65420400 GAGATGGGAGAGAAGAAGGAAGG + Intergenic
1054622296 9:67361353-67361375 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1054935828 9:70686742-70686764 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
1055112526 9:72573933-72573955 GAGGGTGGAAAGTAGGAGGAGGG - Intronic
1055660798 9:78502129-78502151 CAGGTTGGAGAAATGGATCACGG + Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055766330 9:79667332-79667354 CAGCCTGGCGAGAAGGAGAAGGG - Intronic
1055782753 9:79837188-79837210 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1056523173 9:87418826-87418848 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1056906905 9:90659684-90659706 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1057380685 9:94564660-94564682 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1057492901 9:95536277-95536299 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059750698 9:117244686-117244708 AAGGAAGGAGAGAAGGAGAAAGG + Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1059824534 9:118013457-118013479 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1059972507 9:119682167-119682189 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1059978238 9:119740983-119741005 GAAGGTGGAGAGTAGGAGGAGGG - Intergenic
1060046675 9:120347016-120347038 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1060056042 9:120413832-120413854 GAGGGAGGAGGGAAGGAGGAGGG + Intronic
1060298952 9:122362820-122362842 CTGGATGGAGAGAAGGGGGAGGG - Intergenic
1060502176 9:124167609-124167631 AAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1060504763 9:124189496-124189518 TAGGCTGGGGAGGAGGAGGAGGG + Intergenic
1060754839 9:126205409-126205431 CCGGCTGGAGGGAATGAGGACGG - Intergenic
1060838390 9:126775572-126775594 CTGGATGGAGAGAAGCATGAAGG + Intergenic
1060847261 9:126847351-126847373 CAGGTGAGAGACAATGAGGATGG - Intergenic
1060997199 9:127881433-127881455 GAGCTGGGAGAGAATGAGGAAGG + Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061281960 9:129602670-129602692 CAGGAAGGAGGGAGGGAGGAAGG + Intergenic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1061418168 9:130459287-130459309 CAGCTTGGGAAGATGGAGGACGG - Intronic
1061848842 9:133403021-133403043 CCGGTGGGACAGCAGGAGGAGGG - Intronic
1061887367 9:133598592-133598614 CTGGTGGGAGAGAGGGAGGGAGG + Intergenic
1061931088 9:133833603-133833625 GAGGTAGGAGGGTAGGAGGAAGG - Intronic
1062097946 9:134712362-134712384 CAGGAAGGAGGGAAGAAGGAAGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062143958 9:134978786-134978808 AAGGAAGGAGAGAAGGAGGGAGG + Intergenic
1062143965 9:134978813-134978835 AAGGAAGGAGAGAAGGAGGGAGG + Intergenic
1062144002 9:134978925-134978947 AAGGAAGGAGAGAAGGAGGGAGG + Intergenic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062188850 9:135236322-135236344 CAGGTTGGAGTGCAGTAGCATGG + Intergenic
1062276226 9:135732816-135732838 CAGGAAGGAGGGAAGGAAGAAGG - Intronic
1062449099 9:136608137-136608159 AGGGAAGGAGAGAAGGAGGAGGG + Intergenic
1062449116 9:136608183-136608205 AGGGAAGGAGAGAAGGAGGAGGG + Intergenic
1062703957 9:137924336-137924358 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1062744678 9:138203686-138203708 GAGGAGGGAGAGGAGGAGGAGGG + Intergenic
1185662062 X:1735677-1735699 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185662065 X:1735692-1735714 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185719974 X:2373628-2373650 CAGGTTGGAGAAAAGGGGAAGGG + Intronic
1185734393 X:2485965-2485987 AGGGTTGGACGGAAGGAGGAGGG + Intronic
1185834154 X:3329377-3329399 AAGGAAGGAGAGAAGAAGGAAGG + Intronic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186118642 X:6333443-6333465 GAAGGTGGAGGGAAGGAGGAGGG - Intergenic
1186234513 X:7493264-7493286 GAGGTTGGAGGGTGGGAGGAGGG - Intergenic
1186239950 X:7555242-7555264 CAGGAGGGAGAGAAGAAGGGAGG + Intergenic
1186356499 X:8797638-8797660 GAGGTTGGAGGGTAGGAGGAGGG + Intronic
1186378209 X:9031620-9031642 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1186402333 X:9271342-9271364 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1186748692 X:12598452-12598474 CTGGCAGGAGAGAATGAGGATGG - Intronic
1186795313 X:13042416-13042438 GAGGTTGGAGGGTAGGAGGAAGG + Intronic
1187098662 X:16170497-16170519 CATGCAGGAGAGGAGGAGGATGG - Exonic
1187132251 X:16514163-16514185 AAGGGGGGAGGGAAGGAGGAAGG + Intergenic
1187239058 X:17496074-17496096 GAGATTGGAGGGCAGGAGGAAGG - Intronic
1187264553 X:17718977-17718999 AAGGATGGAGGGAAGGAAGAAGG + Intronic
1187447625 X:19373005-19373027 CAGGAGGGAGAGCAGAAGGAGGG + Intronic
1187595172 X:20763283-20763305 CAAGGTGGAGGGAGGGAGGAGGG - Intergenic
1187607328 X:20899913-20899935 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1187749608 X:22447343-22447365 AAGGTTGGAGTGCAGGTGGATGG - Intergenic
1187830287 X:23374239-23374261 AAGGGAGGAGGGAAGGAGGAAGG - Intronic
1187918993 X:24182827-24182849 CAGGTTCCAGAGAAGGGGAAGGG + Intronic
1188000312 X:24974245-24974267 CAAGTTGGGGAGAAGCAGGAGGG + Intronic
1188009165 X:25039465-25039487 CAGTATGGAGAGAAGGACGGTGG + Intergenic
1188035129 X:25308919-25308941 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1188194882 X:27221437-27221459 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1188220602 X:27536833-27536855 CAGGTGGCAGATAAGGTGGAGGG - Intergenic
1188259144 X:28001907-28001929 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1188260427 X:28016569-28016591 CAGGTTGGTGACTAGAAGGAAGG + Intergenic
1188327520 X:28823730-28823752 GAGCTTGGAGTGAGGGAGGAAGG - Intronic
1188589596 X:31817726-31817748 CATGTTGGGGAGAAGGAAGTAGG + Intronic
1188597257 X:31916667-31916689 GAGATTGGAGAGCAGGAGAAGGG - Intronic
1188606173 X:32032918-32032940 CAGGATGGAGTAAAGGAGGTAGG + Intronic
1188679210 X:32980598-32980620 CAGGTTGGAGAAGAGGGTGAAGG - Intronic
1188775792 X:34216721-34216743 GAGGGTGGAGAGTAGAAGGAGGG + Intergenic
1189185056 X:39047635-39047657 CAGGGAGGAGAGAAGGTGGTGGG - Intergenic
1189382861 X:40514062-40514084 CAGGGTGGAGTGAAGGAGGGAGG + Intergenic
1189430037 X:40938159-40938181 AAGGATGGAGGGAAGGAAGAAGG + Intergenic
1189435025 X:40984969-40984991 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
1189595351 X:42559035-42559057 CAGGTTGTGGATAAGGAGAAGGG + Intergenic
1189689561 X:43601777-43601799 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1189892997 X:45625027-45625049 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1189895606 X:45652749-45652771 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1190132520 X:47762811-47762833 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1190644262 X:52510259-52510281 AAGGATGGAGAGGGGGAGGAAGG - Intergenic
1190749870 X:53352734-53352756 GGGGTTTGAGGGAAGGAGGAAGG + Intergenic
1190809605 X:53870506-53870528 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
1190880651 X:54490182-54490204 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1190953164 X:55165788-55165810 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1191780431 X:64858439-64858461 CAGGTTGGAGAGTAGGGTGGAGG - Intergenic
1191894463 X:65977167-65977189 GAGGTTGGAGGGTGGGAGGAGGG - Intergenic
1192461635 X:71322054-71322076 TAGTTTGAAGAGAAAGAGGAAGG + Intergenic
1192491538 X:71580009-71580031 GAGGTTGGACAGAAGGAAGAAGG + Intronic
1192725180 X:73742906-73742928 GAGGGTGGAGAGAGGGAGAAGGG - Intergenic
1192831844 X:74758551-74758573 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1193160584 X:78224607-78224629 GAGGATGGAGAGTAGCAGGAGGG + Intergenic
1193289688 X:79757167-79757189 CAGGATGGAGGGTGGGAGGAGGG - Intergenic
1193448042 X:81629331-81629353 AAGGATGGAGGGATGGAGGAGGG - Intergenic
1193488797 X:82121221-82121243 GAGGGTGGAGAATAGGAGGAGGG + Intergenic
1193599228 X:83488765-83488787 CCGGTTGGAGATGAGGGGGAAGG - Intergenic
1193908760 X:87277024-87277046 CAGGGTGGGGAGAAGGCGAAGGG - Intergenic
1193932179 X:87566913-87566935 GAGGGTGGAGGGCAGGAGGAGGG + Intronic
1193947611 X:87757401-87757423 GAGGGTGGAGAGCGGGAGGAGGG - Intergenic
1194167436 X:90536283-90536305 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
1194504526 X:94715860-94715882 CAAGGTGGAGAGTGGGAGGAGGG + Intergenic
1194568058 X:95518871-95518893 CAGGTTGCGGAGAAAAAGGAAGG + Intergenic
1194914382 X:99686862-99686884 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1195211147 X:102652896-102652918 GAGGTTGGTGAGAAGGGGGAGGG + Exonic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1195353430 X:104015686-104015708 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1195427146 X:104747321-104747343 AAGGGAGGAGGGAAGGAGGAAGG - Intronic
1195467673 X:105197906-105197928 GAGGGTGGAGAGTGGGAGGAGGG - Intronic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195502491 X:105618275-105618297 CAGGGTGGAGTGTAGGAGGAGGG + Intronic
1195563652 X:106315931-106315953 GAGGTTGGAGGGAAGGAGGAAGG + Intergenic
1195977373 X:110542269-110542291 GAGGATGGAGGGAGGGAGGATGG - Intergenic
1196010264 X:110879534-110879556 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1196468414 X:115995952-115995974 GAGGTTGTAGAGAAAAAGGAAGG - Intergenic
1196494606 X:116309754-116309776 AAGGGTGGAGGGAGGGAGGATGG - Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1196896604 X:120343087-120343109 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1196943745 X:120803634-120803656 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1197107802 X:122736433-122736455 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
1197287449 X:124612757-124612779 TAGTTGGGAGAAAAGGAGGAAGG - Intronic
1197704776 X:129626742-129626764 AAGGTGGGAGGGAAGGAGGAGGG + Intergenic
1197824793 X:130577387-130577409 CAGGTTAGAGAAAGGAAGGAAGG + Intergenic
1198170771 X:134103126-134103148 GAGGTTGGAGAGTAGGAGGAGGG + Intergenic
1198453758 X:136794672-136794694 GAGGATGGAGAGCAGGAGGAGGG - Intergenic
1198625374 X:138566583-138566605 GAAGTTGGAAAGAGGGAGGAGGG + Intergenic
1198626892 X:138586060-138586082 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1198733232 X:139756818-139756840 CAGGGTGGAGAGTGAGAGGAGGG + Intronic
1198937664 X:141915912-141915934 GAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1198961391 X:142186951-142186973 GAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1199000260 X:142628162-142628184 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
1199095872 X:143737891-143737913 TAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1199770382 X:150971490-150971512 AAGGGTGGAGAGCAGGAGGAGGG + Intergenic
1199791376 X:151158439-151158461 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1199848759 X:151710450-151710472 GATGTTGGAGAGGAGGAAGAAGG - Intergenic
1199964000 X:152803285-152803307 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1200022802 X:153226096-153226118 CAGGCTGGAGGGAGGGTGGAAGG + Intergenic
1200163013 X:154018928-154018950 AAGATTCGAGACAAGGAGGAAGG - Intronic
1200513699 Y:4114061-4114083 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
1200738854 Y:6831504-6831526 AAGGAGGGAGAGAAGGAGGGAGG - Intergenic
1200782535 Y:7229621-7229643 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
1200807028 Y:7443561-7443583 GAGGTGGGAGGGAGGGAGGAAGG - Intergenic
1200842058 Y:7792447-7792469 CATGGTGGAGAGTAGGAGGCTGG - Intergenic
1201254278 Y:12091682-12091704 CAGGAATGAGAGAATGAGGAGGG - Intergenic
1201319673 Y:12683996-12684018 CAGCTTGGAGATAAAGAGCAAGG + Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201341100 Y:12935498-12935520 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1201409636 Y:13686411-13686433 GAGGGTGGAGGGAAAGAGGAGGG + Intergenic
1201690577 Y:16760250-16760272 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1201711794 Y:17000635-17000657 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1202300723 Y:23410963-23410985 CAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1202570088 Y:26259635-26259657 CAGGGTGGAGGGTAGGAGGAGGG - Intergenic