ID: 926109412

View in Genome Browser
Species Human (GRCh38)
Location 2:10172449-10172471
Sequence GAGCTGAGGGAAGACGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 424}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926109406_926109412 11 Left 926109406 2:10172415-10172437 CCGTCAGTGATTTATAGGAAGCT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 926109412 2:10172449-10172471 GAGCTGAGGGAAGACGGTGAAGG 0: 1
1: 0
2: 1
3: 41
4: 424
926109404_926109412 19 Left 926109404 2:10172407-10172429 CCTTGTCTCCGTCAGTGATTTAT 0: 1
1: 0
2: 0
3: 9
4: 196
Right 926109412 2:10172449-10172471 GAGCTGAGGGAAGACGGTGAAGG 0: 1
1: 0
2: 1
3: 41
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926109412 Original CRISPR GAGCTGAGGGAAGACGGTGA AGG Intronic
900500930 1:3004229-3004251 CAGCTGAGGGACCAGGGTGAGGG - Intergenic
900614993 1:3561448-3561470 GGGCTGATGGCAGAAGGTGATGG - Intronic
900973617 1:6004964-6004986 GAGCTGAGGGATGAGGGTGCAGG + Intronic
900973751 1:6005440-6005462 GAGCTGAGGGGTGAGGGTGGAGG + Intronic
901004707 1:6166123-6166145 GAGCTGAGGGACAACAGAGAAGG + Intronic
901139000 1:7015896-7015918 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
901148798 1:7086566-7086588 GGGTTGGGGGAAGAGGGTGATGG - Intronic
901165233 1:7216140-7216162 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
901227807 1:7624546-7624568 GAGATGAAGGGAGAGGGTGATGG + Intronic
901361070 1:8701202-8701224 TAGGGGAGGGAAGACTGTGATGG - Intronic
902276470 1:15343449-15343471 GAGCTGGGGAAAGATGGAGAAGG - Intronic
902767537 1:18627453-18627475 GGGCTGAGGGAAGAGGCTGTTGG + Intergenic
902791645 1:18772807-18772829 GAGCTGAGGTCAGACAGTCATGG - Intergenic
902835662 1:19045210-19045232 GTGCTGAGGGGTGGCGGTGATGG - Intergenic
904437340 1:30507373-30507395 GTCCGGAGGGAGGACGGTGATGG + Intergenic
904533389 1:31183355-31183377 GCGGTGAGGGAAGACGGTACAGG + Intronic
904643441 1:31947691-31947713 GAGCTGAGGGAAAACCATTATGG + Intergenic
905394840 1:37660620-37660642 GAGCCCAGGGAAGAAGGGGAGGG + Intergenic
906066507 1:42984842-42984864 GGGCTGAGGGAAGAAGGAGGAGG + Intergenic
906684922 1:47757053-47757075 GAGGTGAGGGAACACTGGGAAGG + Intergenic
907306781 1:53517741-53517763 GAACAGAGGGGAGAGGGTGAGGG - Intronic
908466388 1:64400185-64400207 GAGCTGAGAGAAGAGGTTGGAGG - Intergenic
908768128 1:67572406-67572428 GAGCAGAGGGAAGGAGGGGAAGG + Intergenic
910173534 1:84403521-84403543 GAGCAGAAGGAAGAAGGGGAAGG + Intronic
912202949 1:107479228-107479250 GAGCTTAGGAAAGATGGTGGTGG - Intronic
913020363 1:114783466-114783488 GAGCTGATGGAAAAAGTTGAAGG + Intergenic
914883921 1:151569686-151569708 GAGCTTGAGGAAGACGGTGCAGG + Exonic
914984875 1:152447946-152447968 GAGCTGAGGGACTACCTTGAGGG + Intergenic
915442931 1:155957590-155957612 GAGGTGGGGGAAGAGGTTGAGGG - Intronic
915631099 1:157154741-157154763 CAGCTCAGGGGAGAGGGTGAGGG - Intergenic
915945897 1:160151718-160151740 GAGGTGAGGGAATGCAGTGAGGG - Exonic
916361692 1:163977152-163977174 GGGCCAAGGGAAGAGGGTGAAGG - Intergenic
917017004 1:170543430-170543452 GAGAAGAGGGAAGAAGGTGATGG + Intronic
917521571 1:175752149-175752171 GAACTGTGGGAAGGGGGTGAGGG + Intergenic
917536151 1:175876101-175876123 GAGGTCAGAGAAGACCGTGATGG + Intergenic
918411361 1:184261264-184261286 AAGCTCAGGGAAGATGCTGATGG + Intergenic
919355204 1:196513624-196513646 GAGCTGAAGGAAGAAGGACAAGG - Intronic
919725541 1:200880365-200880387 GAGCTGGGGAAAGACGGGCAGGG + Intergenic
919814267 1:201427936-201427958 GGGCAGAGGGAAGAGGCTGAGGG + Intronic
919817393 1:201450092-201450114 CAGCTGCAGGAAGACGCTGAAGG - Intergenic
919925003 1:202187611-202187633 CATCTGAGGGAAGACAGTGAGGG - Intergenic
920717052 1:208349975-208349997 GAGCTGATGGAAGCAGCTGATGG - Intergenic
921022004 1:211244413-211244435 GTACTGAGGGAAGAGAGTGAAGG + Intergenic
921616342 1:217272121-217272143 GGGCTGAGGGAAGCAGGTGCAGG - Intergenic
922758516 1:228109713-228109735 GGGCTGAGGGAAGACGCAGGGGG + Intergenic
923482555 1:234397680-234397702 GAGGTGAGGGAAGAGGGGGAGGG + Intronic
924567061 1:245207743-245207765 GAGCTGTGGGAAGTGGGTGGTGG - Intronic
924645345 1:245872442-245872464 CAGCTCAGGGAGGCCGGTGAAGG - Intronic
924880197 1:248152597-248152619 GAGCTGAGTGAGGCCTGTGAAGG - Intergenic
1062978490 10:1702398-1702420 AAGATGAAGGAAGAGGGTGAGGG + Intronic
1063114027 10:3060611-3060633 GAGCTGAGGGAGGAGCCTGAAGG - Intergenic
1063626549 10:7695729-7695751 GCTCTGAGGCAAGACGGTAATGG + Intergenic
1064137566 10:12764022-12764044 GGGAGGAGGGAAGACGGTGGGGG - Intronic
1064584440 10:16825276-16825298 GAGTTGAGGGAAAATGGGGAAGG + Intronic
1065201073 10:23313693-23313715 GAGCTGAGGGAAGCAGGCGACGG + Intronic
1065689543 10:28319165-28319187 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
1065991531 10:31014645-31014667 CAGCTGCGTGATGACGGTGAAGG + Intronic
1067748785 10:48956507-48956529 AAGCAGAGGGAGGAGGGTGAAGG - Intronic
1067809397 10:49415668-49415690 GAGATGAGGAAAGAAGGGGAAGG + Intergenic
1067824608 10:49561198-49561220 GAGAGGAGGGAAGTCAGTGAAGG + Intergenic
1069152335 10:64979324-64979346 AAACGGAGGGAAGAAGGTGAAGG - Intergenic
1069901260 10:71707949-71707971 GAGGTGAGGGAAGAAAGGGAAGG - Intronic
1071940886 10:90590239-90590261 GAGTCGAGGGAAGAGGGTGGGGG - Intergenic
1072694969 10:97596339-97596361 GAGGTGAAGGAAGAGGGTGATGG + Intronic
1073283068 10:102368922-102368944 GCAGTGAGGGAAGACGCTGAGGG - Intronic
1073961738 10:108939056-108939078 GAGCTGATAGAAGAAGGTGGTGG + Intergenic
1074142864 10:110690542-110690564 GAGCTGGGGGAAGAGGGACATGG - Intronic
1075103775 10:119523965-119523987 GAGCTGAGGGAAGACCAGAAGGG - Intronic
1076117278 10:127908951-127908973 CAGTTGAGGGAAGTCGATGAGGG + Intronic
1076522292 10:131088888-131088910 GAGCTGAGGGAAGTCAGGGAGGG + Intergenic
1076530711 10:131142643-131142665 GACCTGAGGGCAGCCTGTGATGG - Intronic
1076752517 10:132550730-132550752 GACCTCATGGAAGACGGTGGAGG + Intronic
1076770522 10:132660773-132660795 GAACTGGGGGAAGATGGAGAAGG + Intronic
1077051688 11:569453-569475 GAGCTGAGGGGAGACGGCCCGGG - Intergenic
1077057441 11:601680-601702 GAGAAGAGGGAAGAAGGTAAAGG + Exonic
1077264942 11:1643902-1643924 GAGCTGAGGGGACATAGTGAGGG + Intergenic
1077540971 11:3146338-3146360 GAGGTGAGGGCAGACGAGGAGGG + Intronic
1079136281 11:17777480-17777502 GGGCTGAGGGAGGAGGGTGTTGG - Intronic
1079351103 11:19692830-19692852 GAGGTGAGGGGAGATGGGGATGG + Intronic
1079538230 11:21540640-21540662 GAGCTGGAGGAAGAGAGTGAAGG + Intronic
1081158804 11:39728475-39728497 GAGCAGAAGGAAGAAAGTGAAGG + Intergenic
1081911281 11:46701371-46701393 GAGAGAAGGGAAGACAGTGAGGG - Intronic
1082859127 11:57837169-57837191 GAGCAGAAGGAAGACAGTGAAGG - Intergenic
1083611969 11:64008591-64008613 GTGCTAGGGGAAGACAGTGAGGG + Intronic
1083616412 11:64028681-64028703 GAGCTGCGGGAGGAGGGGGAGGG - Intronic
1083689485 11:64398390-64398412 GCCCTGAGGCAAGACTGTGAAGG - Intergenic
1083802074 11:65052662-65052684 GGGTTGTGGGAAGCCGGTGAAGG - Intronic
1084170273 11:67397527-67397549 GTGCTGGCGGAAGACAGTGAGGG + Exonic
1084182519 11:67454053-67454075 GAGCTGTGGGAAGCGGGAGAGGG - Intronic
1084510957 11:69603432-69603454 TAACTGAGGGAAGCCTGTGATGG - Intergenic
1084594138 11:70107133-70107155 GATCTGAGGGATGATGGGGAGGG + Intronic
1084668620 11:70592204-70592226 GTGCAGAGGGAAGACGGAGCAGG - Intronic
1085267655 11:75246769-75246791 GTGCTGAGGGAAGCAGGTGGGGG - Intergenic
1085397439 11:76213748-76213770 GGGCTTAGGGAAGACAGAGAAGG - Intergenic
1085529501 11:77183155-77183177 GAGGTGAGGGCAGACGCTGGGGG + Exonic
1085567752 11:77530177-77530199 GAGCTGAGGGGAGAGGGGAAAGG - Intronic
1085761678 11:79246808-79246830 GAGGTGAGGGAAGAGGGAGAGGG + Intronic
1087913723 11:103783106-103783128 GTGCTGGGGGAAAAGGGTGAGGG - Intergenic
1088728374 11:112659026-112659048 GAGGTGAGGGAAGAGGAAGAAGG - Intergenic
1088842472 11:113638609-113638631 GAGCAGAGGGAAGAGAGGGAGGG + Intergenic
1090093578 11:123722548-123722570 CAGCTGAGGGAAGACGCTAGAGG + Intergenic
1090268895 11:125371798-125371820 GAGCAGTGAGAAGACAGTGAGGG + Intronic
1090590566 11:128262538-128262560 GCACAGAGAGAAGACGGTGACGG - Intergenic
1090805987 11:130202526-130202548 GAACTGAGGGTTGAAGGTGAGGG + Intronic
1090950214 11:131466215-131466237 GAGGAGTGGGAAGACGGAGAAGG + Intronic
1091002568 11:131922648-131922670 GAGCCGAGGAGAGACGGTGGTGG - Intronic
1091219111 11:133920071-133920093 GAGCTCAGGGGAGCCGGTGCGGG + Exonic
1091433044 12:453033-453055 GAGCTGGGGCAAGACTGGGAAGG - Intergenic
1092459061 12:8670688-8670710 GAGCTGTGAGAAGACGGCCATGG - Intergenic
1093209633 12:16292825-16292847 CAGATGAGTGAAGACGGTGGTGG + Intergenic
1094757276 12:33486007-33486029 GAGGTGGTGGAAGACAGTGAGGG + Intergenic
1095726638 12:45460964-45460986 GAGAAGAGGGAAGATGGGGATGG + Intergenic
1095788859 12:46142884-46142906 GAGGGGAGGGAAGACTGGGAAGG - Intergenic
1096423712 12:51482923-51482945 AAGCTGAGGGAAGACAGTTTGGG - Intronic
1097520108 12:60656704-60656726 GAGCAGGAGGAAGACAGTGAAGG - Intergenic
1098021299 12:66159066-66159088 GACCAGAGGGAAGACTGTGGTGG + Intronic
1098804946 12:75011736-75011758 GAGCTGAGGGAACACGAAGAAGG - Intergenic
1099810991 12:87582071-87582093 GAGCTAATGGCAGAGGGTGAAGG + Intergenic
1099977645 12:89562883-89562905 GAGCAGAGAGAATACAGTGAAGG - Intergenic
1100228337 12:92581734-92581756 AAGCTGAGGGAAAAGGGGGAGGG - Intergenic
1100275233 12:93065717-93065739 GAGTTGAGGGAATGAGGTGAGGG + Intergenic
1100585817 12:95978287-95978309 GTTCTGAGGTAAGACGGAGATGG + Intronic
1101342239 12:103852969-103852991 GAGCTCAGGGAAGGCAGTGTTGG + Intergenic
1101880583 12:108623103-108623125 GAGCCCAGGGAGGACCGTGAGGG - Exonic
1102075967 12:110060505-110060527 AAGCTAAGGGAAGGAGGTGAGGG - Intronic
1102472458 12:113167432-113167454 AAGCTGAGGGAAGAGCATGATGG + Intronic
1102512671 12:113426130-113426152 GAGGTGAGGGTAGGGGGTGAGGG - Intronic
1103582407 12:121925076-121925098 GAGGTGAGGCAAGAAGGGGAAGG - Intronic
1103642251 12:122361011-122361033 GAGCTGAGGGAAGAGGCAGAAGG + Exonic
1103799577 12:123528926-123528948 GTGCTGAGGGAAGAACGTGAAGG - Intronic
1103820137 12:123691301-123691323 GAGCTGAGGGAAGAGGGGTAGGG - Intronic
1103959899 12:124602983-124603005 GAGCCGAAGGAAGAGGATGAAGG + Intergenic
1106031692 13:26010619-26010641 GAGCTGTGGACAGTCGGTGATGG + Intronic
1108027962 13:46198586-46198608 GAGGTAAGGGCAGACAGTGAGGG + Intronic
1109259886 13:60131634-60131656 GAGTTGAGGGAAAACAGAGAGGG + Intronic
1109704801 13:66076482-66076504 AATCTGAGGGCAGAAGGTGATGG - Intergenic
1110584471 13:77172236-77172258 GAGCTGAGGGAAAACTGTCAGGG + Intronic
1112303042 13:98247564-98247586 GGGAGGAGGGAAGACGGAGAAGG + Intronic
1113284759 13:108834520-108834542 GAGCTGAGAGAAGAAGGTTAAGG + Intronic
1113719806 13:112546666-112546688 GAGCAGAGTGAAGACAGTGAAGG + Intronic
1114311098 14:21468037-21468059 GGGCTGAGGGATGAGGGGGATGG + Intronic
1114423410 14:22603268-22603290 GAGCTGAGGGAAGTTGGGGAGGG + Intronic
1114540164 14:23449443-23449465 GACCTGGGGGGAGACTGTGAAGG - Intergenic
1115398464 14:32934449-32934471 CAGCTGAGGGAAGAAGGGGAGGG - Intergenic
1117528286 14:56633369-56633391 GAGAGGAGGGAAGAGGGTGCTGG + Intronic
1117961779 14:61170438-61170460 CAGCCAAGGGCAGACGGTGAAGG + Intergenic
1118313146 14:64707306-64707328 GAGATGAGAAAAGACGGTGTGGG - Intronic
1118652456 14:67911803-67911825 GAGCTGAGGAAAGAATGGGAAGG - Intronic
1118780527 14:69004836-69004858 GAGCTGGGGGAAGAGGGAGGAGG - Intergenic
1118835196 14:69473011-69473033 GGGATGATGGGAGACGGTGATGG - Intergenic
1119557199 14:75562434-75562456 GAGAAGAGAGAAGACGCTGAAGG - Intergenic
1119738543 14:76999360-76999382 GAGCTGGAGGAAGAGGATGAGGG - Intergenic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1121398441 14:93648916-93648938 CAGCAGTGGGAAGACAGTGAAGG + Intronic
1121908627 14:97769410-97769432 GAGCAGAGGGCTGACAGTGATGG - Intergenic
1122144774 14:99683067-99683089 GGGCTGAGGGGCGACGGAGACGG - Intergenic
1122656795 14:103267473-103267495 GAGCGGGAGGAAGAGGGTGAAGG + Intergenic
1122940600 14:104979333-104979355 GAGCTGAGGAAAGACTGCGCAGG + Intergenic
1122947617 14:105020503-105020525 GAGCCCAGGGAAGACGGCGCTGG + Intronic
1124609680 15:31200044-31200066 GAGCTCAGGGAAGAGGGAGAGGG + Intergenic
1124621947 15:31278933-31278955 GAGCAGAGGGGAGACAGCGAGGG - Intergenic
1125790990 15:42365579-42365601 GAGGTGAGGGGAAAAGGTGAGGG - Intronic
1125790994 15:42365592-42365614 GAGTTGAGGGAAAGAGGTGAGGG - Intronic
1126644032 15:50857011-50857033 GAGCAGAGGGAAGATGGAGAGGG + Intergenic
1127384136 15:58453508-58453530 GGGCTGGGGGAAGGTGGTGATGG + Intronic
1127538493 15:59913829-59913851 AAACGGAGGGAAGACGGTGTTGG - Intergenic
1129161559 15:73750964-73750986 GAGCTGAGGGAGGTAAGTGAGGG - Exonic
1130136816 15:81188382-81188404 GAGCTGAGGGAAGGCAGAGCTGG + Intronic
1130207982 15:81895499-81895521 GAGATGAGGGAAGAAGCTGGGGG + Intergenic
1132609384 16:807653-807675 AAACTGAGGTAAGACGGTCAGGG + Intronic
1133170441 16:3979607-3979629 AAGCTGATGGGAGCCGGTGACGG - Intronic
1134093024 16:11401654-11401676 GAGCTAAGGGAAGACAGTGGAGG - Intronic
1134230126 16:12422550-12422572 GAGCCCAGGGAAGACGAGGAGGG - Intronic
1134243553 16:12523372-12523394 GAGCTGAGAGAAGGCAGTGGAGG - Intronic
1134455289 16:14390853-14390875 GAGCTGAGGGAAGACTGGCTTGG + Intergenic
1134634808 16:15784219-15784241 GGGCTGAGGGAAGACACTTAGGG + Intronic
1136172590 16:28497724-28497746 GAACAGAGGGAAGACAGTGAGGG + Exonic
1136291104 16:29271958-29271980 GGGCTGCGGGAGGACGGTGCGGG - Intergenic
1136748660 16:32614175-32614197 GAGCTGTGGGAAGACTAAGAGGG - Intergenic
1137038772 16:35590784-35590806 GTGCTGAGGCAAGAGAGTGAGGG + Intergenic
1137727263 16:50665303-50665325 GGGCTGAGGGAAGAGGATGGAGG + Intergenic
1138122457 16:54411563-54411585 GAGCAGAGAGAAGACTGGGAGGG + Intergenic
1140557451 16:75938076-75938098 GAAGGGAGGGAAGAGGGTGAGGG - Intergenic
1140804037 16:78516199-78516221 GAGCTCAGAGAAGAGTGTGAAGG - Intronic
1140928950 16:79609447-79609469 GAGTTGAAGGAAGAGAGTGAAGG - Intergenic
1140978524 16:80084187-80084209 GGGGTGAGGGCAGATGGTGATGG + Intergenic
1141804652 16:86334712-86334734 GGGAGGAGGGAAGACGGGGATGG + Intergenic
1141909201 16:87047069-87047091 TGGCTGAGGGAATACGCTGAGGG - Intergenic
1142024376 16:87804646-87804668 GAGCTCAGGGAGGACAGGGAGGG - Intergenic
1142428651 16:90014057-90014079 AAGCTGAGAGAAGCCGTTGAAGG + Intronic
1203050793 16_KI270728v1_random:873389-873411 GAGCTGTGGGAAGACTAAGAGGG - Intergenic
1142479992 17:213355-213377 GAGCTGAAGGGAGAGGGAGAGGG + Exonic
1142766553 17:2067666-2067688 GAGGGGAAGGAAGACGGGGAGGG + Intronic
1143050198 17:4119019-4119041 TACCTGAGGTAAGACAGTGAGGG + Intronic
1143142240 17:4747387-4747409 GAGCTAAGGGAAGTCACTGAAGG - Intergenic
1143504579 17:7356579-7356601 GACCTGAGGGAAGACGAGGGTGG - Exonic
1144643397 17:16952175-16952197 GAGCTGAGGGAAGATGATAGAGG + Intronic
1144730436 17:17522911-17522933 GGGCAGAGGGAGGAGGGTGAGGG - Intronic
1144877794 17:18411426-18411448 GAGCGGCGGGAAGACGCTGCTGG - Intergenic
1145154427 17:20532963-20532985 GAGCGGCGGGAAGACGCTGCTGG + Intergenic
1145813768 17:27781150-27781172 CCGCTGGGGGAACACGGTGATGG + Exonic
1146514966 17:33482022-33482044 GAGCTGAGGGAATGTGGTCATGG - Intronic
1147155409 17:38542253-38542275 GAGCTGAGGGAAGGGGCTGCTGG + Intronic
1148063567 17:44852818-44852840 GTGCTGAGGCAAGTCAGTGATGG - Intronic
1148759938 17:49994416-49994438 GAGCTGAGAGAGGAAGGGGAAGG - Intronic
1148766067 17:50039022-50039044 GAGCTGAGGGAACTTGGAGAAGG - Intergenic
1148866982 17:50633905-50633927 GAGCTGAGGCAAGCAGGAGAAGG + Intergenic
1149482635 17:57016243-57016265 GGGCTGAGCAAAGCCGGTGAGGG - Intergenic
1151509482 17:74549541-74549563 GAGCTGTGGGGACACGGTGATGG + Intergenic
1152322020 17:79613012-79613034 GAGCTGAAGGGAGACGGAGATGG - Intergenic
1152760217 17:82103702-82103724 GAGCTGAGGGAGGGGGGTGAAGG + Intronic
1155427748 18:25723989-25724011 GGGCTGTGGGGAGCCGGTGATGG + Intergenic
1156617267 18:38802188-38802210 GAACTAAGGGAAGACAGTGAAGG - Intergenic
1157144910 18:45152277-45152299 GACTTGGGGGAAGAAGGTGAGGG - Intergenic
1159136913 18:64347503-64347525 GAGCTGAGGGCAGGAGGAGATGG - Intergenic
1159503933 18:69310148-69310170 GAGCTGAATGAAGACGTTGGAGG - Intergenic
1160166947 18:76522200-76522222 GAGCTGAGTGAAGGAGGTCAGGG + Intergenic
1160659914 19:293099-293121 GAGCGGGGGGAAGACAGTGGGGG + Intergenic
1161430466 19:4229412-4229434 GACCTGAAGGAAGTCGGGGAGGG + Intergenic
1163543499 19:17926415-17926437 GAGCTGAGTGAAGACAGGGAGGG - Intergenic
1163632242 19:18423440-18423462 GAGGGGAGGGAGGACGGCGAGGG + Intronic
1165796598 19:38523523-38523545 GAGATGAGAGAAGAGGGAGATGG - Intronic
1165802207 19:38559597-38559619 GAGGTGAGGGCAGAAGGTGAGGG + Intronic
1166336943 19:42114049-42114071 GAGCTGAGGGAAGCTGGGGAAGG + Intronic
1166531319 19:43545219-43545241 GAGCAGAGGAAAGACAGTCACGG - Intronic
1167112852 19:47472033-47472055 GGGCAGAGGGAAGGCGGTGCGGG + Exonic
1167409489 19:49336669-49336691 GAGCTGAAGGAGGAAGGAGAGGG + Intronic
1167430026 19:49448839-49448861 GAGGTGAGGCAAGACAGAGATGG + Intronic
1167430123 19:49449379-49449401 GAGCTGAGGGAGGAGGGTCCTGG + Intronic
1167987152 19:53328167-53328189 CAGGGGAGGGAAGACAGTGAAGG + Intergenic
1168263695 19:55209601-55209623 GCGGTGAGGGAGGAAGGTGAGGG - Intergenic
1168384668 19:55953230-55953252 GGGGTGATGGGAGACGGTGACGG - Intronic
925006396 2:446099-446121 GAGCTGCGGGAAGACGAAGCAGG + Intergenic
925038253 2:708843-708865 GATTTGAGGGGAGACGGTGCAGG + Intergenic
925258975 2:2513086-2513108 GAGCGGAGGGAGCACGTTGAAGG - Intergenic
925307407 2:2859016-2859038 GAGCTGGGGGAAGACAGGAAGGG - Intergenic
926109412 2:10172449-10172471 GAGCTGAGGGAAGACGGTGAAGG + Intronic
926302616 2:11615275-11615297 GAGCTGGGGACAGAAGGTGAGGG + Exonic
927124015 2:19996692-19996714 GGGCTGAGGGGAGCGGGTGATGG + Intronic
927238505 2:20899861-20899883 GAGGTGAGGGAAGAAGTTGTTGG + Intergenic
927518986 2:23688036-23688058 ATGCTCAGGGAAGAGGGTGAAGG - Intronic
929764466 2:44832612-44832634 GTGCTGATGAAAGACAGTGAGGG + Intergenic
930359259 2:50357995-50358017 TAGCCAAGGGAAGCCGGTGAGGG + Intronic
931188467 2:59976544-59976566 GAGCTCAGGGAAGAAGGTGATGG - Intergenic
931646731 2:64429474-64429496 GACCTCAGGGAAGACCCTGAAGG - Intergenic
932713306 2:74083443-74083465 GAGCTGTGGGAAGACAGGGTTGG + Intronic
933596946 2:84291843-84291865 GATCTGAGGCAAAACTGTGAAGG + Intergenic
934925832 2:98381210-98381232 GAGGAGAGGCAAGACGTTGAGGG + Intronic
934945926 2:98541684-98541706 AAGCTGAGGTAAGAGGATGATGG - Intronic
936679457 2:114753511-114753533 GAGATGAAGGAAGACAGAGAAGG - Intronic
936874593 2:117173034-117173056 GAGCAGAAGGAAGACAGAGAGGG - Intergenic
937091475 2:119209276-119209298 GAGCTCAGGGAGCAGGGTGAGGG - Intergenic
937301954 2:120848051-120848073 AAGCTGTGGGAAGAGGGAGAAGG + Intronic
940037451 2:149325754-149325776 AAGCTTAGTGAAGAAGGTGAAGG - Intergenic
942447124 2:176085518-176085540 GAGGCGAGGGAGGACGGGGATGG + Intergenic
942733327 2:179082604-179082626 GAGCTGTGAGAAGAGGGCGAGGG - Intergenic
944842777 2:203640439-203640461 GAGCTGAGGGGAGGTGGAGATGG - Intergenic
945515037 2:210752875-210752897 GAGATGAGGGAAGAAGCTGAGGG - Intergenic
946459574 2:219857042-219857064 GAGCGGAGGGAACACGGAGCAGG + Intergenic
947540385 2:230973354-230973376 GAGCTGGGGGAAGTGGGGGATGG + Intergenic
947583337 2:231335485-231335507 GAGCTGTGGGTAGACTTTGAGGG - Intronic
948005683 2:234605731-234605753 GAGCTGAGGGTAGCGGATGAGGG - Intergenic
948858872 2:240743328-240743350 CAGCTGAGGGGAGATGGAGATGG + Intronic
948945604 2:241217634-241217656 GGGCTGAGGGCGGACGGTGGCGG + Intronic
1168955068 20:1828930-1828952 GAGATGGGGGAAGAGGGAGAGGG - Intergenic
1169613497 20:7411293-7411315 GAGCAGGAGGAAGACAGTGAAGG - Intergenic
1170085917 20:12531391-12531413 AACTTGAGGGAAGAAGGTGATGG + Intergenic
1170938124 20:20827204-20827226 GAACTCAGGGAAGAGGGAGAGGG + Intergenic
1171145132 20:22774788-22774810 GAGCAGAGGGAGGCCGGTGAGGG + Intergenic
1171815346 20:29781475-29781497 GAGCAGGGGGAAGAGAGTGAGGG + Intergenic
1172005287 20:31815402-31815424 GAGCAGAGGGAAGGCTGTGAGGG + Intergenic
1172159800 20:32859261-32859283 GAGCTGACGGAAGAGGGGCAGGG - Intronic
1172408001 20:34703811-34703833 GAGCTGAGGAAAAACGGGGTGGG + Intronic
1173023311 20:39285817-39285839 GAGCTGAGGGAAGCGGGGCAGGG + Intergenic
1173141566 20:40489460-40489482 GAGCAAAGGGTAGATGGTGATGG - Intergenic
1173248512 20:41352278-41352300 GAGGGCAGGGAAGACTGTGAGGG + Intronic
1173364649 20:42373945-42373967 GAGCTGAGGCCAGAGGGTGCTGG + Intronic
1173382981 20:42562730-42562752 GGGCTGAGTGATGAGGGTGATGG - Intronic
1173846339 20:46191114-46191136 GAGCTGAGGGAAAAAAGTTAAGG + Intronic
1174220258 20:48948809-48948831 GAGCGGCGGGAAGACGGACAGGG - Intronic
1175311336 20:58013680-58013702 GAGCTGAAGGAGGAAGGTGGAGG + Intergenic
1175563807 20:59955920-59955942 GAGCTGGGGGACAACAGTGAAGG - Intergenic
1175613987 20:60376971-60376993 CAGCAGAGGGAAGAAGGTGAGGG + Intergenic
1176146936 20:63569669-63569691 GAGAGGAGGCCAGACGGTGAGGG + Intronic
1177816950 21:25988026-25988048 GAGCTGAGGGGAGAGGGGAAAGG + Intronic
1178168916 21:30016804-30016826 TAGCTGAGGTAGGATGGTGATGG + Intergenic
1178509715 21:33194160-33194182 GAGCCTAGGGAACAAGGTGAGGG + Intergenic
1179947135 21:44686172-44686194 GAGCCGAGGGGAGCTGGTGAAGG - Intronic
1180830852 22:18905418-18905440 GAGCTAAGGGGACACAGTGAGGG - Intergenic
1180949230 22:19713853-19713875 GAGCTGGGGTGAGACGGTCAGGG + Intergenic
1181440572 22:22933385-22933407 GAGCTGATTGAAGATGGTGCTGG - Intergenic
1181584333 22:23844877-23844899 GAGCAGAGGAGAGAAGGTGAAGG + Intergenic
1183319426 22:37156053-37156075 GAGCAGAGGGAGGACGGGTAGGG - Intronic
1184109110 22:42384745-42384767 GAGCTGAGGGAGGACCCTGCAGG - Exonic
1184561899 22:45268516-45268538 GGGGTGAGGGAAGCGGGTGAGGG - Intergenic
1185324804 22:50220358-50220380 GAGCTGGGGGAGGACAGAGATGG + Exonic
1203280940 22_KI270734v1_random:130689-130711 GAGCTGAGGGGACACAGTGAGGG - Intergenic
949459678 3:4276955-4276977 GTTCTGAGGGAAGATGGGGATGG + Intronic
949482678 3:4509002-4509024 GAGGTGAGTGAAGACTTTGAAGG + Intronic
949784361 3:7724263-7724285 GAGTTGAGGGAAGAAATTGAGGG - Intronic
950646962 3:14383039-14383061 GAGGTGAGGGAAGACGGACCGGG + Intergenic
951486744 3:23221442-23221464 GAGCTGGGGGAAAATGGGGAAGG - Intronic
953447098 3:42977973-42977995 GAAATGAGGGAAGAGGGTGGAGG - Intronic
954143780 3:48623968-48623990 GAGCTGAGGTGAGAGGGTGGGGG - Intergenic
954692512 3:52403182-52403204 CAGCAGAGAGAAGACGGGGATGG - Exonic
955122555 3:56075309-56075331 GGGCAGAGGAAAGAGGGTGAGGG + Intronic
957739368 3:84243936-84243958 GAGCTGAGACAAGAGGGGGAAGG - Intergenic
958469150 3:94496404-94496426 GAGCAGAAGGAAGAGAGTGAAGG - Intergenic
958528958 3:95299631-95299653 GAGCTGGAGGAAGAGGGAGAGGG - Intergenic
958679750 3:97313067-97313089 TAGCTGAGGGGAGACAGGGAAGG - Intronic
960487977 3:118276520-118276542 GAGGGGAGGGAAGCAGGTGAGGG + Intergenic
960739210 3:120814536-120814558 GAGCAAAGGGAAGCTGGTGAAGG - Intergenic
961490083 3:127249906-127249928 GAGCTGATGGAAAAAGTTGAAGG + Intergenic
962593519 3:136915681-136915703 GAGCAGAAGGAAGAGAGTGAAGG + Intronic
963239036 3:142984550-142984572 GAGCTGGGGTAAGACACTGAGGG + Intronic
964148685 3:153497757-153497779 GAGCTGAGGGGAGAGGGAGGAGG - Intronic
964499022 3:157327641-157327663 GAGCTGTAGGAGGACGTTGAGGG + Intronic
966318744 3:178677520-178677542 GAGCTGAGGGCAGCAGGGGAAGG - Intronic
966945671 3:184775571-184775593 GAGGTCAGAGGAGACGGTGAGGG - Intergenic
967763890 3:193256300-193256322 GTGCTGAGGGCAGAAGGTGGTGG + Intronic
968875129 4:3262708-3262730 GAGCTGAGGGGAGCCTGTGGTGG - Intronic
968889330 4:3359274-3359296 GAGGAGAGGGAGGAGGGTGAGGG - Intronic
969480593 4:7445013-7445035 GAGCAGAGGGAGGGCGGGGAGGG + Intronic
969908397 4:10419551-10419573 GAGCAGAAGGAAGAGAGTGAGGG - Intergenic
970091047 4:12408532-12408554 CAGATGAGGGAACAAGGTGATGG - Intergenic
971339335 4:25753489-25753511 CAGCTGGGGGAAGACAGGGATGG - Intronic
974046642 4:56904214-56904236 AACATGAGGGAAGACTGTGATGG + Intergenic
974512179 4:62857476-62857498 GAGCAGAAGGAAGACAGTGAAGG - Intergenic
974953872 4:68615113-68615135 GGGCTGAGGGCAGAATGTGATGG + Intronic
976478328 4:85510566-85510588 GAGGGGAGGGAAGAAGGAGAAGG - Intronic
981259929 4:142707568-142707590 GAGCAGGAGGAAGAGGGTGAAGG - Intronic
983443731 4:167821604-167821626 GAGCAGGAGGAAGACAGTGAAGG - Intergenic
983512080 4:168619664-168619686 CAGCTGGAGGAAGACAGTGATGG + Intronic
985144832 4:186885838-186885860 GAGCTGATAGAAGGGGGTGAGGG - Intergenic
985781591 5:1874479-1874501 GAGTTGGAGGGAGACGGTGAGGG + Intergenic
985971302 5:3380810-3380832 GAGCTCATGGAAGAAAGTGACGG + Intergenic
987661469 5:20883851-20883873 AAGCTGAGGGAAGAAAGTGTAGG + Intergenic
987681895 5:21146621-21146643 GGGCTGAGGGGAGGTGGTGATGG - Intergenic
987862257 5:23503953-23503975 GAGCAGGAGGAAGAGGGTGAAGG - Intergenic
988762117 5:34321467-34321489 AAGCTGAGGGAAGAAAGTGTAGG - Intergenic
989764115 5:45059180-45059202 GAGCTGGGGGAATAAGGAGAGGG - Intergenic
992180130 5:74187916-74187938 AAGCTGAGAGAAGAGGGGGAGGG + Intergenic
992275254 5:75109843-75109865 AAGCTGAGAGAAGACTGAGAGGG + Intronic
992502775 5:77358176-77358198 GAACTGAGAGAAGAGGGTGGTGG + Intronic
992614499 5:78535567-78535589 GCGCTGGGGGCTGACGGTGAGGG - Intronic
995144347 5:108769560-108769582 GAGCTGAGGTGAGATAGTGATGG + Intronic
995331173 5:110948491-110948513 GAACTGGGAGAAGAAGGTGATGG + Intergenic
995435295 5:112128491-112128513 GAACTGAGAGAAGACCTTGAGGG + Intergenic
996165043 5:120213170-120213192 GAGTTGAGGTAGGACAGTGAAGG + Intergenic
996798353 5:127375614-127375636 GAGGGGAGGGAAGAAGGAGATGG - Intronic
997468371 5:134103020-134103042 GAGGGGAGGGAGGACAGTGAGGG - Intergenic
998312481 5:141149190-141149212 TTGCTGTGAGAAGACGGTGAAGG + Intronic
1001978870 5:176023870-176023892 GAGCTGGGGGAAGGAGGAGAAGG - Intronic
1001990531 5:176112551-176112573 GAGCTGTGGGAAGACTAGGAGGG - Intronic
1002226342 5:177725589-177725611 GAGCTGTGGGAAGACTAGGAGGG + Intronic
1002238545 5:177819896-177819918 GAGCTGGGGGAAGGAGGAGAAGG + Intergenic
1002267506 5:178045624-178045646 GAGCTGTGGGAAGACTAGGAGGG - Intronic
1002363225 5:178690030-178690052 AAACTGAGGGAGGACAGTGAAGG - Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002606304 5:180385003-180385025 GAGTGGAGGGAGGACGGTGGGGG + Intergenic
1002825420 6:768318-768340 AAGGTGGGGGAAGACGGAGAGGG - Intergenic
1003169500 6:3709939-3709961 CAGCGGAAGGAAGACCGTGAAGG + Intergenic
1006367343 6:33623151-33623173 AAGCTGAGGGAAGGAGGAGAGGG + Intronic
1007425367 6:41743003-41743025 GAGCTCAGAGAAGAAGGAGACGG - Intronic
1007484756 6:42173415-42173437 GAGCAGAAGGAAGAAGATGATGG - Exonic
1009030733 6:58055397-58055419 GATCTGGGGGCAGATGGTGAGGG + Intergenic
1009206587 6:60809858-60809880 GATCTGGGGGCAGATGGTGAGGG + Intergenic
1009608469 6:65905511-65905533 GAGCAGAAGAAAGACAGTGAGGG + Intergenic
1011622304 6:89254367-89254389 GAGGTGAGGGATGGTGGTGACGG - Intergenic
1011704343 6:89985936-89985958 CAGCTGTGGGAAGACAGTGTGGG + Intronic
1013050796 6:106533212-106533234 TAGCTGAGGGAAGAGGGGCAGGG + Intronic
1013327974 6:109067280-109067302 GAGCTCAGGGAAGTTGGTCATGG - Intronic
1015097628 6:129434496-129434518 GAGCTGAAGGAATAAGGAGAGGG + Intronic
1015437018 6:133201339-133201361 AAGCTGAGGGTAGAAGGTGTTGG - Intergenic
1017599817 6:156068311-156068333 GAGCTGAGGGAGGTGAGTGATGG + Intergenic
1017898469 6:158701421-158701443 GAGCCGTGGGAAGAGGGTCATGG + Intronic
1017956093 6:159179038-159179060 AAGCAGATGGCAGACGGTGAGGG - Intronic
1018330915 6:162727277-162727299 GAGGTGAGGGGCGAAGGTGAGGG + Exonic
1019350075 7:550421-550443 GAGCTGTGCTCAGACGGTGAGGG + Exonic
1020796751 7:12686633-12686655 GACGTGAGGGAAGGCGGTGCCGG + Intergenic
1021199328 7:17710652-17710674 GGGCTGAGGGAAGAAAGAGAAGG - Intergenic
1021382450 7:19984190-19984212 GAGGAGAGGGAAGAGGGGGAAGG - Intergenic
1021398965 7:20187485-20187507 AAGCTGTGGGAAGAGGGAGAAGG - Intronic
1023374593 7:39543459-39543481 GAGATGAGGCTAGACGATGATGG + Intergenic
1023866434 7:44240574-44240596 GAGCTGAGGGCAGACGCCGAGGG + Intronic
1026498402 7:70922652-70922674 CAGCTGAGGGAGGATGGTGGTGG - Intergenic
1026984440 7:74546094-74546116 GGGCGGAGGGATGAGGGTGAGGG - Intronic
1029435536 7:100562207-100562229 GAGCTGAGGTAAGACAGGGCGGG - Intronic
1031427308 7:121621357-121621379 GTGCAGAGGGAGGACGGAGATGG - Intergenic
1032432554 7:131873603-131873625 GTGATGAGGGGAGAGGGTGAGGG - Intergenic
1033091951 7:138394041-138394063 GAGCTGGGGGAAGCGGGTGGAGG - Intergenic
1034348531 7:150401933-150401955 GAGCAGAGGGGAGAAGGTGAAGG - Intronic
1034422880 7:150998544-150998566 GCGCTGCGGGAACACTGTGATGG - Exonic
1034539608 7:151748408-151748430 GAGCAGAGGGAAAACTGGGAAGG + Intronic
1034704410 7:153127710-153127732 GAAGGGAGGGAAGAAGGTGAGGG - Intergenic
1034798451 7:154035104-154035126 GAGCTTAGGGAAGACCCTTAAGG - Intronic
1035307489 7:157942681-157942703 GATCTGGGGAAAGACAGTGAGGG - Intronic
1035492660 7:159293758-159293780 GAGCTGAGGGTAGACTGGGAGGG + Intergenic
1035770576 8:2143530-2143552 GAGCAGAGGGAACCCAGTGAGGG + Intronic
1036484057 8:9163858-9163880 GAGCAGATGAAAGAGGGTGATGG + Intronic
1036662521 8:10717044-10717066 AAGCAGAGAGAAGTCGGTGAAGG - Intergenic
1037395410 8:18436340-18436362 CAGCTGTGTGAAGACTGTGATGG - Intergenic
1037725346 8:21478662-21478684 AAGGTGATGGAAGACGGGGAAGG + Intergenic
1039576976 8:38631539-38631561 GTGATGAGGGAAGACTTTGAGGG - Intergenic
1039765627 8:40625226-40625248 GAACGGAGGGAAGGCAGTGAGGG + Intronic
1040855145 8:51941404-51941426 GAGCTTAGGGAAGACGTCAAGGG - Intergenic
1041347881 8:56920435-56920457 ATGCTGAGAGAAGACGGAGAAGG + Intergenic
1042176515 8:66042671-66042693 GAGAGGAGGGAAGAGGGAGAAGG - Intronic
1042593772 8:70423888-70423910 GAGCTGAGGGAAGACTGGATTGG - Intergenic
1042854266 8:73249846-73249868 AAGCTGAGGGAAGATGGCAAGGG + Intronic
1044093273 8:88028951-88028973 GAGGTCAGGGAAGATGGGGAAGG + Intergenic
1044294566 8:90512291-90512313 GAGCTCAAAGAAGACTGTGATGG + Intergenic
1044728014 8:95208555-95208577 GAGCTCAGGGAAGAGGGAGGGGG + Intergenic
1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG + Intronic
1045688413 8:104735526-104735548 GTGCTCAGGGAAGACAGTGCAGG + Intronic
1046314563 8:112482155-112482177 GCACTGAGGGATGAAGGTGATGG - Intronic
1046789876 8:118309758-118309780 GAGCTAAGTGAAGATGGTAAGGG - Intronic
1047060253 8:121217509-121217531 GGGCTGAAAGAAGAAGGTGAAGG - Intergenic
1047933002 8:129749407-129749429 AAGTTCAGGGAAGAGGGTGAGGG - Intronic
1048274268 8:133054066-133054088 AAGCTCAGGGAAGACTTTGAAGG - Intronic
1048927533 8:139284214-139284236 GAGCTGGGTGGAGACAGTGAGGG - Intergenic
1049139117 8:140935541-140935563 GAGACAAGGGAAGACGGGGAGGG + Intronic
1049374399 8:142282085-142282107 GAGCTGAGGGCCCACGGTGCTGG + Intronic
1049746531 8:144265525-144265547 GGGCCGAGGGCAGACGGTGGGGG - Intronic
1050328702 9:4523086-4523108 GAGCTGTGGGAAGACAGGGATGG - Intronic
1051335740 9:16064394-16064416 GAGGTGTGGGGAGAGGGTGAGGG + Intergenic
1052048091 9:23818557-23818579 GAGCTGGGGGTAGACTGAGATGG + Intronic
1052930174 9:34049393-34049415 GAGCCGAGGGAAGGCCGGGACGG + Intergenic
1053611853 9:39722009-39722031 GAGCTGAGGGAAGATACTCAAGG + Intergenic
1054086403 9:60749146-60749168 GAGCTGAGGGAAGATACTCAAGG - Intergenic
1054241668 9:62620384-62620406 GAGCTGAGGGAAGATACTCAAGG - Intergenic
1054555794 9:66654907-66654929 GAGCTGAGGGAAGATACTCAAGG - Intergenic
1054785000 9:69201949-69201971 GAGCTGAGGGGAGAGGGAAATGG + Intronic
1055511033 9:76995785-76995807 GAGCAGAAGGAAGGGGGTGAGGG - Intergenic
1056381529 9:86061528-86061550 CAGCAGAGGGAAGACCGGGATGG + Intronic
1056499729 9:87197079-87197101 GAGCTGATGGAGGACGATGGAGG + Intergenic
1057075627 9:92136792-92136814 CATCTGAGGGAAGACAGTGAGGG - Intergenic
1057110890 9:92469758-92469780 GTGCTGAGGGGAGGCGGTGGCGG + Intronic
1057196015 9:93115890-93115912 GAGGTGAGGGAAGGAGTTGAGGG + Intergenic
1057751165 9:97794405-97794427 GAGTTGAAGGAAGAGGGAGAAGG + Intergenic
1057792266 9:98132144-98132166 CAGCTGAGGGGTGATGGTGAGGG + Intronic
1058152912 9:101481582-101481604 GGGCTCAGGGAAGACAGTAAAGG + Intronic
1059405705 9:114097441-114097463 GAGGGGAGGGAGGAGGGTGAGGG + Intronic
1060566887 9:124600858-124600880 GACCTGAAGGAAGAAGGAGAAGG + Intronic
1061392292 9:130324172-130324194 GGGCTGAGGGGAGACGGGAATGG - Intronic
1061714983 9:132513442-132513464 GTCCTCAGGGAAGACGGGGAGGG - Intronic
1062139109 9:134945672-134945694 GAGCGGAGGGCAGAGGGTGGAGG + Intergenic
1062362614 9:136194770-136194792 GAGAGGAGGGAAGAAGGGGAAGG - Intergenic
1062362634 9:136194822-136194844 GAGGGGAGGGAAGATGGAGAAGG - Intergenic
1062636845 9:137495958-137495980 GAGCTGAGGCGAGGCGGTGCTGG + Intronic
1062671245 9:137711015-137711037 GAGCTGCTGGGAGAAGGTGAGGG + Exonic
1186159016 X:6757054-6757076 GAGCAGAGAGAAGACGGAGGAGG + Intergenic
1186741224 X:12520353-12520375 GAGCTGAGGGAAACAGATGAAGG + Intronic
1186789680 X:12984805-12984827 CAGCTGAGGGAAAACTGTAAGGG + Intergenic
1187426481 X:19181836-19181858 GAGCAGAAGGGAGATGGTGAAGG + Intergenic
1187871271 X:23767050-23767072 GAGCTGAGGGCACTCGGTGCGGG - Intergenic
1188068051 X:25685878-25685900 TAGCTGCGGGAAGGCAGTGAAGG + Intergenic
1188864239 X:35294908-35294930 GAGCTGGGGGAAGAGGGAAATGG - Intergenic
1190035326 X:47018210-47018232 GAGGTGTGGGAAGAAGGAGATGG - Intronic
1192065841 X:67884087-67884109 GAGGTCAGGGAAGAGGGAGAGGG - Intergenic
1192579341 X:72267958-72267980 GAGGTGAGGCCAGACTGTGAGGG + Intronic
1192950467 X:76010961-76010983 GAGCTGTGGCAAGATGATGAGGG - Intergenic
1193762342 X:85482989-85483011 GGGCTGAGGGAAGAGTGTGATGG - Intergenic
1194490963 X:94549036-94549058 GAACTGAGTGAAGAAGCTGAAGG + Intergenic
1194546842 X:95246154-95246176 GAGCTGAGGGGAGGTGGGGATGG + Intergenic
1197229514 X:123988959-123988981 GGGCTGAGGGGAGAAGGTGGTGG - Intronic
1198791163 X:140347906-140347928 GAGCTAAGGAAAGAGGGGGAAGG - Intergenic