ID: 926109772

View in Genome Browser
Species Human (GRCh38)
Location 2:10174343-10174365
Sequence CTCTGCTGACAGCAGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926109772_926109784 14 Left 926109772 2:10174343-10174365 CCCTGGCCCTGCTGTCAGCAGAG 0: 1
1: 0
2: 6
3: 32
4: 340
Right 926109784 2:10174380-10174402 ATGCTGGCCCCTCACCAGCCGGG 0: 1
1: 0
2: 0
3: 33
4: 233
926109772_926109783 13 Left 926109772 2:10174343-10174365 CCCTGGCCCTGCTGTCAGCAGAG 0: 1
1: 0
2: 6
3: 32
4: 340
Right 926109783 2:10174379-10174401 CATGCTGGCCCCTCACCAGCCGG 0: 1
1: 1
2: 2
3: 26
4: 248
926109772_926109780 -2 Left 926109772 2:10174343-10174365 CCCTGGCCCTGCTGTCAGCAGAG 0: 1
1: 0
2: 6
3: 32
4: 340
Right 926109780 2:10174364-10174386 AGGGGAATGGCCATCCATGCTGG 0: 1
1: 0
2: 0
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926109772 Original CRISPR CTCTGCTGACAGCAGGGCCA GGG (reversed) Intronic
900582014 1:3414099-3414121 CTCTGCTGTGAGCAGGTCCAGGG + Intronic
901206618 1:7501205-7501227 CTCTGCTGACTGGAAGGGCAGGG - Intronic
902041133 1:13493277-13493299 AACTGCTGTCACCAGGGCCAGGG + Intronic
902760183 1:18575809-18575831 CTGAGCTGACAGCTGGTCCAGGG + Intergenic
902782114 1:18711579-18711601 CTCTGCAGAAAGCAGGGGAAAGG + Intronic
903064892 1:20693886-20693908 GTCTTCTGACACCAGGGCAAGGG + Intronic
903138960 1:21327130-21327152 CTCTGCAGGCAGCAGGGCATGGG + Intronic
903651644 1:24926161-24926183 CTCTGCTGACTGCGGGGCAGTGG - Intronic
904042446 1:27592581-27592603 CTCAGCTAAGAGCAGGGCCTGGG - Intronic
904185692 1:28702511-28702533 CGCTGCTGTCACCATGGCCACGG + Exonic
904321925 1:29703370-29703392 CTCTGCTGACTGCCGGGGCCTGG + Intergenic
904799261 1:33081370-33081392 CTCTGCTGACAGGAGGCAGAAGG - Exonic
904804265 1:33119916-33119938 CTCAGCTGAGGGCAGGGGCAGGG - Intronic
905909678 1:41645232-41645254 CCCTGCAGCCAGCAGGGCCTGGG - Intronic
906713555 1:47950932-47950954 CTCTACTGGAAGCAGGCCCAAGG - Intronic
908693584 1:66810978-66811000 CTTTGATGACAGAAGGGCCTTGG - Intergenic
908714103 1:67052375-67052397 TTCTGCTGACAATAGAGCCATGG - Intronic
909043927 1:70686563-70686585 CCCTGCTGGCTGCTGGGCCAGGG - Intergenic
915802437 1:158808632-158808654 CTCAGCTGCCAGTAGTGCCAAGG - Intergenic
918302684 1:183218500-183218522 CTCTGCTGTTTGTAGGGCCACGG - Intronic
919664214 1:200276673-200276695 CACTGCTAACAGCATGGGCAGGG + Intergenic
919986840 1:202681443-202681465 CCCTGCTGCCAGCGGGGCCATGG - Intronic
920054454 1:203182195-203182217 CTCTCCTGAGAGCAGAGCCATGG - Intronic
920782973 1:209012420-209012442 CATTCCTGACAGCAGGGCCTTGG - Intergenic
922050563 1:221986329-221986351 CACTGCTCACAGCAGAGGCAAGG - Intergenic
922875512 1:228937090-228937112 CTGGGCTGCCTGCAGGGCCAAGG - Intergenic
1062828102 10:587039-587061 CCCTGCTGACAGCGTGGCGAGGG + Intronic
1062828147 10:587219-587241 CCCTGCTGACAGCGTGGCGAGGG + Intronic
1062863481 10:829022-829044 GGCTTCTGACAGCAAGGCCAAGG - Intronic
1063974731 10:11406126-11406148 CACTGAGGACAGCAGGGTCATGG + Intergenic
1066592596 10:37011731-37011753 CTCTGCTGACATCCAGGCCAAGG + Intergenic
1067682406 10:48449397-48449419 CTCTGCTGACAGCTGTTCCCTGG - Intronic
1068733482 10:60386096-60386118 CCCTGCTCCCAGCAGGGCCCTGG - Intronic
1070538125 10:77394465-77394487 CTGAGCTGCCAGCAGGGCCTGGG + Intronic
1071527769 10:86367772-86367794 CTCCGCGGACAACAGGGCCCGGG - Intergenic
1072478518 10:95786609-95786631 CTCTGCTGACAGTGGGCACAGGG - Intronic
1073464471 10:103686292-103686314 CTCTCCTGACAACAGCCCCAGGG + Intronic
1073887261 10:108054236-108054258 CTCTTCTCACAGCTGGGCCTGGG - Intergenic
1076364078 10:129910916-129910938 CACAGGTGCCAGCAGGGCCATGG + Intronic
1076530076 10:131138328-131138350 CTCTGCTGACTGCAAAGACAAGG + Intronic
1076671014 10:132121146-132121168 CTCTGCTGACACTTGGGGCAGGG - Intronic
1077303998 11:1859765-1859787 CACTGCTGACAGCAGGAGAATGG - Intronic
1078352726 11:10607818-10607840 CTCCGCTGACTTCATGGCCATGG - Intronic
1081435408 11:43022252-43022274 CCATGCTGAGAGCAAGGCCAAGG + Intergenic
1081614853 11:44584761-44584783 CCCTGCTGACACCAGGACCAGGG - Intronic
1081695329 11:45105590-45105612 CCGTGGTGACAGCAGAGCCATGG + Intronic
1081802914 11:45871931-45871953 CACTGCTGAAAGCAAGGCCGAGG + Intronic
1082239710 11:49857103-49857125 CCCTGCTGTCAGCAGTGACAAGG + Intergenic
1082242448 11:49887248-49887270 CCCTGCTGTCAGCAGTGACAAGG - Intergenic
1083594854 11:63914329-63914351 CACTGCTGACACAGGGGCCAGGG + Exonic
1083607632 11:63988266-63988288 CACTGCAGGCAGCTGGGCCAGGG - Intronic
1083763193 11:64829806-64829828 CTCTGCTACCAGCTGGGCCCGGG - Exonic
1084270206 11:68025322-68025344 CTCTGATCACAGCTGGGTCAGGG - Intronic
1084559430 11:69894444-69894466 CTCTGCTGACGGCAGCTCCGAGG - Intergenic
1085712369 11:78841676-78841698 CACAGCTGACAGCACGTCCAGGG + Intronic
1085895757 11:80637667-80637689 CTCTGCTGACATCCAGGCCAAGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089630291 11:119780042-119780064 CTCTGATGAGAGCAGGGGCTTGG + Intergenic
1089735813 11:120549633-120549655 CTCAGCTCACAGCAGGGGCCTGG + Intronic
1090069074 11:123527759-123527781 GTGTGCTGACAGCAGGGGCGCGG - Intronic
1090471986 11:126989025-126989047 GTCGGGGGACAGCAGGGCCAAGG + Intronic
1090633481 11:128671056-128671078 CTCTCCTGGCACAAGGGCCAGGG - Intergenic
1091601225 12:1918709-1918731 CTCTCCTGACAGCAGGGAGGGGG + Exonic
1091833328 12:3566292-3566314 CTCAACTGAGAGCAGGGCCCAGG - Intronic
1094175173 12:27533957-27533979 CTGACCTGACAGCAGGACCAGGG - Intronic
1096603992 12:52752063-52752085 CTCAGGTGGCAGCAGAGCCAAGG + Intergenic
1096692461 12:53329373-53329395 CGCTGCCGTCAGCATGGCCAGGG + Exonic
1101902289 12:108799701-108799723 CTCTTCAGACAGGAGGGCCAGGG + Intronic
1102481878 12:113229464-113229486 CTCCTCAGACAGCAGGGACAGGG - Intronic
1102492376 12:113297073-113297095 CTCTGGTGTGAGCAGAGCCAGGG - Exonic
1103360945 12:120353256-120353278 CTCTGCTGCCAGCATGCCCCTGG - Intronic
1104767702 12:131341027-131341049 GTCTGCTCAGAGCAGGGCCCTGG - Intergenic
1107147083 13:37070532-37070554 CTCTGCTGGTAGCTGGACCATGG + Intergenic
1107409779 13:40147911-40147933 CTGTGCTGATTCCAGGGCCATGG + Intergenic
1107449888 13:40498691-40498713 CTCTCCTGCCTGCAGGGGCATGG - Intergenic
1107721407 13:43252440-43252462 CTGTGCAGACATCAGAGCCAGGG - Intronic
1108116687 13:47136345-47136367 ATCTGCTAACAGCAGTGCGAAGG - Intergenic
1113343889 13:109454516-109454538 CTTGGCTGAAAGAAGGGCCATGG + Intergenic
1113763984 13:112869437-112869459 CTCGGCTCACAGCAGGGAGAGGG + Intronic
1115017410 14:28633840-28633862 CCCTGCTGACAGCTGGACCAGGG - Intergenic
1115502763 14:34064021-34064043 CTCTGCTCAGGCCAGGGCCAGGG - Intronic
1115645416 14:35365791-35365813 CTCAGCTGACAGCAGGTCTTTGG - Intergenic
1119265055 14:73259520-73259542 CTCTGCTGACAGGGGGCCCCAGG - Exonic
1119566958 14:75636938-75636960 CTCTGCTGAAAGCAACGTCATGG - Intronic
1120225247 14:81783917-81783939 ATCTGCTGAGAGCAGAGCCCAGG - Intergenic
1121249276 14:92487789-92487811 GTCAGGTGTCAGCAGGGCCATGG + Intronic
1121630265 14:95416687-95416709 CTCTGGAGACAGCAGGTCTATGG - Intronic
1121783940 14:96640506-96640528 CTCTCCTGAAAGCTGGGCCATGG - Intergenic
1121874695 14:97440612-97440634 CTATGATGACTGCAAGGCCACGG - Intergenic
1121945849 14:98121056-98121078 CACTGCTGACAGATGAGCCAAGG - Intergenic
1122199822 14:100115628-100115650 CTCTGCTAAGCCCAGGGCCAGGG + Intronic
1122539907 14:102492339-102492361 CACTCCTGACACCAGGGCCTGGG - Intronic
1122867008 14:104610906-104610928 CTCAGCTGACCCCAGGGTCAAGG + Intergenic
1122959833 14:105089396-105089418 CTCAGGTGACAGCAGAGCCCAGG + Intergenic
1124435453 15:29645177-29645199 CTCTGCAGATTGGAGGGCCATGG - Intergenic
1126141908 15:45445878-45445900 CTCTGCTGATTACAGGGCCATGG - Intronic
1128186087 15:65644552-65644574 CACTACTGACAGCAGGGAGAGGG - Intronic
1128712451 15:69882485-69882507 CTCAGCTCACAGCAAGGCTAGGG - Intergenic
1128779839 15:70352106-70352128 CTCTCCTGACATCCAGGCCAGGG + Intergenic
1129552224 15:76465288-76465310 CTCACCTGACAGAAGGGGCAAGG + Intronic
1129663376 15:77565751-77565773 CTCTGCGGGCAGCGGGGTCAGGG - Intergenic
1129686343 15:77688180-77688202 CTCTGAAGACAGCAGGGCCAGGG + Intronic
1129711787 15:77824111-77824133 CTCTGCTCACTGCAGGGCCAAGG - Intergenic
1131391097 15:92049459-92049481 CCATGGTGACAGCAGGGCAATGG - Intronic
1132011590 15:98281294-98281316 ATCTGCAGACTGAAGGGCCAAGG - Intergenic
1132546627 16:536184-536206 CACTGAGGACAGCAGGGACAGGG - Intronic
1132636018 16:947116-947138 CTCTTCTGTCAGCCGGGTCATGG - Intronic
1132895672 16:2228340-2228362 GCCTGCTGTCAGCAGGGCCTGGG - Intronic
1133384457 16:5357663-5357685 CTCTGCTGAAACCAGAGCCTGGG - Intergenic
1134914635 16:18059630-18059652 CACTGCTGACAGTGGGGACAAGG - Intergenic
1135112289 16:19699627-19699649 CTGTGCAGACACCAGGACCATGG + Exonic
1136516642 16:30772529-30772551 GCCTGCTGACCCCAGGGCCAGGG - Intronic
1137581951 16:49639034-49639056 CTCTGCAGACAGGAAGGCCCTGG - Intronic
1138657421 16:58499415-58499437 CTGGGCAGATAGCAGGGCCAGGG - Intronic
1139338580 16:66251400-66251422 TTCTGCAGTCAGAAGGGCCAGGG + Intergenic
1139475559 16:67200916-67200938 CAAGGCTGTCAGCAGGGCCATGG - Exonic
1139492635 16:67294613-67294635 ATGTGGTGACAGAAGGGCCAGGG - Exonic
1139967646 16:70754591-70754613 CCCTGCCCACGGCAGGGCCAGGG + Intronic
1140469508 16:75206328-75206350 CTCTGCGGAGAGGAGAGCCAGGG - Intronic
1141005483 16:80348018-80348040 CTGTGGTGGCAGCAGGCCCAGGG + Intergenic
1141600867 16:85125517-85125539 TTCAGCAGACAGAAGGGCCAGGG + Intergenic
1141880356 16:86854441-86854463 CTCTGTTGAAAGCCAGGCCAGGG - Intergenic
1142302845 16:89268729-89268751 CTCAGCTGCCAGCAGGGCCAAGG + Intronic
1142772230 17:2106761-2106783 CTTTCCTGTCAGCAGGGACACGG - Intronic
1143976930 17:10837073-10837095 CGCTGCTGTCACCATGGCCATGG + Intronic
1146013826 17:29216881-29216903 CTTTGCTGACAGCAGAAACAAGG + Intergenic
1146770297 17:35562579-35562601 TTCTGGAGACAGCAGGTCCATGG + Intergenic
1148738100 17:49876029-49876051 CACTCCTGAGAGCTGGGCCAGGG - Intergenic
1149435458 17:56629877-56629899 CTCTGCAGCCAGCAAGGCAAGGG + Intergenic
1149505021 17:57187064-57187086 CTCTGTTGAGAGAAGGGGCAAGG - Intergenic
1149884707 17:60328343-60328365 CTCTGCTGAGAGCTGGACCGAGG + Intronic
1150323279 17:64234545-64234567 CTCAGCTGTCAGCTGCGCCATGG - Intronic
1150812621 17:68368613-68368635 CTCAGCTACCAGCAGCGCCACGG + Exonic
1150978304 17:70113342-70113364 CTGTACTGACAGCAGGGCTGTGG + Intronic
1151263079 17:72931944-72931966 CTGTGGTGAGAGCAGGGCCTGGG - Intronic
1152095561 17:78269808-78269830 AGGTGCTGGCAGCAGGGCCACGG - Intergenic
1152217998 17:79045576-79045598 CTCTGCTGAAAGTTGTGCCAGGG + Intronic
1152382762 17:79950670-79950692 CTCTTCTGAAAGGAGGGCAAGGG + Intronic
1152605201 17:81286106-81286128 CCTTGGTGACAGCAGGGCCCTGG - Intronic
1152618242 17:81347650-81347672 CTTTGGTGACAACAGTGCCAGGG - Intergenic
1152656781 17:81523563-81523585 CTCACCTGGCTGCAGGGCCAAGG + Intronic
1152751155 17:82063042-82063064 CTCCGCTGTCTGCAGGGCCCTGG - Intronic
1152769053 17:82156503-82156525 CTGTGCTGCCAGCTGGCCCAAGG + Intronic
1153041041 18:812735-812757 CACTACTGAGAGCTGGGCCAAGG - Intergenic
1153650405 18:7234383-7234405 CTCTGCCCACAGCAAGGTCATGG - Intergenic
1155821862 18:30387483-30387505 TTCTGCTGACAGCAGGGAAGGGG - Intergenic
1156049539 18:32915604-32915626 CTAGGATGAGAGCAGGGCCATGG + Intergenic
1157553570 18:48597956-48597978 CTCTGCCTGCAGCAGGGCCTAGG + Intronic
1157808987 18:50679796-50679818 CTCTGCTCACAGTGGGGCCCAGG - Intronic
1157813150 18:50711961-50711983 CTCAGCTGACAGCAGGGCCCTGG + Intronic
1157842065 18:50968044-50968066 CCCCGCGGACAGCTGGGCCAGGG + Exonic
1158629054 18:59096226-59096248 CTCTGCAGACTGCAAGGCCAAGG + Intergenic
1159637569 18:70824130-70824152 CTGTGCTGAAAGCAGGGGCCAGG + Intergenic
1160269019 18:77367052-77367074 CTGTGCTGCCCGCAGGGCCTAGG - Intergenic
1160565252 18:79783041-79783063 CTGTGCTGGCACCAGGGACACGG - Intergenic
1160915307 19:1493488-1493510 CTCTGCAGATAGCAGCCCCAGGG + Intronic
1160919678 19:1513649-1513671 CCCTGGTGACAGCAGCGCCCGGG - Intergenic
1160940243 19:1617478-1617500 CTCTGCATTCAGCAGGGCCTGGG + Intronic
1161010092 19:1955729-1955751 CTCCGGTGACAGCAGTGGCACGG - Intronic
1161044814 19:2129164-2129186 CTGTGGGGACAGCAGGGCCTCGG + Intronic
1161320094 19:3637130-3637152 CTGTGCAGCCAGCGGGGCCACGG + Intronic
1161321121 19:3641989-3642011 CTGTGGTGCCAGCAGGGCCTGGG + Intronic
1162489882 19:10985802-10985824 CCCTGATGACAGCAAGGCCTTGG - Intronic
1163034660 19:14563779-14563801 CTCTGCAGAGAGGCGGGCCAGGG - Exonic
1163695580 19:18761752-18761774 CTTTGGTGCCAGCAGGGCCAGGG + Intronic
1164042490 19:21505940-21505962 CTGTGCTGACAGCCGGGCCCCGG + Intronic
1164049117 19:21568914-21568936 CTGCGCTGACAGCAGGACCCTGG - Intergenic
1164082754 19:21874914-21874936 GTCTCCTGAGTGCAGGGCCAAGG - Intergenic
1164190724 19:22914958-22914980 GTCTCCTGAGTGCAGGGCCAAGG - Intergenic
1164293668 19:23889857-23889879 CTCTCCTGAAAGCAGGGCACAGG - Intergenic
1164313336 19:24065307-24065329 CTCTCCTGAAAGCAGGGCATAGG - Intronic
1164961919 19:32439885-32439907 CACTGCTGGCAGCATGTCCAGGG - Exonic
1165921086 19:39298220-39298242 CTCAGCCCACAGCAGGGCCCAGG + Exonic
1166541165 19:43607114-43607136 CTCTTCTGCCAGCAGGACCCAGG + Intronic
1168232932 19:55044846-55044868 CTCTGCTGCCAGCAGGGGAGAGG - Exonic
1168485785 19:56760880-56760902 CTCAACTGACAGCAGGCCCCAGG + Intergenic
925543283 2:4989676-4989698 CTTTCCTGACAGCAGTGACAGGG + Intergenic
925620807 2:5790972-5790994 CTGTGCTAATTGCAGGGCCATGG + Intergenic
925841487 2:7996025-7996047 CCCTGCTGACAGCAGGAGCTGGG - Intergenic
926109772 2:10174343-10174365 CTCTGCTGACAGCAGGGCCAGGG - Intronic
926144525 2:10388566-10388588 CTCTGCTGCCCCCAGGTCCAGGG + Intronic
926706900 2:15843540-15843562 CGCAGATGCCAGCAGGGCCACGG + Intergenic
927313603 2:21656986-21657008 CTCTGCTGACATCAAGGAAAAGG + Intergenic
927855319 2:26524025-26524047 CTCTGCAGCCAGCAGTGCCCTGG + Intronic
927865437 2:26584758-26584780 CTCTGTGCACACCAGGGCCACGG - Intronic
930402154 2:50904015-50904037 CTCTGCTGGAATCAGGGCAAGGG + Intronic
932245142 2:70190642-70190664 CTCCGTTGACTGCAGGGCCCCGG - Intronic
932656335 2:73613937-73613959 CTCAGCTGACTGCAGGGACAGGG - Intergenic
932932304 2:76056641-76056663 CTCTGCTCAGAGCAGCGCTATGG - Intergenic
933290577 2:80433749-80433771 TTCTGGTGACAGGAGGACCATGG - Intronic
934219669 2:90070615-90070637 CTCTTTTGACAGAAGAGCCATGG + Intergenic
934937797 2:98477838-98477860 CTCTTCCCACAGCAGGGCCCAGG - Intronic
935223578 2:101035175-101035197 CCCTGCTGACAAAAGCGCCATGG + Intronic
935558978 2:104541433-104541455 CTCTGCTGGCAGGAGGGCTGGGG + Intergenic
936055291 2:109257884-109257906 CTTCTCTGACACCAGGGCCAGGG + Intronic
936059025 2:109282548-109282570 CTCAGCTGACTGCAGGGCCTGGG + Intronic
936283326 2:111161489-111161511 CTCTGCAGACAGCAGGTCTCAGG + Intronic
936435551 2:112502168-112502190 ATGAGCTGACAGCAAGGCCAAGG - Intronic
936518577 2:113197971-113197993 CTCAGGTGTCAGCAGGGTCAGGG - Intronic
938288915 2:130139194-130139216 CCCTGCAGACAGCGGGGCCTGGG + Intergenic
938306002 2:130254249-130254271 CCCTGCGGACAGCAGGGGCTGGG + Intergenic
938448150 2:131393523-131393545 CCCTGCGGACAGCAGGGGCTGGG - Intergenic
938467619 2:131533737-131533759 CCCTGCAGACAGCAGGGCCTGGG - Intergenic
939808034 2:146798356-146798378 CTCTGCTAACACCAGTGTCAAGG - Intergenic
940029197 2:149242591-149242613 ATCTGGTGACAACAGGGGCAGGG - Intergenic
943226888 2:185188890-185188912 CCCTCCTGGCAGCAGGGGCATGG - Intergenic
943228353 2:185210253-185210275 CTCTGCTGACAGTATGCCCAAGG - Intergenic
944456788 2:199903283-199903305 TTCAGCTGACAGAATGGCCAGGG - Intergenic
947269515 2:228318402-228318424 CTCTGCTGGCCGCAGGGACAGGG - Intergenic
947671868 2:231942017-231942039 CTCTGCGGCCAGCAGAGCTAGGG + Intergenic
947740805 2:232484000-232484022 CTCAGCTGCCAGCAAAGCCAAGG - Exonic
1169066081 20:2694634-2694656 CTCTGCTGACAGCTGGGACAGGG + Intronic
1169871068 20:10248938-10248960 CTCTGGTCACAGCAGTGTCAAGG + Intronic
1171032574 20:21690906-21690928 CTCTGCTCCCAGCAGGCCCATGG - Intergenic
1172063693 20:32204976-32204998 CTCTTCTGATAGCAAGTCCAAGG - Intronic
1172838611 20:37888576-37888598 CTCCACTGACAGTAGGGACAAGG - Intergenic
1174414417 20:50357633-50357655 CTCTGCTGTCTGCAGGGCCTGGG - Intergenic
1174588094 20:51624268-51624290 CTGTCCTTTCAGCAGGGCCATGG - Intronic
1175808958 20:61847219-61847241 CTCTGCACACAGCACGGCTAGGG + Intronic
1176010363 20:62890211-62890233 CTCTGGGGACTGCATGGCCACGG + Intronic
1176210855 20:63920590-63920612 TTCTGCTGGCAGCAGCCCCAGGG - Intronic
1176457960 21:6929298-6929320 CTGAGCAGGCAGCAGGGCCAGGG - Intergenic
1176836132 21:13794382-13794404 CTGAGCAGGCAGCAGGGCCAGGG - Intergenic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179149516 21:38797772-38797794 CTCTGCTTATTGCAGGGCAAGGG + Intergenic
1179732174 21:43374094-43374116 CTCTGGGCACAGGAGGGCCAAGG - Intergenic
1179991263 21:44949314-44949336 CACTCCTGACAGCCGGGCCCAGG - Intronic
1180081315 21:45489025-45489047 CTCTGCTGCGTGCGGGGCCAAGG + Intronic
1180740323 22:18049072-18049094 CTCTGCAGAGAGCAGAGCAAAGG + Intergenic
1181528883 22:23504815-23504837 CTGTGCTGTGTGCAGGGCCAGGG + Intergenic
1181633023 22:24161361-24161383 CCCTGGTGACACCAGGGCCCAGG + Intronic
1182852342 22:33486067-33486089 CTTTGCTGGCAGAAGTGCCAGGG - Intronic
1183035568 22:35138611-35138633 CTTTGCTGACAGCATCACCATGG + Intergenic
1183307750 22:37091907-37091929 CACTGCAGTCAGCATGGCCAGGG - Intronic
1183571444 22:38656408-38656430 CTATGGTGACAGCCGGGCCGGGG + Intronic
1183674420 22:39291673-39291695 CGCTGCAGACAGGGGGGCCATGG - Intergenic
1183687333 22:39368663-39368685 CTCTGCTGTCCCCAGGGCCCAGG + Intronic
1184224795 22:43123351-43123373 CTGTGCTGACAGCAGGTGCCTGG + Intronic
1184231950 22:43163098-43163120 CTCTGCTGACCCCTGGGCCAAGG - Exonic
1184734448 22:46389990-46390012 CACTGCTGACAGCTAGACCATGG + Intronic
1184749824 22:46478937-46478959 CACTGCTCACCGCAGGCCCAGGG + Intronic
950404506 3:12796499-12796521 CTGCGCTGTCAGCAGGGCAAGGG + Intronic
950426664 3:12928094-12928116 CTCAGCTGCCAGCTGGGCCCTGG - Intronic
950455127 3:13088333-13088355 CTCTGCTCACTGCAGGGCTGAGG + Intergenic
950677142 3:14561159-14561181 TTCTGCAGACAGCAGCCCCAGGG + Intergenic
953407191 3:42665286-42665308 CTCTGCTGCCAGCAGGCCCAGGG + Exonic
953446460 3:42972964-42972986 TTCTGCTCACAGCAGGGGGAAGG + Intronic
953793428 3:45965663-45965685 CTCTCCTGACAGCAGATACAGGG - Intronic
954400847 3:50318784-50318806 CTTTCCTGAGAGCAGGGCCGGGG + Intronic
954869917 3:53760031-53760053 GTCTGCTGATAGATGGGCCAGGG + Intronic
961640112 3:128359917-128359939 CTCTCCTGACAGCCTTGCCAGGG + Intronic
961828960 3:129613484-129613506 CTTTGCTGACAGCAGGGGCTGGG + Intergenic
963918642 3:150884792-150884814 CTCTGCTGACAGGGTGGTCAGGG - Intronic
965310031 3:167116202-167116224 CACTCCTGACAGCCAGGCCAGGG - Intergenic
967268708 3:187715090-187715112 GTCTCAGGACAGCAGGGCCATGG - Intronic
969087507 4:4667484-4667506 CTCTTCTGCCAGCTTGGCCAAGG - Intergenic
969173579 4:5383129-5383151 CACGGCTGACTGCAGGGCCCAGG - Intronic
969178832 4:5421725-5421747 CCCTTTTGAAAGCAGGGCCATGG - Intronic
969620256 4:8275333-8275355 CCCTGCCGAAAGCTGGGCCATGG + Intronic
972772051 4:42206555-42206577 GTCTGCAGACAGCAGGAGCATGG + Intergenic
973792466 4:54391134-54391156 CAGTGTTCACAGCAGGGCCATGG - Intergenic
976609373 4:87013876-87013898 CTCTGCTGTCTGTAAGGCCAGGG + Intronic
978577204 4:110199099-110199121 CTCTGCCGTCCGCAGGGCCTGGG - Intronic
979600726 4:122584032-122584054 TTCTGCTGACGGCAGGGGTATGG - Intergenic
980829660 4:138114619-138114641 CTCTGCTGACAGCAGAGATGTGG - Intergenic
981316130 4:143341483-143341505 CAATGCTGACAGCTGGGCTATGG - Intronic
982097702 4:151937859-151937881 TCCTCCTGACAGCATGGCCATGG - Intergenic
983122573 4:163905557-163905579 TTCTGCTGAGAGCAGGGGAAGGG + Intronic
984636780 4:182119453-182119475 CTCTGCTGGAACCAGTGCCAGGG - Intergenic
984892168 4:184503843-184503865 ATCTCCTGACTCCAGGGCCAAGG - Intergenic
985729911 5:1541291-1541313 CTGTGCACACAGCAGGGCCCAGG - Intergenic
985760317 5:1745560-1745582 CTCTGCAGACAGCAGGCACTAGG + Intergenic
985966557 5:3342629-3342651 CTCTGATGACAGCGGTGCCTCGG + Intergenic
986613864 5:9597029-9597051 CTCCGAAGACAGCAGGGGCATGG + Intergenic
988914595 5:35879898-35879920 CTCTGCAGACTGCAGGGACTAGG - Intergenic
989137155 5:38167037-38167059 CTCAGAGGGCAGCAGGGCCATGG - Intergenic
997635005 5:135398641-135398663 CTCTGCTCACAGCAGCTCCCGGG + Intronic
998352286 5:141509320-141509342 CTCTACTGCCAGCTGGGCCTGGG + Intronic
999363018 5:151001914-151001936 CTCTGCAGAGAGCAGGCACAAGG + Intergenic
1000908556 5:166993478-166993500 CTCTGCTGACAGTTGGGTCCTGG - Intergenic
1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG + Intronic
1002000403 5:176193698-176193720 CTGTGCTGACAGCGGGTGCAGGG - Intergenic
1002096629 5:176835083-176835105 CTCTGCAGGCAGCGAGGCCAGGG + Intronic
1002158531 5:177301624-177301646 CTCTGCTGACATGAGGACCTGGG + Exonic
1002529849 5:179837804-179837826 CTCTGCAGACTGCAGTGCCGGGG - Exonic
1002660960 5:180790971-180790993 CTCTCCTGACAGCTGGGCATGGG + Exonic
1002924640 6:1598242-1598264 CTCAGATGCCTGCAGGGCCAAGG - Intergenic
1003500654 6:6700268-6700290 CTCCTCTGAAAGCTGGGCCAAGG + Intergenic
1003983572 6:11412902-11412924 GTCTGATGACAGGAGGGGCATGG + Intergenic
1004299411 6:14443781-14443803 CTCTGGTGACTGGAGGGCCATGG - Intergenic
1004319507 6:14621502-14621524 CTCTGCTCACAGCAGAGGAAGGG - Intergenic
1006987005 6:38182549-38182571 CTGTGGGGAGAGCAGGGCCATGG - Intronic
1007406944 6:41640677-41640699 CTCTGCTGGCAGGACAGCCAGGG + Intronic
1007708358 6:43805370-43805392 GTCTGCTGTCTGCAGGGCCCTGG - Intergenic
1008113567 6:47520501-47520523 CTCCGCTGACAGCAGGGGGAAGG + Intronic
1008678512 6:53846431-53846453 GCGTGCTGACAGCAGAGCCAGGG - Intronic
1009381132 6:63031507-63031529 ATCCGCTGACAGCTGGACCATGG - Intergenic
1011104729 6:83766989-83767011 GACTGCTGACATCAGGGCCCAGG - Intergenic
1011216062 6:85006933-85006955 CTCTGGTGACTCCAGGGACAGGG + Intergenic
1011917563 6:92526907-92526929 CTTTGCTGAGAGCAGGGCATTGG - Intergenic
1012832843 6:104227593-104227615 CTCTGCTTAAAGCAGGTCAATGG + Intergenic
1013676659 6:112471381-112471403 CTCTGCTGGCAGCAGCTCCAGGG - Intergenic
1013690548 6:112637153-112637175 ATCTGCTGACAGAAGTTCCAAGG - Intergenic
1013826091 6:114213293-114213315 CTCTGCTGCCAGTAGAGCCTGGG + Intronic
1015131645 6:129817888-129817910 CTCTGCTCACAGCAGCACCTAGG + Intergenic
1015953349 6:138575865-138575887 CCCTCCTGGCAGCAGGGCCAAGG + Intronic
1018280400 6:162179422-162179444 CTCTGCAGTCAGGAGAGCCATGG - Intronic
1018280827 6:162183683-162183705 CACTGCTGACTGCATGACCAAGG + Intronic
1018930896 6:168239645-168239667 CTCTGCTGACCACAGGCCCCTGG - Intergenic
1019049776 6:169174016-169174038 CTCTGATGACTGCAGGGACGTGG - Intergenic
1019088490 6:169503108-169503130 CTCTGCTCACAGCATGGCAGAGG - Intronic
1019211243 6:170407151-170407173 CCCTGCTGCCACCATGGCCACGG + Intergenic
1019224236 6:170496933-170496955 ATCTTCTGACAACAGGGCCCTGG + Intergenic
1019309353 7:352711-352733 CTCAGCTGAGTACAGGGCCAAGG - Intergenic
1019488721 7:1301258-1301280 AGCTGGTGGCAGCAGGGCCAAGG + Intergenic
1022509866 7:30928289-30928311 CGGTGCTGGGAGCAGGGCCAGGG - Intergenic
1022535125 7:31093757-31093779 CTCTGATGAAGGCAGGACCATGG - Intronic
1023900273 7:44471508-44471530 CTCTGCTGACAGAATGAGCAGGG + Intronic
1025256064 7:57384582-57384604 CTCTGCTGTCTGCAGGGCCTGGG + Intergenic
1025785438 7:64639553-64639575 GTCTTCTGAGGGCAGGGCCAAGG - Intergenic
1026020008 7:66698941-66698963 CTCCGGTGACTGCAGGGCCAAGG + Intronic
1026148061 7:67765238-67765260 GTCTGATAACAGCAGTGCCATGG + Intergenic
1026623782 7:71974743-71974765 TCCAACTGACAGCAGGGCCAGGG - Intronic
1026881474 7:73909208-73909230 CTCTGGTGGCAGCAGGGTCTTGG + Intergenic
1029382489 7:100222772-100222794 CTCTGGTGAGTGCAGGGCCTGGG + Intronic
1029587791 7:101486522-101486544 AGCTGCTGACGGCAGGGCCAGGG - Intronic
1029611989 7:101631321-101631343 CTCAACTGACCACAGGGCCAGGG + Intergenic
1032410114 7:131688597-131688619 GTCTGAGGACAGCAGGGCCTGGG - Intergenic
1032677088 7:134141069-134141091 CACTGCTGACAACAGGAGCAGGG + Intronic
1033270804 7:139931356-139931378 CTCTGCAGAAAGGAGGTCCAGGG - Intronic
1033540143 7:142349103-142349125 CTCTCCTGACAGCAAGGCTCTGG + Intergenic
1034256272 7:149726151-149726173 CTCTGCTCCCAGCACGGGCATGG - Intronic
1035456554 7:159013163-159013185 CTCTGCTGGGAGGAGGGCAACGG + Intergenic
1036561790 8:9904910-9904932 CTCTGCTGCCTGGAGGGCTAAGG - Intergenic
1036815929 8:11902791-11902813 CTCTGGTGACTGCAAGGCCTGGG - Intergenic
1038450484 8:27636132-27636154 CTCTGCAGTCAGCTGGCCCAGGG + Intronic
1038695766 8:29804995-29805017 TTCTGCTCCCAGCAGGGCCAAGG + Intergenic
1039972770 8:42334455-42334477 GTCTGCTCACAGCAGAACCATGG + Intergenic
1041089367 8:54288047-54288069 CCCTGCTGAGGGCAGGACCAGGG - Intergenic
1041388780 8:57330821-57330843 CACTGCTCACAGCTGGCCCATGG + Intergenic
1041659026 8:60382961-60382983 CTCTTCAGATAGCAGGGCCCAGG + Intergenic
1041945927 8:63442895-63442917 GGCTGCTGACACCATGGCCAGGG - Intergenic
1042084701 8:65094641-65094663 CTCTTCTGCCAGCAGGGCAGAGG + Intergenic
1046748425 8:117900651-117900673 CTCTGCTGACTCCAAGCCCAAGG - Intronic
1048282290 8:133114347-133114369 CCCTGGGGACAGCAGGGCCTGGG - Intronic
1048706714 8:137161842-137161864 CTCTTCTGGCAGCATGGACAGGG - Intergenic
1048846302 8:138606371-138606393 CTCTGCTTACCGGAGGCCCACGG + Exonic
1048877742 8:138850399-138850421 CGCAGCTGTCAGCAGGTCCAGGG - Intronic
1048935766 8:139355419-139355441 CTCAGGTGACAGCCGGGCCCAGG + Intergenic
1049402904 8:142438378-142438400 CTCTGCTGACACCTGGGTCTTGG - Intergenic
1049553199 8:143270144-143270166 AGCTGCTGACAGCAGGGGCAAGG + Intronic
1051073048 9:13196148-13196170 CTCTGCTGACAAAATGGCAAAGG - Exonic
1051129350 9:13842032-13842054 CTCTGCTGAGTGCAAGGGCAGGG + Intergenic
1051547563 9:18293489-18293511 CTGTGCTACCAGCAGGCCCACGG - Intergenic
1054899674 9:70356013-70356035 CTCTGATAAAGGCAGGGCCAGGG - Intergenic
1055514851 9:77023864-77023886 CTCTCCTGAAAGCAGGACCGAGG - Intergenic
1057234119 9:93345565-93345587 TGATGCTGACAGCAGGGACATGG + Intronic
1057505152 9:95627469-95627491 CCCTGCTGACAGGAGGGTCCTGG - Intergenic
1057818886 9:98316025-98316047 CCCTGCAGACATCAGGGTCAGGG + Intronic
1058751153 9:108039481-108039503 CTCTTCGGGTAGCAGGGCCAAGG + Intergenic
1059334001 9:113557312-113557334 TGCTGCTGCCAGAAGGGCCAGGG + Intronic
1060611420 9:124968831-124968853 TTCTGCTGGCCGCAGGGCCCAGG + Intronic
1062179670 9:135184572-135184594 CTCTTCTTAGAGCAGGGACAGGG - Intergenic
1062199105 9:135291711-135291733 CTCCTCTACCAGCAGGGCCATGG - Intergenic
1062266606 9:135689447-135689469 CCCGGCTGCCAGCTGGGCCAGGG + Intergenic
1062502939 9:136858987-136859009 CTTGTCTGAGAGCAGGGCCAGGG - Exonic
1186149095 X:6655354-6655376 TTCTCCTGAGAGCAGAGCCAGGG - Intergenic
1186930638 X:14385465-14385487 CACTGCAGACAGGAGGGTCATGG - Intergenic
1191654793 X:63584977-63584999 CTGTGGTGACAGCAGGGCAGAGG + Intergenic
1192423829 X:71058062-71058084 CTATGCTAACAGCAGGGCTGGGG - Intronic
1192996036 X:76514245-76514267 CTCAGCTGACATCAATGCCAGGG + Intergenic
1197649773 X:129051939-129051961 CTTAGCTGACAGCAGGGCCCGGG + Intergenic
1199606614 X:149584097-149584119 CTCAGCTGACACAAGGGGCAGGG + Intronic
1199632509 X:149785271-149785293 CTCAGCTGACACAAGGGGCAGGG - Intronic
1199735795 X:150685697-150685719 CTCTGCTGAGAGCACTCCCAAGG - Intergenic
1199850890 X:151724395-151724417 CTCTGCTTTGAGCAGGGCCCAGG - Intergenic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200063743 X:153495187-153495209 CACTGGGGACAGCAGGACCAGGG - Intronic
1200906519 Y:8488965-8488987 TTTTACTGACAGCAGGGCCCAGG - Intergenic