ID: 926112979

View in Genome Browser
Species Human (GRCh38)
Location 2:10194586-10194608
Sequence CCGGGGCCCACCGGTGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926112979_926112995 14 Left 926112979 2:10194586-10194608 CCCCAACCACCGGTGGGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 926112995 2:10194623-10194645 CTGGTGTCCCGTGCCCAGCATGG 0: 1
1: 0
2: 3
3: 24
4: 170
926112979_926112996 15 Left 926112979 2:10194586-10194608 CCCCAACCACCGGTGGGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 926112996 2:10194624-10194646 TGGTGTCCCGTGCCCAGCATGGG 0: 1
1: 0
2: 2
3: 10
4: 122
926112979_926112988 -10 Left 926112979 2:10194586-10194608 CCCCAACCACCGGTGGGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 926112988 2:10194599-10194621 TGGGCCCCGGGTGGCTTGGCCGG 0: 1
1: 0
2: 2
3: 20
4: 247
926112979_926112991 -5 Left 926112979 2:10194586-10194608 CCCCAACCACCGGTGGGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 926112991 2:10194604-10194626 CCCGGGTGGCTTGGCCGGCCTGG 0: 1
1: 0
2: 1
3: 81
4: 914
926112979_926112998 21 Left 926112979 2:10194586-10194608 CCCCAACCACCGGTGGGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 926112998 2:10194630-10194652 CCCGTGCCCAGCATGGGCTCTGG 0: 1
1: 0
2: 1
3: 29
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926112979 Original CRISPR CCGGGGCCCACCGGTGGTTG GGG (reversed) Intronic
900171038 1:1268972-1268994 CCGGGCCCCACAGGGGTTTGGGG + Intronic
900417242 1:2540766-2540788 CCGGGGCGCACGGGGGGTGGGGG - Intergenic
900440754 1:2653964-2653986 CCGATGCTCACCTGTGGTTGTGG - Intronic
900441577 1:2658218-2658240 CCGATGCTCACCTGTGGTTGTGG - Intronic
900442940 1:2665241-2665263 CCGATGCTCACCTGTGGTTGTGG - Intronic
900443833 1:2669857-2669879 CCGATGCTCACCTGTGGTTGTGG - Intronic
900444364 1:2672628-2672650 CCGATGCTCACCTGTGGTTGTGG - Intronic
900444835 1:2675035-2675057 CCGATGCTCACCTGTGGTTGTGG - Intronic
900445266 1:2677284-2677306 CCGATGCTCACCTGTGGTTGTGG - Intronic
900445445 1:2678247-2678269 CCGATGCTCACCTGTGGTTGTGG - Intronic
900445978 1:2681018-2681040 CCGATGCTCACCTGTGGTTGTGG - Intronic
900446252 1:2682463-2682485 CCGATGCTCACCTGTGGTTGTGG - Intronic
900446829 1:2685393-2685415 CCGATGCTCACCTGTGGTTGTGG - Intronic
900447494 1:2688645-2688667 CAGAGGCTCACCTGTGGTTGTGG - Intronic
900448332 1:2692860-2692882 CCGATGCTCACCTGTGGTTGTGG - Intronic
900449148 1:2696915-2696937 CAGAGGCTCACCTGTGGTTGTGG - Intronic
900449582 1:2699045-2699067 CCGATGCTCACCTGTGGTTGTGG - Intronic
900450346 1:2746425-2746447 CAGAGGCTCACCTGTGGTTGTGG - Intronic
900451805 1:2753812-2753834 CCGATGCTCACCTGTGGTTGTGG - Intronic
900452616 1:2757866-2757888 CAGAGGCTCACCTGTGGTTGTGG - Intronic
900453047 1:2759996-2760018 CCGATGCTCACCTGTGGTTGTGG - Intronic
900507886 1:3038777-3038799 CCCGGGCCCTCAGGGGGTTGCGG + Intergenic
900933417 1:5750800-5750822 CCAGGGCCCAACAGTGGTTGTGG + Intergenic
901800688 1:11706423-11706445 CCGGGCCCCGCCGGCGGTGGTGG - Exonic
902513106 1:16976697-16976719 CTGGGGCCTACCTGGGGTTGGGG + Exonic
903121061 1:21217491-21217513 CCGGGGCCGGCAGGGGGTTGGGG - Intronic
903867858 1:26411630-26411652 CCGGAGCCCACCCGTGGATATGG - Intronic
907829514 1:58051202-58051224 CTGGGGCCCATCGGGGGCTGGGG - Intronic
908400500 1:63768586-63768608 CCGGGGCCCATTGGAGGTTGGGG - Intergenic
908786736 1:67741967-67741989 CCTGGGCCCACAGGTGGCTGAGG + Intronic
910449527 1:87331555-87331577 CCGGGGCCCGGCGGGGGCTGGGG + Intronic
911807923 1:102234895-102234917 CCAGAGCCCACCAGTGGTGGGGG + Intergenic
912774669 1:112498080-112498102 CCGGGGCCTATCGGGGGTTGGGG - Intronic
915450783 1:156003537-156003559 CCGGGGCTCACGGCTTGTTGTGG + Intronic
917997435 1:180455358-180455380 CCAGGGCCTATCGGGGGTTGGGG + Intronic
918709626 1:187710722-187710744 CTGGGGCCCAACTGGGGTTGGGG - Intergenic
920108998 1:203574012-203574034 CTGGGGCCTACCGGAGGGTGGGG - Intergenic
922526442 1:226308492-226308514 CCTGGGACCACAGGTGGCTGTGG - Intronic
1065000978 10:21337306-21337328 CTGGGGCCTACCGGAGGGTGGGG - Intergenic
1066984432 10:42452760-42452782 CTGGGGCCCATCGGGGGTGGGGG - Intergenic
1068004265 10:51374247-51374269 CCGGGGCCTGTCGGGGGTTGGGG - Intronic
1068322988 10:55444121-55444143 CCGGGGCCTATCGGGGGGTGGGG + Intronic
1070150309 10:73801129-73801151 CCGGGGCACGCAGGTGGTTGTGG - Exonic
1075489967 10:122858390-122858412 CCGGGGCCTATCGTTGGGTGAGG + Intronic
1075841292 10:125506403-125506425 CCGGGGCCTATTGGGGGTTGGGG + Intergenic
1077177187 11:1196272-1196294 CCCAGGCCCACAGGTGGCTGCGG + Intronic
1077333598 11:1993957-1993979 CCAGGGCCCACAGCTGGATGGGG + Intergenic
1077600412 11:3570782-3570804 CCAGGGCCCATCGGGGGTGGGGG + Intergenic
1077967463 11:7150479-7150501 CCGCGGCCTATCGGTGGGTGGGG + Intergenic
1080040693 11:27756616-27756638 CCGGGGCCTGTCGGGGGTTGGGG - Intergenic
1080155987 11:29111594-29111616 CCAGGGCCTATCGGGGGTTGGGG - Intergenic
1081046369 11:38278683-38278705 CCGGAGCCCACTGGTAGTGGGGG + Intergenic
1084256325 11:67945397-67945419 CCAGGGCCCATCGGGGGTGGGGG + Intergenic
1085401121 11:76236144-76236166 GCGGGTCCCGCCGGTGGTTGAGG - Intergenic
1085845745 11:80062507-80062529 CCGGGGCCTGTCGGGGGTTGGGG + Intergenic
1087207427 11:95411787-95411809 CCGGGGCCTATCGGGGGGTGGGG + Intergenic
1089494128 11:118899922-118899944 CCGGAGCCCTGCGGTGGTGGTGG + Exonic
1089665017 11:120012899-120012921 CAGGGGCCCACCTGGGCTTGTGG - Intergenic
1202816578 11_KI270721v1_random:49139-49161 CCAGGGCCCACAGCTGGATGGGG + Intergenic
1092550791 12:9496981-9497003 CCGGGGCCTGTCGGGGGTTGGGG + Intergenic
1094254578 12:28408138-28408160 CCAGGGCCTACTGGGGGTTGGGG - Intronic
1094474389 12:30830102-30830124 CCGGGCCCCTCAGGGGGTTGGGG - Intergenic
1094521027 12:31189388-31189410 CCGGGGCCTGTCGGGGGTTGGGG - Intergenic
1094761659 12:33540064-33540086 CCGGGGCCTGTCGGTGGGTGGGG + Intergenic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096648284 12:53049789-53049811 CCCGGCCCCACCGGGGGTGGGGG + Intronic
1099268977 12:80483738-80483760 CCGGGGCCTGTCGGTGGGTGGGG - Intronic
1100399109 12:94212479-94212501 CCGGGGCCTGCCGGGGGGTGGGG - Intronic
1101691373 12:107085647-107085669 CCGGGGCCTGCCAGGGGTTGAGG + Intronic
1103403495 12:120659135-120659157 CCGGGGGCCACCAGTGCTTCTGG - Intronic
1104881266 12:132072209-132072231 CCCGGGCCCTCCGGAGGCTGAGG - Intronic
1107550916 13:41474508-41474530 CCGGGGCCTATTGGGGGTTGGGG - Intergenic
1110796027 13:79639372-79639394 CCGGGGCCTATCGGCGGATGGGG - Intergenic
1114645742 14:24255161-24255183 CCGGGGCTCAGCGGAGGATGTGG - Exonic
1115265950 14:31500474-31500496 CCGGGGCCTGTCGGTGGGTGGGG + Intronic
1117497600 14:56321082-56321104 CCCGGGAACACTGGTGGTTGGGG - Intergenic
1117930772 14:60838711-60838733 CAGCTGCCCACCTGTGGTTGTGG + Intronic
1118336892 14:64861186-64861208 CCAGGGCCTATCGGGGGTTGGGG + Intronic
1120430864 14:84413038-84413060 CTGGGGCCTGCCGGGGGTTGGGG - Intergenic
1122316363 14:100828027-100828049 CCAGAGCCCACCTGTGGCTGCGG - Intergenic
1122985113 14:105208336-105208358 GCTTGGCCCACAGGTGGTTGAGG - Intergenic
1125724705 15:41862376-41862398 CATGGGCCCTCCTGTGGTTGAGG - Intronic
1127317297 15:57809307-57809329 CCAGGGCCTGCCGGGGGTTGGGG - Intergenic
1128151389 15:65365535-65365557 CCTGGGCCCAACCCTGGTTGGGG - Intronic
1128532559 15:68464618-68464640 CAGGGGCCTGCCGGTGATTGTGG - Intergenic
1128804486 15:70520694-70520716 CCAGGTCCCATGGGTGGTTGGGG - Intergenic
1131263350 15:90901463-90901485 CCGGGGCCTGTCGGGGGTTGGGG + Intergenic
1134418184 16:14062558-14062580 CAGGGGCTCACCGGGGGTAGTGG - Intergenic
1135174692 16:20217435-20217457 GAGGGGCCCACTGGAGGTTGAGG - Intergenic
1136465494 16:30440725-30440747 CCAGGGCCCATTGGGGGTTGGGG - Intergenic
1137456683 16:48623127-48623149 CCGGGTCCTATCGGTGGGTGGGG - Intergenic
1137557934 16:49484518-49484540 CCGCGGCCCCCAGGTGGGTGGGG + Intergenic
1138465407 16:57186418-57186440 CCCGGGCCCACCGGAGGGAGGGG - Exonic
1142300398 16:89254483-89254505 CCGGGGCCTGTCGGTGGGTGGGG - Intergenic
1142518854 17:491386-491408 CCGGGGCCAACAGGCGGCTGCGG - Intergenic
1144043428 17:11433236-11433258 CCGGGGCCTGTCGGTGGGTGGGG - Intronic
1144782447 17:17814824-17814846 CGGGGACTCACCGGTGGTGGTGG + Exonic
1146167325 17:30600420-30600442 CCGGAGCCGACCAGTGGTGGCGG + Intergenic
1151437140 17:74104829-74104851 CAGGGGCCCAGGGGTGGTAGCGG + Intergenic
1151817592 17:76478921-76478943 CCGGGGGTCAGCGGTGGGTGCGG + Exonic
1152245586 17:79183148-79183170 GCGGGGGCCACCGGTGGCGGCGG + Intronic
1152979989 18:267818-267840 CCGGGCCCCGTCGGAGGTTGAGG - Intronic
1154216510 18:12420319-12420341 CCGTGTCCCACGGGTGGCTGCGG - Exonic
1160843270 19:1155805-1155827 CAGGGGCCCACCAGTGCTAGGGG + Intronic
1162966932 19:14160520-14160542 CCAGGGCCCAGCGGGGGTCGTGG - Intronic
1163686639 19:18715620-18715642 CCCGGGGCCACAGGTGGCTGAGG - Intronic
1163829277 19:19540097-19540119 CCGGTGCCCACCGGGGGAGGGGG + Intronic
1164485048 19:28648962-28648984 CAGTGGCCCACCAGTGCTTGTGG - Intergenic
1165738794 19:38193717-38193739 CCGGGGCCGACGGGCGGGTGGGG - Exonic
1165859395 19:38899420-38899442 CCGGGGCCCAAGGGTGGCCGCGG - Intronic
1165994247 19:39833283-39833305 GCGGGGCCCACGGGGGGCTGGGG + Exonic
1166123591 19:40700402-40700424 CCGGGTCCCAGCCGTGGTTAAGG - Exonic
925985092 2:9208066-9208088 CCAGGGGCCACCGTTGGCTGTGG + Intronic
926112979 2:10194586-10194608 CCGGGGCCCACCGGTGGTTGGGG - Intronic
933489469 2:82967258-82967280 CCGGTTGCCACTGGTGGTTGGGG + Intergenic
935983451 2:108649805-108649827 CCGGGGCCTGTCGGTGGGTGGGG + Intronic
939812081 2:146846019-146846041 CCGGGGCCTGTCGGGGGTTGGGG + Intergenic
940572252 2:155452782-155452804 CCGGGGCCTATCGGGGGTGGTGG + Intergenic
944335704 2:198531356-198531378 CCGGGGCCTGTCGGGGGTTGGGG + Intronic
946375031 2:219302721-219302743 CCTTTGCCCACTGGTGGTTGTGG + Exonic
947792682 2:232876958-232876980 CCGGGGCCCGCCGCTCCTTGAGG + Intronic
948781457 2:240324229-240324251 CCGGGCCCCACTGCTGTTTGAGG - Intergenic
948987349 2:241533503-241533525 CTGGTGCCTTCCGGTGGTTGTGG - Intergenic
949004620 2:241637982-241638004 CCGGAGCGCTCCGGAGGTTGTGG + Intronic
1171457874 20:25282155-25282177 CCGGGCCCCACCCGTGCCTGTGG + Intronic
1173873747 20:46357213-46357235 CCGGGGCCCATGGCTGGTAGAGG - Intronic
1175919943 20:62446128-62446150 CCGGGGGCCACAGGTGGTGAGGG + Intergenic
1176654116 21:9574645-9574667 CCAGGGCCCACTGGAGGTTTGGG - Intergenic
1177764313 21:25439459-25439481 CCGGGGCCTGTCGGGGGTTGGGG + Intergenic
1179311490 21:40199762-40199784 CCGGGGCCTGTCGGTGGGTGGGG + Intronic
1181767323 22:25101196-25101218 CCTGGGCCACCCGGTGGTTCTGG - Intronic
1184152304 22:42646242-42646264 CCTGGGCCCCCAGGTGGCTGGGG - Intronic
1185089780 22:48759374-48759396 CCGGGGCCCTCCGGGGTCTGTGG - Intronic
949194227 3:1286351-1286373 CTGGGGCCTACTGGGGGTTGGGG - Intronic
949711121 3:6872617-6872639 CCGGGGCCTGTCGGGGGTTGGGG - Intronic
952521040 3:34158136-34158158 CCGGGGCCTGTCGGTGGGTGGGG - Intergenic
953449123 3:42991654-42991676 CCTGGGCCCAGCGGAGGTGGAGG + Intronic
953627070 3:44580129-44580151 CCTGGGACCTCCTGTGGTTGGGG + Intronic
954515259 3:51169573-51169595 CCGGGGCCCACCTGAGGATGAGG + Intronic
957071233 3:75569434-75569456 CCAGGGCCCATCGGGGGTTGGGG + Intergenic
957564383 3:81865675-81865697 CTGAGGCACTCCGGTGGTTGAGG - Intergenic
958883358 3:99697970-99697992 CCGGGGCCTATCAGTGGGTGAGG - Intronic
964245708 3:154650205-154650227 CTGGGGCCTGCCGGGGGTTGGGG + Intergenic
966238645 3:177730253-177730275 CCAGGGCCCACCCGTGGTCGTGG - Intergenic
968566183 4:1314557-1314579 CCAGAGCCCACCAGTGGGTGGGG + Intronic
969448382 4:7258302-7258324 CCGGGGCCTGTCGGTGGGTGTGG - Intronic
969715871 4:8867843-8867865 CGGGGGCCCAGCGGCGGCTGCGG + Exonic
970006882 4:11419465-11419487 CCGGGGCCTGTCGGAGGTTGGGG + Intronic
970669182 4:18376672-18376694 CCGGGGCCTATCGGGGGTGGGGG - Intergenic
972660980 4:41116301-41116323 CCGGGGCCTGTCGGTGGGTGGGG + Intronic
973661470 4:53111173-53111195 CCGGGGCCTACTGGTGGGTGGGG + Intronic
978036806 4:104004891-104004913 CCGGGGCCTACTGGGGGTTTGGG + Intergenic
980431104 4:132697515-132697537 CCGGGGCCTGTCGGGGGTTGGGG - Intergenic
981424371 4:144586290-144586312 CCGGGGCCCACTGGGGATTGGGG - Intergenic
982292112 4:153790935-153790957 CCGGGGCCGGCGGGGGGTTGGGG - Intergenic
983103844 4:163660390-163660412 CCGGGGCCTGTCGGTGGGTGGGG + Intronic
983835361 4:172377618-172377640 CGGGAGCCCACCGGTTGTGGGGG + Intronic
987894575 5:23927491-23927513 CCGGGGCCTGTCGGGGGTTGGGG - Intergenic
993619637 5:90152710-90152732 CCGGGGCCTACCGTGGGGTGGGG + Intergenic
994043528 5:95284382-95284404 CCTGTGCCCACCGGGGGTGGCGG + Exonic
998042956 5:138964985-138965007 CAGGGGCCCACCAGGGGCTGAGG + Intronic
998542505 5:142996028-142996050 CCGGGGCCTACTGGGGGGTGGGG + Intronic
998674380 5:144390680-144390702 CCGGGGCCCGTCGGGGGTAGGGG - Intronic
999255146 5:150205866-150205888 CCAGGTCCCACCGTGGGTTGGGG + Intronic
1001201912 5:169725660-169725682 CCGGGGCCTGTCGGGGGTTGGGG - Intronic
1003263897 6:4549758-4549780 CCGGGGCGCACTGGGGCTTGCGG + Intergenic
1004262275 6:14118371-14118393 CTGGAGGCCACCTGTGGTTGTGG + Intronic
1010138255 6:72581343-72581365 CCGGGGCCTATCGGTTGGTGGGG - Intergenic
1010412449 6:75575890-75575912 CCAGGGCCAATCGGTGGTGGTGG + Intergenic
1010487839 6:76436729-76436751 CCGGGGCCTATCGTTGGGTGGGG + Intergenic
1010552981 6:77245798-77245820 CCGGGGCTAATCAGTGGTTGAGG + Intergenic
1017647004 6:156548540-156548562 CTTGGGCCCACTGGTGTTTGAGG - Intergenic
1017647012 6:156548586-156548608 CTTGGGCCCACTGGTGTTTGAGG - Intergenic
1018993307 6:168691420-168691442 CCGGGGCCTGTCGGTGGGTGGGG + Intergenic
1022113008 7:27243007-27243029 CCGGGGCTCTCCGGTGGGGGAGG - Exonic
1023171074 7:37390858-37390880 CCAGGGCACACAGGTGGCTGGGG + Intronic
1024660276 7:51486517-51486539 CCGGGGCCTACTGGGGGGTGGGG - Intergenic
1024736944 7:52315502-52315524 CCGGGGCCTGTCGGTGGGTGGGG + Intergenic
1025280467 7:57623319-57623341 CCAGGGCCCACTGGAGGTTTGGG - Intergenic
1025304264 7:57842188-57842210 CCAGGGCCCACTGGAGGTTTGGG + Intergenic
1029530566 7:101122456-101122478 CCAGGGCCCACCAGTGGGTGGGG + Intergenic
1029968859 7:104769613-104769635 CCGGGGCCTGTCGGGGGTTGGGG - Intronic
1031710560 7:125040712-125040734 CCAGGGCCTATCGGGGGTTGGGG + Intergenic
1035749689 8:1987886-1987908 CCGGGGCCCGTCGGGGGCTGGGG - Intronic
1036244178 8:7102524-7102546 CCGGGGCCCGTCGGGGGTGGGGG - Intergenic
1036256563 8:7211216-7211238 CCGGGGCCCATCGGGGGTGGGGG + Intergenic
1036308613 8:7669801-7669823 CCGGGGCCCATCGGGGGTGGGGG + Intergenic
1036360924 8:8076276-8076298 CCGGGGCCCATCGAGGGTGGGGG - Intergenic
1036890042 8:12590725-12590747 CCGGGGCCCATCGGGGGTGGGGG + Intergenic
1038082770 8:24158696-24158718 CCGGGGCCTGTCGGTTGTTGGGG - Intergenic
1039764779 8:40616723-40616745 CCGGGGCCTGCCGTGGGTTGGGG + Intronic
1048176561 8:132157832-132157854 CCGGGGCCTGTCGGTGGATGGGG - Intronic
1049004245 8:139844845-139844867 CCGGGGCCCCCAGCTGGCTGCGG + Intronic
1049168382 8:141141338-141141360 CCGGGGGCCAGGGGTGGTAGGGG + Intronic
1051505198 9:17819174-17819196 CCAGGGCCTGCCGGTGGGTGGGG + Intergenic
1055321684 9:75088549-75088571 CCGGCGCCCACCCTTGGCTGCGG - Exonic
1056692597 9:88820802-88820824 CCGGGGCCTGTCGGGGGTTGGGG - Intergenic
1056772751 9:89491850-89491872 CCGGGGCCCACAGATGCATGGGG - Intronic
1059285985 9:113172002-113172024 CCGGGGCCTGTCGGGGGTTGGGG - Intronic
1060329226 9:122650236-122650258 CCGGGGCCTGTCGGTGGGTGGGG + Intergenic
1062718750 9:138023863-138023885 GCGGGCCCCAGCGGTGGCTGCGG + Intronic
1203631839 Un_KI270750v1:78103-78125 CCAGGGCCCACTGGAGGTTTGGG - Intergenic
1185695452 X:2190886-2190908 CCGGGGCCTGCTGGGGGTTGGGG + Intergenic
1187661480 X:21551202-21551224 CCGGGGCCTTTCGGGGGTTGGGG + Intronic
1187702762 X:21979357-21979379 CCGGGGCCGATCGGGGGTAGGGG - Intronic
1189215138 X:39316543-39316565 CCGGGGCCTATCGGGGGGTGGGG + Intergenic
1189446617 X:41086145-41086167 CCGGGGCCAACAGCTGGATGTGG + Intronic
1191163433 X:57360830-57360852 CCGGGGCCTGTCGGTGGGTGGGG - Intronic
1191677176 X:63803737-63803759 CCGGGGCCTGCTGGGGGTTGGGG + Intergenic
1191771928 X:64770184-64770206 CCGGGGCCCATTGGGGGCTGGGG - Intergenic
1191796179 X:65024093-65024115 CCGGGGCCTATCGGCGGGTGGGG + Intronic
1192496977 X:71622699-71622721 CCGGGCCCCACCTGTGGTCAAGG + Intergenic
1192957564 X:76089403-76089425 CTGGGGCCCATCGGGGGGTGAGG - Intergenic
1194911535 X:99650884-99650906 CCGGGGCCTGTCGGTGGGTGGGG - Intergenic
1198135426 X:133744999-133745021 CCGGGGCCTGTCGGTGGGTGGGG + Intronic
1199930631 X:152515926-152515948 CCGGGGCCCGTCGGGGGTTGGGG + Intergenic