ID: 926116035

View in Genome Browser
Species Human (GRCh38)
Location 2:10214064-10214086
Sequence CCATTTTGTTCTTGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17532
Summary {0: 1, 1: 5, 2: 113, 3: 1982, 4: 15431}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926116035 Original CRISPR CCATTTTGTTCTTGTTGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr