ID: 926119114 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:10231950-10231972 |
Sequence | TCTCATAACTGTTGATGGCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
926119114_926119117 | -1 | Left | 926119114 | 2:10231950-10231972 | CCCTGCCATCAACAGTTATGAGA | No data | ||
Right | 926119117 | 2:10231972-10231994 | ACAGACTTACCGACGCCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
926119114 | Original CRISPR | TCTCATAACTGTTGATGGCA GGG (reversed) | Intergenic | ||