ID: 926119115

View in Genome Browser
Species Human (GRCh38)
Location 2:10231951-10231973
Sequence GTCTCATAACTGTTGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926119115_926119117 -2 Left 926119115 2:10231951-10231973 CCTGCCATCAACAGTTATGAGAC No data
Right 926119117 2:10231972-10231994 ACAGACTTACCGACGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926119115 Original CRISPR GTCTCATAACTGTTGATGGC AGG (reversed) Intergenic