ID: 926119116

View in Genome Browser
Species Human (GRCh38)
Location 2:10231955-10231977
Sequence GTCTGTCTCATAACTGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926119116_926119117 -6 Left 926119116 2:10231955-10231977 CCATCAACAGTTATGAGACAGAC No data
Right 926119117 2:10231972-10231994 ACAGACTTACCGACGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926119116 Original CRISPR GTCTGTCTCATAACTGTTGA TGG (reversed) Intergenic
No off target data available for this crispr