ID: 926119117

View in Genome Browser
Species Human (GRCh38)
Location 2:10231972-10231994
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926119114_926119117 -1 Left 926119114 2:10231950-10231972 CCCTGCCATCAACAGTTATGAGA No data
Right 926119117 2:10231972-10231994 ACAGACTTACCGACGCCTCCAGG No data
926119116_926119117 -6 Left 926119116 2:10231955-10231977 CCATCAACAGTTATGAGACAGAC No data
Right 926119117 2:10231972-10231994 ACAGACTTACCGACGCCTCCAGG No data
926119115_926119117 -2 Left 926119115 2:10231951-10231973 CCTGCCATCAACAGTTATGAGAC No data
Right 926119117 2:10231972-10231994 ACAGACTTACCGACGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type