ID: 926119629

View in Genome Browser
Species Human (GRCh38)
Location 2:10235041-10235063
Sequence GCTGATGGGGAGCAGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926119629_926119637 11 Left 926119629 2:10235041-10235063 CCTTCTGGCTGCTCCCCATCAGC No data
Right 926119637 2:10235075-10235097 CCAGACCCTCCCTACTTTTCTGG No data
926119629_926119644 26 Left 926119629 2:10235041-10235063 CCTTCTGGCTGCTCCCCATCAGC No data
Right 926119644 2:10235090-10235112 TTTTCTGGAGACATCCCTTGGGG No data
926119629_926119645 29 Left 926119629 2:10235041-10235063 CCTTCTGGCTGCTCCCCATCAGC No data
Right 926119645 2:10235093-10235115 TCTGGAGACATCCCTTGGGGAGG No data
926119629_926119642 24 Left 926119629 2:10235041-10235063 CCTTCTGGCTGCTCCCCATCAGC No data
Right 926119642 2:10235088-10235110 ACTTTTCTGGAGACATCCCTTGG No data
926119629_926119643 25 Left 926119629 2:10235041-10235063 CCTTCTGGCTGCTCCCCATCAGC No data
Right 926119643 2:10235089-10235111 CTTTTCTGGAGACATCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926119629 Original CRISPR GCTGATGGGGAGCAGCCAGA AGG (reversed) Intergenic
No off target data available for this crispr