ID: 926120245

View in Genome Browser
Species Human (GRCh38)
Location 2:10237804-10237826
Sequence CAAGGTCACCCATCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926120237_926120245 14 Left 926120237 2:10237767-10237789 CCTCCCATTTTATGGGCAAGAAT No data
Right 926120245 2:10237804-10237826 CAAGGTCACCCATCTGGTGTTGG No data
926120238_926120245 11 Left 926120238 2:10237770-10237792 CCCATTTTATGGGCAAGAATACA No data
Right 926120245 2:10237804-10237826 CAAGGTCACCCATCTGGTGTTGG No data
926120239_926120245 10 Left 926120239 2:10237771-10237793 CCATTTTATGGGCAAGAATACAG No data
Right 926120245 2:10237804-10237826 CAAGGTCACCCATCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926120245 Original CRISPR CAAGGTCACCCATCTGGTGT TGG Intergenic
No off target data available for this crispr