ID: 926120716

View in Genome Browser
Species Human (GRCh38)
Location 2:10239925-10239947
Sequence CAGGGTGCTGTTGGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926120704_926120716 14 Left 926120704 2:10239888-10239910 CCCCCAGCGCAGACAGGGCCTCA No data
Right 926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG No data
926120709_926120716 -4 Left 926120709 2:10239906-10239928 CCTCATCGGTAGCTGCACTCAGG No data
Right 926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG No data
926120706_926120716 12 Left 926120706 2:10239890-10239912 CCCAGCGCAGACAGGGCCTCATC No data
Right 926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG No data
926120707_926120716 11 Left 926120707 2:10239891-10239913 CCAGCGCAGACAGGGCCTCATCG No data
Right 926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG No data
926120705_926120716 13 Left 926120705 2:10239889-10239911 CCCCAGCGCAGACAGGGCCTCAT No data
Right 926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG No data
926120703_926120716 18 Left 926120703 2:10239884-10239906 CCGGCCCCCAGCGCAGACAGGGC No data
Right 926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926120716 Original CRISPR CAGGGTGCTGTTGGGGAGGA AGG Intergenic
No off target data available for this crispr